Next Article in Journal
Association Between Dietary Acid Load and Excess Weight in Adults: A Cross-Sectional Study
Previous Article in Journal
Standardized Hibiscus–Inulin Shot Lowers Lipid–Glucose Indices in Adults with Overweight and Obesity: 8-Week Randomized Trial
Previous Article in Special Issue
Propolis Modulates the Gut Microbiota–Gut Hormone–Liver AMPK Axis to Ameliorate High-Fat Diet-Induced Metabolic Disorders in Rats
 
 
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Lactiplantibacillus plantarum Lp20 Alleviates High Fat Diet-Induced Obesity in Mice via Its Bile Salt Hydrolase Activity

1
College of Food Science and Nutritional Engineering, China Agricultural University, Beijing 100083, China
2
Key Laboratory of Precision Nutrition and Food Quality, Department of Nutrition and Health, China Agricultural University, Beijing 100190, China
3
School of Food and Health, Beijing Technology and Business University, Beijing 100048, China
*
Authors to whom correspondence should be addressed.
Nutrients 2025, 17(22), 3555; https://doi.org/10.3390/nu17223555
Submission received: 14 October 2025 / Revised: 8 November 2025 / Accepted: 12 November 2025 / Published: 14 November 2025
(This article belongs to the Special Issue Effect of Dietary Components on Gut Homeostasis and Microbiota)

Abstract

Background: Obesity is a highly prevalent chronic disease characterized by excessive weight gain and fat accumulation. There is growing evidence that Lactiplantibacillus plantarum strains with bile salt hydrolase (BSH) activity are effective in preventing and alleviating obesity. Methods: Initially, we screened bacterial strains with high hydrolytic activity against glycochenodeoxycholic acid (GDCA), and constructed an isogenic bsh1 knockout mutant. Subsequently, male C57BL/6J mice fed a high-fat diet (HFD) were randomly assigned to receive daily gavage of either the wild-type Lp20 (Lp20-WT) or the bsh1-deficient mutant (Lp20-Δbsh1) for 8 weeks. Serum cholesterol levels and histopathological changes in liver sections were monitored. Hepatic gene expression was quantified by RT-qPCR, and fecal bacterial communities were analyzed via 16S rRNA gene sequencing. These comprehensive assessments aimed to evaluate metabolic improvements and uncover the potential mechanisms behind the observed effects. Results: L. plantarum Lp20 hydrolyzed 91.62% of GDCA, exhibiting the highest bile-salt hydrolase (BSH) activity among tested isolates. Whole-genome sequencing and in-silico analyses mapped this activity to bsh1; gene deletion of bsh1 confirmed the role of bsh1 in GDCA hydrolysis. Daily gavage of the wild-type strain (Lp20-WT) to diet-induced obese mice markedly attenuated weight gain, reduced inguinal white adipose tissue and mesenteric fat mass, and lowered serum TC and LDL-C by 20.8% and 33.3%, respectively, while decreasing ALT and AST levels and reversing hepatic steatosis. In contrast, the bsh1-null mutant (Lp20-Δbsh1) failed to elicit any measurable metabolic benefit. Mechanistically, Lp20-WT upregulated rate-limiting bile-acid synthetic enzymes CYP7A1 and CYP27A1, thereby accelerating the catabolism of cholesterol into bile acids. Concurrently, it activated hepatic TGR5 and FXR signaling axes to modulate hepatic metabolism. Moreover, Lp20-WT restructured the gut microbiota by notably enhancing the abundance of beneficial bacteria such as norank_f__Muribaculaceae, Akkermansia, and Alistipes, while reducing the abundance of potentially harmful taxa, including norank_f__Desulfovibrionaceae, Dubosiella, and Mucispirillum. Conclusions: This study provides direct evidence of BSH’s anti-obesity effects through gene deletion. Specifically, BSH lowers cholesterol by modulating hepatic bile-acid metabolism-related gene expression and altering the gut microbiota composition. However, the study is limited by a small sample size (n = 6), the use of male mice only, and its preclinical stage, indicating a need for further validation across diverse strains and human populations.

1. Introduction

Obesity increased incidences of related comorbidities, such as type 2 diabetes, cardiovascular diseases and cancer [1,2]. According to the World Obesity Atlas 2023 report, the number of adults with obesity is projected to rise from 0.81 billion in 2020 to 1.53 billion in 2035. Most of these individuals will primarily reside in middle-income countries, which often have limited resources and infrastructure to address obesity adequately [3]. Low-harm, safe and effective intervention methods are urgently needed. Clinical studies have demonstrated that gut microbiota dysbiosis, which can trigger inflammation, is closely associated with obesity and its related health issues [4]. When fecal microbiota from obese individuals were transplanted into germ-free mice, the mice developed an obese phenotype, highlighting the critical role of microbiota disruption in obesity development [5]. In a cohort study, the supplementation with a probiotic containing two strains of Bifidobacterium and three strains of Lactobacillus (at a dosage of 500 billion CFU/day) for six months led to significant reductions in body weight, serum total cholesterol (TC), and low-density lipoprotein cholesterol (LDL-C) [6]. In another study, male Sprague-Dawley rats fed heat-inactivated or live Lactobacillus reuteri GMNL263 while on a high-fat diet (HFD) for 12 weeks showed marked decreases in body weight, serum glucose, and insulin levels [7]. Similarly, a 12-week intervention with Lactiplantibacillus plantarum Y44 not only alleviated lipid metabolism disorder by decreasing TC and LDL-C levels, but also reduced serum aspartate aminotransferase (AST) and alanine aminotransferase (ALT) in obese mice [8]. Probiotic intervention has emerged as a promising strategy for alleviating obesity. However, its efficacy is largely dependent on the bacterial strains employed. Thus, future probiotic trials should prioritize the selection and optimal pairing of strains to enhance intervention outcomes.
In recent years, there has been growing interest in the potential of modulating bile acid metabolism as a therapeutic approach for obesity and related metabolic disorders. Probiotics, as key microbial modulators of host metabolism, have been shown to play a role through specific metabolites or enzymes, such as bile salt hydrolase (BSH) [9,10]. Recent studies have highlighted the potential role of BSH in regulating lipid metabolism and ameliorating obesity-related syndrome. An in vitro experiment revealed that L. plantarum TCI378 with bile salts deconjugation ability reduced oil droplet accumulation and lipid metabolism in 3T3-L1 [11]. For in vivo assay, L. plantarum H-87 with a distinguished BSH activity exhibited a significant inhibitory effect on weight gain and lipid accumulation in HFD-fed mice [12]. Furthermore, the recombinant Escherichia coli MG1655 with bsh1 from Lactobacillus salivarius JCM1046 significantly reduced weight gain, LDL-C and triglyceride (TG) levels in obese mice [13]. L. acidophilus GOLDGUT-LA100 with high BSH activity was also demonstrate concrete anti-obesity benefit in HFD-induced obese mice [14].
Bile acids (BAs), synthesized in the liver, are stored within the gallbladder and released into the gastrointestinal tract following food ingestion [15]. BSH deconjugated tauro-conjugated or glycol-conjugated BAs in the small intestine, generating their corresponding free BAs [16]. The reduced solubility of these free BAs increases bile excretion, promoting the conversion of cholesterol to BAs. CYP7A1, the rate-limiting enzyme in bile acid biosynthesis, promotes hepatic cholesterol catabolism when expressed in the liver [17]. This effect contributes to the reduction of cholesterol levels and lipid absorption in the small intestine [18,19,20]. Due to this gateway efficacy, primary BAs can be further transformed into secondary bile acids (sBAs) by cecal and colonic microbiota [21,22]. Certain sBAs serve as ligands for multiple BA receptors, including the farnesoid X receptor (FXR) and Takeda G protein-coupled receptor (TGR5) [23]. Activation of FXR by deoxycholic acid (DCA) inhibits SREBP1c production, thereby reducing triglyceride synthesis and ameliorating hepatic steatosis [24,25,26]. As potent TGR5 agonists, lithocholic acid (LCA) and DCA stimulate intestinal GLP-1 secretion, thereby enhancing insulin sensitivity and glucose homeostasis in obese individuals [24]. Probiotic strains with high BSH activity have the potential to modulate bile acid composition, thereby influencing the activity of signaling pathways such as FXR and TGR5 and contributing to metabolic regulation.
In this study, Lp20, exhibiting the highest BSH activity among 23 BSH-positive strains, was selected and confirmed to be safe through hemolytic and antibiotic resistance tests. Genomic sequencing and bioinformatics analysis indicated that gene bsh1 was associated with BSH activity of Lp20. Subsequently, a bsh1 mutant strain of Lp20 was constructed by homologous double-overcrossing recombination. The Lp20-Δbsh1 strain was used as the negative control for Lp20 to investigate the correlation between probiotic BSH activity and its efficacy in reducing fat in the high fat diet-induced obese mice.

2. Materials and Methods

2.1. Bacterial Strains and Culture Condition

The bacterial strains and plasmids used in this study are listed in Table S1. The L. plantarum strain was anaerobically cultured at 37 °C in de Man, Rogosa, and Sharpe (MRS) medium. Escherichia coli DH5α, was grown at 37 °C in Luria–Bertani (LB) broth for 12 h with shaking at 220 rpm. The Lactococcus lactis NZ9000 strain was cultivated at 30 °C in M17 medium (Oxoid, Unipath, Basingstoke, UK) supplemented with 0.5% wt/vol glucose (GM17) for 14 h. When required, the media were supplemented with the appropriate antibiotics at the following concentrations: 100 µg/mL ampicillin for E. coli, 10 µg/mL chloramphenicol for L. lactis and 10 µg/mL erythromycin for L. plantarum.

2.2. BSH Activity Assays of L. plantarum

For the qualitative assay of BSH activity, the bile salt plate method was employed in this study [27,28]. Briefly, MRS agar plate was supplemented with 0.1% wt/vol glycodeoxycholic acid (GDCA, Sigma Aldrich, Saint Louis, MO, USA) and 0.1% wt/vol taurodeoxycholic acid (TDCA, Sigma Aldrich), respectively. The 23 L. plantarum strains were streaked onto the plates and subjected to anaerobic culture for 48 h, with three technical replicates. Positive results were indicated by the formation of a halo-like precipitate surrounding the colonies.
BSH activity was also analyzed quantitatively by the ninhydrin assay, which was a colorimetric test to determine the amount of amino acids released from individual BAs through BSH deconjugation [29,30,31]. Bacterial cells in the stationary phase were collected by centrifugation, washed with sodium phosphate buffer, and resuspended to OD600nm = 5.0. A 50 μL cell suspension was mixed with an equal volume of 20 mM bile salt substrate and incubated at 37 °C for 1 h. The reaction was terminated by the addition of 100 μL trichloroacetic acid. Then the mixture was centrifuged to collect 100 μL supernatant, which was then mixed with 900 μL ninhydrin. The reaction system was carried out in boiling water bath for 14 min and immediately transferred to an ice bath for color stabilization. Based on a standard curve, the OD at 570 nm was measured to determine the amino acid concentration. A standard curve was generated by plotting glycine concentration (mM) on the x-axis and OD570 values on the y-axis, and a regression equation was calculated. The concentration of amino acids generated from the hydrolysis of 5 mM conjugated bile salt substrate was determined using this standard curve, and the amount of bile salt hydrolysis was then calculated. BSH activity assays for each L. plantarum strain were performed in triplicate.
The bile salt hydrolysis rate was calculated using the following formula:
B i l e   s a l t   h y d r o l y s i s   r a t e   ( % )   =   C 5 × 100 %
5 stands for the initial concentration of bile salt substrates in the reaction system is 5 mM, C is the concentration of amino acids after substrate hydrolysis.

2.3. Draft Genome Sequencing and Comparative Analysis

The genome of Lp20 was extracted using the Bacterial Genome Extraction Kit (Tiangen, Beijing, China). Purified genome was sequenced and assembled by Beijing Novogene Bioinformatics Technology Co., Ltd. (Beijing, China). Genomic DNA samples were fragmented using the Covaris ultrasonic disruptor (Covaris Inc., Woburn, MA, USA), followed by the construction of a 350 bp short fragment library. Sequencing was performed on the Illumina NovaSeq PE150 platform (Illumina, San Diego, CA, USA). The raw data were processed using genome assembly tools including SOAP denovo, SPAdes and ABySS, and then was integrated with CISA. The assembly was further refined with GapCloser v1.12-ro, filtering out fragments below 500 bp, resulting in a draft genomic scaffold sequence. GeneMarkS 4.17 was employed for the prediction of coding genes. Subsequently, the protein sequences of structural genes were functionally annotated through Diamond alignment against universal databases including GO (Gene Ontology), KEGG (Kyoto Encyclopedia of Genes and Genomes), COG (Clusters of Orthologous Groups), NR (Non-Redundant Protein Database), Pfam, TCDB (Transporter Classification Database), and Swiss-Prot [32,33,34,35,36]. The alignment results with the highest score (minimum identity ≥ 40%, coverage ≥ 40%) were selected for annotation. The critical quality control metrics for the Lp20 genome assembly are detailed in Table S2.
Genome comparisons were conducted using BLAST v2.11.0. Circular genome maps were generated using the BRIG v0.95 JAVA script based on CGView [37]. Lp20 and WCFS1 were compared using SnapGene 6.0.2 to assess genomic structure, functional content, and similarity metrics such as ANI v1.34 and OrthoMCL v2.0.9, with differences evaluated based on unique genes, repeat elements, and divergence in virulence or antibiotic resistance genes.

2.4. Construction of bsh1 Deletion Mutant and Complemented Strains

The entire open reading frame of the bsh1 gene was deleted by the homologous double-overcrossing recombination. A schematic diagram of the suicide plasmid construction and bsh1 deletion is shown in Figures S2 and S3. Primer pairs used in this study are listed in Table S3. Homologous arms were amplified using two primers pairs (Lp20_GM1654L-F/Lp20_GM1654L-R and Lp20_GM1654R-F/Lp20_GM1654R-R), and then cloned into pUC19E by seamless cloning (CWBIO, Beijing, China) to obtain pUCbsh1. This suicide plasmid was then transformed into L. plantarum Lp20 cells by electroporation. MRS agar plates containing erythromycin were used to screen for positive colonies, which were then continuous cultivation in antibiotic-free MRS for 20 passages to select for double-overcrossing transformants. The replica plating method was performed to screen for colonies sensitive to erythromycin, and meanwhile hydrolase precipitation zones of this positive colonies disappeared (Figure S4C). Subsequently, the Δbsh1 gene knockout mutants were confirmed by PCR with primers pairs Up-F/Up-R (UF/UR) and Down-F/Down/R (DF/DR).
To generate a gene complementation, the bsh1 gene from L. plantarum Lp20 was amplified with primers (NcoI-bsh1/SacI-bsh1) and then cloned into pNZ11. Then, the recombinant pNZbsh1 plasmid was electroporated into the L. plantarum Lp20-Δbsh1 gene knockout mutants to obtain the complementation strain, which was designated as L. plantarum Lp20-Δbsh1+.

2.5. Animal Experiment

Specific pathogen-free C57BL/6J mice (male, 6–8 weeks) were purchased from Beijing Huafukang Bioscience Co., Ltd. (Beijing, China) and maintained in barrier facility conditions (22 ± 2 °C, 50 ± 5% humidity, 12-h light/dark cycle and free access to food and water). Chew sticks were placed in each cage to enrich the environmental conditions. Following a 7-day acclimatization period, animals were randomly assigned to 4 groups using a computer-generated random number sequence: the low-fat diet group (LFD, n = 6) was fed a normal diet with 10% of energy from fat (D12450J, Research Diets, Table 1) for 12 weeks; the HFD groups were given a diet with 60% of energy from fat (D12492, Research Diets, Table 1) for 12 weeks to induce obesity (HFD, n = 6). The successful establishment of the obesity model was defined as a twenty percent increase in the mean body weight of all HFD-fed mice compared to that of LFD group [38]. Subsequently, obese mice were treated with bacteria strains (n = 6): (1) HFD group, fed with HFD and PBS; (2) HFD + Lp20-WT group, fed with HFD and 1 × 109 CFU wild-type L. plantarum Lp20 with BSH activity; (3) HFD + Lp20-Δbsh1 group, fed with HFD and 1 × 109 CFU L. plantarum Lp20-Δbsh1 mutant. PBS or bacterial suspension was daily administered by oral gavage at a volume 0.2 mL for additional 8 weeks.
Body weight of each group mice was recorded weekly, and the average daily energy intake was calculated according to energy density of diets in Table 1 (Tables S4 and S5). The experimental endpoint was defined when the body weight of mice in the HFD group was significantly higher than that in the intervention group and remained stable for 2 weeks. Before sacrificing, mice have been fasted overnight, anesthetized with isoflurane (Shenzhen RWD Life Science Co., Ltd., Shenzhen, China). Body composition, including fat mass and lean mass, was analyzed before sacrifice using a MiniQMR23-060H-I type Body Composition Analyzer (Shanghai Niumag Corporation, Shanghai, China). Blood serum was collected after euthanasia by cervical dislocation. Organs and adipose tissues, including epididymal white adipose tissue (eWAT), inguinal white adipose tissue (iWAT), and mesenteric fat were collected and weighed immediately. The experimental design was evaluated and approved by the Institutional Animal Care and Use Committee of the China Agricultural University, Beijing, China (protocol code AW81503202-5-2 and 18 May 2023 of approval). All procedures were performed in accordance with the National Research Council’s Guide for the Care and Use of Laboratory Animals.

2.6. Biochemical Assay of Blood Serum

We measured key indicators of metabolic status and liver function in the blood, including total cholesterol (TC), high-density lipoprotein cholesterol (HDL-C), low-density lipoprotein cholesterol (LDL-C), alanine aminotransferase (ALT), and aspartate aminotransferase (AST). The measurements were performed using a Hitachi Automatic Analyzer 3100 (Hitachi, Tokyo, Japan), with reagents from a biomedical analysis kit supplied by Maccura Biotechnology Co., Ltd. (Chengdu, China).

2.7. Liver Histological Analysis

Liver tissues were fixed in 4% paraformaldehyde, followed by progressively dehydrated and embedded in paraffin wax. Then, the liver tissues were cut into 4 μm sections and stained with hematoxylin and eosin (H&E) and periodic acid-Schiff (PAS). Histological and histochemical assessments were conducted in a blinded fashion. The scoring was performed according to the criteria established by Tian et al. [39].

2.8. RT-qPCR

The total RNA of mice liver tissues was extracted by AG RNAex Pro reagent (Accurate Biotechnology Hunan Co., Ltd., Changsha, China). The A260/280 ratios of all samples were between 1.8 and 2.1, indicating high RNA integrity and purity. For reverse transcription, we utilized 1 μg of the total RNA, combined with the reverse transcription kit designated for qPCR. RT-qPCR was then performed using the SYBR Green Premix Pro Taq Hs qPCR kit (Accurate Biotechnology Hunan Co., Ltd., Changsha, China) with QuantStudio 5 Real-Time PCR Systems (Thermo Fisher, Wilmington, NC, USA). All the primers used in this study are presented in Table 2. The amplification efficiency of all primers was validated using standard curve experiments. The relative quantification of the target gene is determined, and β-actin was used as the reference, in accordance with the 2−ΔΔCTmethod [40]. β-actin exhibited stable expression in liver tissue samples under experimental conditions.

2.9. Microbiome Analysis

Fecal samples were processed for gut microbiome profiling (n = 4). DNA was extracted using the PF Mag-Bind Stool DNA Kit (Omega, GA, USA), and the V3–V4 region of the 16S rRNA gene was amplified with barcoded primers (338F/806R). Amplicons were purified, pooled, and sequenced (2 × 300 bp) on Illumina MiSeq (Illumina, San Diego, CA, USA) [41]. Quality control of the raw paired-end sequencing data was performed using fastp v0.19.6 [42]. Subsequently, paired-end reads were merged into single sequences via FLASH v1.2.11 [43], with an overlap length of at least 10 bp and a maximum mismatch rate of 0.2 in the overlapping regions. Then, the optimized sequences, obtained following quality control and merging, were subjected to denoising using the DADA2 [44] or Deblur [45] plugin in the Qiime2 pipeline, with all default parameters. Finally, taxonomic assignment of the resulting amplicon sequence variants (ASVs) was performed using the Naive Bayes, Vsearch, or Blast classifier in Qiime2, against the Silva 16S rRNA gene database (v138). All data analyses were conducted via the Majorbio Cloud Platform (https://cloud.majorbio.com, accessed on 15 June 2025). α-diversity differences were assessed using the Kruskal-Wallis test, β-diversity differences between groups were evaluated with ANOSIM, and species-level differences were identified using the Wilcoxon test. The 16S analyses was conducted in a blinded manner. Specifically, the personnel performing the 16S analysis were blinded to the sample groups during the data acquisition and analysis process. The raw sequencing data generated in this study have been deposited in the National Center for Biotechnology Information (NCBI) database; the 16S rRNA gene sequencing accession number is PRJNA1358044 (https://dataview.ncbi.nlm.nih.gov/object/PRJNA1358044, accessed on 1 November 2025).

2.10. Statistical Analysis

Statistical analyses were conducted using GraphPad Prism version 9.0 (GraphPad, San Diego, CA, USA). Data were verified for normality using the D’Agostino and Pearson omnibus normality test. The difference in hydrolase activity between wild-type and mutant strains was assessed using Student’s t-test. All other data were analyzed using one-way ANOVA followed by Dunnett’s multiple comparison test, with LFD as control. Data are expressed as mean ± SEM. p-values < 0.05 were considered to be statistically significant.

3. Results

3.1. L. plantarum Lp20 Exhibited the Highest GDCA Hydrolase Activity

Twenty-eight L. plantarum strains were investigated to produce BSH activity by bile salt plate method. Of these strains, 23 were able to produce precipitation halos on GDCA plates. Notably, L. plantarum Lp20 produced the most prominent precipitation halos on GDCA plate. The reference strain L. plantarum WCFS1 only produced white colonies with opaque granular precipitate halos (Figure 1A,B). However, none of these strains formed precipitation halos on TDCA plates; both the reference strain WCFS1 and L. plantarum Lp20 formed only uniform white colonies, indicating an absence of detectable BSH activity toward taurine-conjugated bile salts (Figure 1C,D).
The BSH activity of 28 L. plantarum strains was further measured using the ninhydrin assay. Most results were consistent with those of plate assay. L. plantarum Lp20 exhibited the highest GDCA hydrolysis activity, with a hydrolysis rate of 91.62% (Figure 1E). In addition, L. plantarum Lp255, 260, 274, 277, and 282 produced no deconjugation precipitation halos and showed GDCA hydrolysis rate below 15% (Figure S1). The bile salt plate method proves to be an effective and rapid screening method for identifying BSH-active strains. Consequently, L. plantarum Lp20 was selected to investigate the correlation between its BSH activity and the presence of BSH genes.

3.2. BSH-like Genes Were Located in the Chromosome of L. plantarum Lp20

Comparison of cholylglycine hydrolase family genes of L. plantarum Lp20 with those in the L. plantarum WCFS1 genome using Clustal Omega alignment (Figure 2A and Figure S2). Draft genome sequencing demonstrated that L. plantarum Lp20 contains 4 choloylglycine hydrolase (CGH) family genes, identified as bsh1, pva1, pva2 and pva3 (Figure 2B). However, pva2 gene appears to be a pseudogene due to a frame-shift at 109 bp downstream the start codon in L. plantarum Lp20. When compared to the amino acid sequences of Bsh1, Pva1 and Pva3 in L. plantarum WCFS1, the corresponding sequences in L. plantarum Lp20 showed similarities of 99.69%, 99.69%, and 97.48%, respectively. It was found that pva2 and pva4 were conservative for penicillin acylase activity, while bsh1 contributed the major BSH activity in L. plantarum WCFS1 [27,46]. Therefore, the high BSH activity in L. plantarum Lp20 might be attributed to the gene bsh1.

3.3. Bsh1 Played a Key Role in the GDCA Hydrolysis Activity of L. plantarum Lp20

The bsh1-deleted strain, L. plantarum Lp20-Δbsh1, and complementary strain, L. plantarum Lp20-Δbsh1+, were constructed in this study (Figures S3 and S4). The results revealed the absence of precipitation halo formation in the L. plantarum Lp20-Δbsh1 mutant on GDCA plate (Figure 3A,B). Meanwhile, the rate of bile salt hydrolysis was only 5.86% (Figure 3C). The complementation of the bsh1 gene into the L. plantarum Lp20-Δbsh1 strain restored its hydrolysis activity (Figure 3D,E). These results confirm that the bsh1 gene confers GDCA hydrolysis activity to L. plantarum Lp20. Subsequently, L. plantarum Lp20 and Δbsh1 mutant strain were used to investigate the relationship between BSH activity and obesity amelioration. To address the concern of potential differences in bacterial growth states, we compared the growth of the wild-type (WT) and Δbsh1 strains in MRS broth. The growth curves indicated that all strains exhibited comparable growth rates and biomass production (Figure S5).

3.4. L. plantarum Lp20 Decreased Weight Gain and Fat Accumulation in Obese Mice

The obesity induced by high fat diet in mice and the grouping intervention scheme are shown in Figure 4A. The bodyweight of HFD group mice reached 41.03 g after 12 weeks, which was 1.21-fold higher than that of LFD group mice, indicating the successful establishment of an obese mouse model (Figure 4B). After 8 weeks L. plantarum Lp20 intervention, the net body weight gains of mice in the HFD, Lp20-WT, and Lp20-Δbsh1 groups averaged 8.58 g, 3.18 g, and 8.81 g, respectively (Figure 4C). This finding, when combined with the analysis of energy intake data from each group (Table S6), suggests that Lp20 with BSH enzyme activity can significantly reduce weight gain in a manner that appears unrelated to energy intake. Moreover, L. plantarum Lp20 treatment decreased fat mass ratio in body composition compared with the L. plantarum Lp20-Δbsh1 mutant treatment group, without affecting the lean mass (Figure 4D,E). Furthermore, no difference in eWAT mass was observed among the three groups; however, iWAT mass and mesenteric fat mass were significantly lower in the Lp20-WT group than in both the Lp20-Δbsh1 and HFD groups (p < 0.01) (Figure 4F–H). However, no difference was observed between the Lp20-Δbsh1 group and HFD group. Taken together, the bile salt hydrolase bsh1 of L. plantarum Lp20 contributes to ameliorating obese-related syndromes by reducing weight gain and body fat accumulation.

3.5. Bsh1 Alleviated Liver Steatosis and Decreased Serum Cholesterol in Obese Mice

We conducted a comprehensive histopathological analysis of liver tissues. In this study, livers from the HFD and Lp20-Δbsh1 groups appeared pale yellow, indicative of hepatic steatosis. By contrast, healthier, slightly redder livers were observed in the Lp20-WT and LFD groups (Figure S6). Liver weights were 1.97 ± 0.23 g in the HFD group and 1.20 ± 0.19 g in the Lp20-WT group, the latter being significantly lower than in the Lp20-Δbsh1 group (Table S10). Additionally, there was no significant difference in liver weight between the Lp20-WT group and LFD group. Collectively, these findings indicate that the BSH activity of Lp20 exerts a protective effect against host liver injury. Hepatocytes in LFD mice displayed purple-red cytoplasmic staining with uniformly stained chromatin, indicating negligible fat accumulation and the absence of steatosis (Figure 5A). However, vacuolization due to lipid accumulation was observed in the livers of HFD mice. NAS scores revealed that Lp20 administration significantly reduced HFD-induced histological damage (Figure S7). PAS staining corroborated these results by distinguishing steatosis from glycogen or other polysaccharide accumulation (Figure 5B). It is worth noting that the Lp20-WT group exhibited a darker cytoplasm and a substantial reduction in lipid droplets. However, the Lp20-Δbsh1 group showed steatosis comparable to that of the HFD group in both droplet size and number.
Serum cholesterol levels were subsequently quantified for all experimental groups. After 8 weeks of feeding with the HFD, the TC levels of the HFD group increased to 9.15 mmol/L, which was 1.76-fold higher than that of the LFD group. Notably, only Lp20-WT treatment significantly reduced the total serum cholesterol compared with the HFD group, while no significant difference was observed between the mutant and HFD groups (Figure 5C). Further analysis revealed that Lp20-WT primarily decreased serum LDL-C levels, with no significant impact on serum HDL-C levels (Figure 5D,E). Therefore, the bile salt hydrolase Bsh1 of the Lp. plantarum Lp20 appears to play a role in mitigating abnormal blood lipid levels by regulating serum cholesterol levels in obese mice. Furthermore, compared with the Lp20-Δbsh1 group, the Lp20 group exhibited reductions in serum ALT and AST of 76.6% and 45.3% (Figure 5F,G).
To further investigate the hepatic bile acid synthetic pathways, we quantified key transcripts related to bile acid synthesis using RT-qPCR. Compared with the Lp20-Δbsh1 group, the Lp20-WT group exhibited a marked upregulation of CYP7a1 and CYP27a1, which encode the rate-limiting enzymes in the classical and alternative bile acid biosynthetic pathways, respectively (Figure 5H,I). Additionally, Lp20-WT significantly increased the hepatic expression of the bile acid-activated receptors FXR and TGR5 (p < 0.05, Figure 5J,K). Collectively, these findings suggest that bacterial activity dependent on BSH within the gut microbiota may transcriptionally modulate hepatic bile acid synthesis and sensing pathways under diet-induced obesity.

3.6. L. plantarum Lp20 Restored the Intestinal Microbial Community

To systematically evaluate the therapeutic potential of Lp20-WT in reversing HFD-induced dysbiosis, we profiled faecal microbial communities by 16S rRNA gene sequencing. The analysis of the Shannon index revealed a significant increase in α-diversity within the Lp20-WT group relative to the LFD group (Figure S8). Moreover, when compared to the LFD group, the HFD group exhibited an augmented gut microbiota diversity, which may be associated with an increased fiber intake [47]. β-diversity principal-coordinate analysis (PCoA, Bray–Curtis distance) revealed complete segregation of LFD and HFD groups along PC1, indicating that HFD profoundly reshaped gut microbial architecture. Strikingly, Lp20-WT intervention steered the microbial community away from the HFD-associated configuration, indicating a partial restoration of both richness and composition, whereas the Lp20-Δbsh1 cohort remained indistinguishable from the HFD group (Figure 6A). Quantitation using the Microbiota Health Index (MHI) corroborated these findings: Lp20-WT fully restored HFD-lowered MHI scores (p < 0.05), whereas MHI values in the Lp20-Δbsh1 group remained indistinguishable from those of the HFD cohort (Figure 6B,C). Lp20-WT expanded beneficial SCFA producers—including norank_f__Muribaculaceae, Akkermansia, and Alistipes. At the same time, it suppressed LPS-producing pro-inflammatory taxa such as norank_f__Desulfovibrionaceae, Dubosiella, and Mucispirillum (Figure 6D). LEfSe with LDA score > 3.0 further disclosed that the HFD microbiota was dominated by potential pathogens (g__Romboutsia, g__norank_f__Desulfovibrionaceae, and g__Dubosiella). In contrast, Lp20-WT fostered a beneficial consortium centered on Akkermansia and Alistipes, whereas Lp20-Δbsh1-treated mice retained a pro-inflammatory signature enriched for g__norank_f__Desulfovibrionaceae, g__Dubosiella, and g__Mucispirillum (Figure 6E,F), reinforcing that loss of BSH activity attenuates probiotic efficacy. Furthermore, we analyzed the correlation between bacterial abundance and host phenotypes (Figure 6G). The relative abundance of fecal Akkermansia was significantly negatively correlated with white adipose tissue mass and serum levels of TC, ALT and AST, but positively correlated with lean mass and the hepatic expression of BA synthesis rate-limiting enzymes CYP7A1 and CYP27A1, as well as nuclear receptors FXR and TGR5. In contrast, the abundance of norank_f__Desulfovibrionaceae and Dubosiella was positively associated with metabolic inflammatory phenotypes. These results collectively demonstrate that Lp20-WT improves gut microbial balance through BSH-dependent metabolic regulation, thereby restoring host metabolic homeostasis.

4. Discussion

The global shift toward high-fat, high-calorie diets, fueled by economic growth, has led to a surge in obesity, a key risk factor for type 2 diabetes, atherosclerosis, and related mortality [48]. Conventional interventions are hindered by poor adherence, gastrointestinal side effects, and high costs. In response, probiotic interventions are emerging as a promising new strategy for managing metabolic disorders [49].
Accumulating evidence demonstrates that BSH acts as a metabolic gatekeeper, promoting the conversion of primary BAs into secondary BAs. Upon microbial deconjugation of GDCA, the secondary bile acid DCA is released into the intestinal lumen and functions as a selective signaling metabolite. It engages the bile-acid-sensing receptors FXR and TGR5 expressed in skeletal muscle, brown adipose tissue, and enteroendocrine L-cells, thereby initiating downstream transcriptional cascades that systemically modulate lipid and energy homeostasis [12,13]. A recent study indicates that BSH/T enzymes from Bifidobacterium animalis can extend their catalytic activity beyond classic deconjugation, linking tryptophan with bile acids to form Trp-CA, a novel microbial-derived bile acid that boosts GLP-1 release and insulin sensitivity [50]. Moreover, these enzymes exhibit acyltransferase activity [51]. Such strain-specific remodeling of the bile acid pool is likely to influence microbial fitness within the intestinal niche, underscoring the need for mechanistic studies that dissect its ecological and metabolic consequences.
The BSH activity of different lactic acid bacteria strains varies significantly, with the genus Lactiplantibacillus serving as a major microbial reservoir of this enzyme [52]. Here we found that most L. plantarum strains have a strong specificity to glycine-conjugated bile salts, which is likely because L. plantarum is one of the prevalent strains in the human intestinal microbiota. The existence of BSH activity is considered a conservative microbial adaptation to the human intestinal environment [53,54]. Given that more than 60% of BAs in the human bile acid pool are glycine-conjugated, the general deconjugating activity and preference for glycine-conjugated bile salts by Lactiplantibacillus likely result from the evolutionary conservation of the BSH gene [55,56]. In this study, we screened L. plantarum Lp20 for its exceptionally high BSH activity and engineered an isogenic Δbsh1 mutant that lost > 94% of GDCA hydrolysis capacity—an observation that aligns with prior work in L. plantarum WCFS1 [46]. To establish a causal link between bsh1 and host energy balance, diet-induced obese mice were randomly assigned to receive either the Lp20-WT or the Lp20-Δbsh1 variant by daily gavage for 8 consecutive weeks.
In vivo experiments demonstrated that daily gavage of L. plantarum Lp20 markedly reduced body weight, white-adipose-tissue mass, serum TC and LDL-cholesterol relative to high-fat-diet (HFD) controls; moreover, the Lp20 modulated gut microbiota composition by expanding beneficial taxa while suppressing potential pathogens, thereby alleviating diet-induced obesity. Strikingly, these metabolic benefits were almost completely abolished in mice receiving the isogenic Lp20-Δbsh1. Notably, HFD-induced liver steatosis has been reported in previous studies [57,58]. Increased ALT and AST levels in the bloodstream are typically indicative of liver injury or steatosis [59]. However, there are few studies which confirmed the anti-liver steatosis effect of Bsh1 in Lactobacillus strains. The reduction in serum ALT and AST levels and the histopathological improvements observed through H&E and PAS staining provide strong evidence for the liver-protective role of bsh1 from Lp20. Consequently, these results indicate that Lp20-WT significantly alleviates liver lipid accumulation, suggesting a potential therapeutic benefit of BSH in Non-Alcoholic Fatty Liver Disease (NAFLD). Therefore, it can be inferred that BSH activity might play a protective role against liver injury. When BAs are deconjugated by BSH, the solubility of bile salts decreases, resulting in an increased excretion of BAs through feces due to their impaired reabsorption in the enterohepatic circulation. This reduction in reabsorption capacity subsequently diminishes the small intestine’s ability to absorb lipids from chylomicrons. Concurrently, to compensate for the loss of BAs, the liver is prompted to utilize cholesterol for the synthesis of new BAs, thereby lowering serum cholesterol levels [24]. In this study, we observed that the upregulation of the rate-limiting bile acid synthesis genes, CYP7A1 and CYP27A1, suggests that Lp20 intervention promotes the utilization of hepatic cholesterol for bile acid resynthesis, thereby reducing serum cholesterol levels. Simultaneously, increased expression of hepatic farnesoid X receptor (FXR) was noted. This may stem from the fact that upon activation, hepatic FXR predominantly suppresses CYP8B1, with minimal effects on CYP7A1 [60]. The activation of hepatic FXR could modulate triglyceride synthesis and mitigate hepatic steatosis through alternative signaling pathways, though the precise mechanisms warrant further investigation. Moreover, the enterohepatic circulation of secondary BAs via the portal vein may enhance the activation of receptors such as TGR5, leading to reduced lipid synthesis and elevated carbohydrate metabolism [25,61]. Consistently, our study revealed increased hepatic TGR5 expression, implying that bile acid signaling transcriptional regulation contributes to Lp20’s anti-obesity effects.
By comparing the isogenic Δbsh1 knockout mutant with its wild-type counterpart, our study shows that BSH plays an essential role in the anti-obesity phenotype of L. plantarum Lp20. Notably, Lp20 may also produce other beneficial metabolites, such as short-chain fatty acids (SCFAs) and conjugated linoleic acid (CLA), which warrant further investigation in future studies. Our study has several limitations. The sample size was small (n = 6), which may affect the statistical power and the ability to generalize our findings. Only male mice were used, so the results may not apply to female mice. We did not perform dose-response testing, so the optimal dose of L. plantarum Lp20 for anti-obesity effects is unknown. Finally, we did not conduct bile acid profiling or validate in vivo metabolic endpoints, nor did we measure GLP-1 levels. Although L. plantarum Lp20 exhibits significant BSH activity and metabolic benefits, its mechanism of action remains to be further elucidated. Future research should focus on high-throughput screening of various lactobacilli and bifidobacteria strains to identify those with the highest BSH activity. Subsequent in vivo studies in animal models and human subjects should assess the metabolic effects of these strains, taking into account the distinct bile acid conjugation patterns and microbiome profiles between species. This will help determine their potential for clinical application in humans.

5. Conclusions

The BSH is recognized as a metabolic marker for probiotics with the ability to reduce lipid accumulation. In this study, L. plantarum Lp20 was screened for its highest BSH activity among 28 candidate strains. To establish a causal link between BSH and anti-obesity efficacy, we constructed a bsh1 knock-out mutant; comparative analyses confirmed that the anti-obesity phenotype of Lp20 is BSH-dependent. In a diet-induced obese mouse model, the Lp20-WT administration markedly curbed weight gain, lowered serum TC, and reversed hepatic steatosis. Mechanistically, the Lp20-WT up-regulated the expression of the rate-limiting bile-acid-synthetic enzymes CYP7A1 and CYP27A1, activated the receptor FXR and TGR5, and thereby modulated bile-acid-related pathways. Concomitantly, Lp20-WT modulated microbiota composition and re-established micro-ecological homeostasis. In contrast, the Lp20-Δbsh1 group exhibited almost complete loss of these metabolic protective effects. These findings provide strong evidence in this model that BSH activity underlies the obesity-ameliorating effects of Lp20, while recognizing that additional microbial metabolites (e.g., SCFAs, CLA) may also participate.
In mice, bile acids are predominantly tauroconjugated, while in humans, they are primarily glycoconjugated; this difference might affect Lp20’s efficacy in humans. Also, the human gut microbiota differs from that of laboratory mice in both taxonomy and function. As a pre-clinical model, this study is limited by the small number of male mice used. Future studies should therefore validate these findings in female mouse, perform dose-response and long-term safety assessments, and ultimately conduct randomized placebo-controlled trials that monitor systemic bile-acid profiles, GLP-1 dynamics, and microbiome shifts to determine whether Lp20 BSH activity translates into clinically meaningful metabolic benefits in human obesity.

Supplementary Materials

The following supporting information can be downloaded at: https://www.mdpi.com/article/10.3390/nu17223555/s1, Table S1: Bacteria strains and plasmids used in this study; Table S2: Key quality control metrics for the Lp20 genome assembly; Table S3: Primers used in this study; Table S4: Dietary composition and energy density in animal experiments; Table S5: Mice average daily energy intake during the modeling period (1–12 weeks); Table S6: Mice average daily energy intake during treatment (13–20 weeks); Table S7: Weight trajectories and Area Under the Curve (AUC) for individual mice during the modeling period (Weeks 1–12); Table S8: Weight trajectories and Area Under the Curve (AUC) for individual mice during treatment (13–20 weeks); Table S9: NAS scoring of NASH; Table S10: Liver weight and liver index (Mean and standard deviation) of mice after 8 weeks of intervention. Figure S1: Negative results in precipitation halo assay for Lactiplantibacillus BSH activity on GDCA plates; Figure S2: Comparison of cholylglycine hydrolase family genes of L. plantarum Lp20 with those in the L. plantarum WCFS1 genome using Clustal Omega alignment. Figure S3: A schematic representing the generation of a markerless bsh1 deletion in L. plantarum Lp20 using the pUCbsh1arm suicide plasmid; Figure S4: Illustrations of the PCR detection of bsh1 single crossover insertion vectors using primer pairs DF/UF and DR/UR; Figure S5: Growth curve measurement of wild-type and mutant strains; Figure S6: Fat distribution in abdominal cavity and schematic diagram of liver in mice; Figure S7: Hepatic NAS assessment; Figure S8: α-diversity of the gut microbiota, represented by Shannon index.

Author Contributions

X.B.: Investigation, methodology, visualization, writing—original draft and writing—review & editing. F.L.: Investigation, visualization and writing—original draft. Y.J.: Investigation, methodology and visualization. H.W.: Investigation and visualization. H.Q.: Investigation, writing—original draft. M.Z.: writing—review & editing. Z.Z.: Conceptualization, project administration, resources, supervision, and writing—review and editing. Y.H.: Conceptualization, funding acquisition, project administration, resources, supervision, and writing—review and editing. All authors have read and agreed to the published version of the manuscript.

Funding

This research was funded by the National Key Research and Development Program of China (Grant number: 2022YFF1100100) and Cross-Innovation Open Project of Food Flavor and Health, Beijing Technology & Business University (No. FFHCI-2025010).

Institutional Review Board Statement

The animal study protocol was approved by the Institutional Animal Care and Use Committee of the China Agricultural University, Beijing, China (protocol code W81503202-5-2 and 18 May 2023 of approval). All of the animal handling and experimental procedures were performed in accordance with the National Research Council’s Guide for the Care and Use of Laboratory Animals.

Informed Consent Statement

Not applicable.

Data Availability Statement

All data presented in this study is available from the corresponding author upon reasonable request. The draft genome and assembly of Lactiplantibacillus plantarum Lp20 strain was deposited to GenBank (Accession number: JBAJNI000000000). The 16S rRNA gene sequencing accession number is PRJNA1358044 (https://dataview.ncbi.nlm.nih.gov/object/PRJNA1358044, accessed on 1 November 2025).

Conflicts of Interest

The authors declare no conflicts of interest.

References

  1. Blüher, M. Obesity: Global epidemiology and pathogenesis. Nat. Rev. Endocrinol. 2019, 15, 288–298. [Google Scholar] [CrossRef] [Scilit]
  2. Shaikh, S.R.; Beck, M.A.; Alwarawrah, Y.; MacIver, N.J. Emerging mechanisms of obesity-associated immune dysfunction. Nat. Rev. Endocrinol. 2024, 20, 136–148. [Google Scholar] [CrossRef] [Scilit]
  3. Lobstein, T.; Jackson-Leach, R.; Powis, J.; Brinsden, H.; Gray, M. World Obesity Atlas 2023; World Obesity Federation: London, UK, 2023. [Google Scholar]
  4. Cox, A.J.; West, N.P.; Cripps, A.W. Obesity, inflammation, and the gut microbiota. Lancet Diabetes Endocrinol. 2015, 3, 207–215. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  5. Ridaura, V.K.; Faith, J.J.; Rey, F.E.; Cheng, J.; Duncan, A.E.; Kau, A.L.; Griffin, N.W.; Lombard, V.; Henrissat, B.; Bain, J.R.; et al. Gut microbiota from twins discordant for obesity modulate metabolism in mice. Science 2013, 341, 1241214. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  6. Michael, D.R.; Jack, A.A.; Masetti, G.; Davies, T.S.; Loxley, K.E.; Kerry-Smith, J.; Plummer, J.F.; Marchesi, J.R.; Mullish, B.H.; McDonald, J.A.K.; et al. A randomised controlled study shows supplementation of overweight and obese adults with lactobacilli and bifidobacteria reduces bodyweight and improves well-being. Sci. Rep. 2020, 10, 4183. [Google Scholar] [CrossRef] [Scilit]
  7. Hsieh, F.C.; Lan, C.C.; Huang, T.Y.; Chen, K.W.; Chai, C.Y.; Chen, W.T.; Fang, A.H.; Chen, Y.H.; Wu, C.S. Heat-killed and live Lactobacillus reuteri GMNL-263 exhibit similar effects on improving metabolic functions in high-fat diet-induced obese rats. Food Funct. 2016, 7, 2374–2388. [Google Scholar] [CrossRef] [Scilit]
  8. Liu, Y.; Gao, Y.; Ma, F.; Sun, M.; Mu, G.; Tuo, Y. The ameliorative effect of Lactobacillus plantarum Y44 oral administration on inflammation and lipid metabolism in obese mice fed with a high fat diet. Food Funct. 2020, 11, 5024–5039. [Google Scholar] [CrossRef] [Scilit]
  9. Fan, J.; Jin, W.L.; Su, S.C.; Khan, A.; Wu, Y.; Chen, Y.Y.; Feng, P.Y.; Jeon, B.-H.; Salama, E.-S.; Ling, Z.M.; et al. A probiotic targets bile acids metabolism to alleviate ulcerative colitis by reducing conjugated bile acids. Mol. Nutr. Food Res. 2024, 68, 2300731. [Google Scholar] [CrossRef] [Scilit]
  10. Li, L.; Liu, T.; Gu, Y.; Wang, X.; Xie, R.; Sun, Y.; Wang, B.; Cao, H. Regulation of gut microbiota-bile acids axis by probiotics in inflammatory bowel disease. Front. Immunol. 2022, 13, 974305. [Google Scholar] [CrossRef] [Scilit]
  11. Huang, C.H.; Ho, C.Y.; Chen, C.T.; Hsu, H.F.; Lin, Y.H. Probiotic BSH Activity and Anti-Obesity Potential of Lactobacillus plantarum Strain TCI378 Isolated from Korean Kimchi. Prev. Nutr. Food Sci. 2019, 24, 434–441. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  12. Liang, C.; Zhou, X.H.; Gong, P.M.; Niu, H.Y.; Lyu, L.Z.; Wu, Y.F.; Han, X.; Zhang, L.W. Lactiplantibacillus plantarum H-87 prevents high-fat diet-induced obesity by regulating bile acid metabolism in C57BL/6J mice. Food Funct. 2021, 12, 4315–4324. [Google Scholar] [CrossRef] [Scilit]
  13. Joyce, S.A.; MacSharry, J.; Casey, P.G.; Kinsella, M.; Murphy, E.F.; Shanahan, F.; Hill, C.; Gahan, C.G. Regulation of host weight gain and lipid metabolism by bacterial bile acid modification in the gut. Proc. Natl. Acad. Sci. USA 2014, 111, 7421–7426. [Google Scholar] [CrossRef] [Scilit]
  14. Zheng, Y.; Zhang, S.; Zhang, Z.; Zhang, T.; Teng, X.; Xiao, G.; Huang, S. Isolation of Lactobacillus acidophilus strain and its anti-obesity effect in a diet induced obese murine model. Lett. Appl. Microbiol. 2024, 77, ovae021. [Google Scholar] [CrossRef] [Scilit]
  15. Jia, B.; Zou, Y.; Han, X.; Bae, J.W.; Jeon, C.O. Gut microbiome-mediated mechanisms for reducing cholesterol levels: Implications for ameliorating cardiovascular disease. Trends Microbiol. 2023, 31, 76–91. [Google Scholar] [CrossRef] [Scilit]
  16. Joyce, S.A.; Shanahan, F.; Hill, C.; Gahan, C.G. Bacterial bile salt hydrolase in host metabolism: Potential for influencing gastrointestinal microbe-host crosstalk. Gut Microbes 2014, 5, 669–674. [Google Scholar] [CrossRef] [Scilit]
  17. Li, T.; Owsley, E.; Matozel, M.; Hsu, P.; Novak, C.M.; Chiang, J.Y. Transgenic expression of cholesterol 7α-hydroxylase in the liver prevents high-fat diet–induced obesity and insulin resistance in mice. Hepatology 2010, 52, 678–690. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  18. Degirolamo, C.; Rainaldi, S.; Bovenga, F.; Murzilli, S.; Moschetta, A. Microbiota modification with probiotics induces hepatic bile acid synthesis via downregulation of the Fxr-Fgf15 axis in mice. Cell Rep. 2014, 7, 12–18. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  19. Choi, S.B.; Lew, L.C.; Yeo, S.K.; Nair Parvathy, S.; Liong, M.T. Probiotics and the BSH-related cholesterol lowering mechanism: A Jekyll and Hyde scenario. Crit. Rev. Biotechnol. 2015, 35, 392–401. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  20. Xie, C.; Huang, W.; Young, R.L.; Jones, K.L.; Horowitz, M.; Rayner, C.K.; Wu, T. Role of Bile Acids in the Regulation of Food Intake, and Their Dysregulation in Metabolic Disease. Nutrients 2021, 13, 1104. [Google Scholar] [CrossRef] [Scilit]
  21. Foley, M.H.; O’Flaherty, S.; Barrangou, R.; Theriot, C.M. Bile salt hydrolases: Gatekeepers of bile acid metabolism and host-microbiome crosstalk in the gastrointestinal tract. PLoS Pathog. 2019, 15, e1007581. [Google Scholar] [CrossRef] [Scilit]
  22. Karlov, D.S.; Long, S.L.; Zeng, X.; Xu, F.; Lal, K.; Cao, L.; Hayoun, K.; Lin, J.; Joyce, S.A.; Tikhonova, I.G. Characterization of the mechanism of bile salt hydrolase substrate specificity by experimental and computational analyses. Structure 2023, 31, 629–638.e625. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  23. Pushpass, R.G.; Alzoufairi, S.; Jackson, K.G.; Lovegrove, J.A. Circulating bile acids as a link between the gut microbiota and cardiovascular health: Impact of prebiotics, probiotics and polyphenol-rich foods. Nutr. Res. Rev. 2022, 35, 161–180. [Google Scholar] [CrossRef] [Scilit]
  24. Collins, S.L.; Stine, J.G.; Bisanz, J.E.; Okafor, C.D.; Patterson, A.D. Bile acids and the gut microbiota: Metabolic interactions and impacts on disease. Nat. Rev. Microbiol. 2023, 21, 236–247. [Google Scholar] [CrossRef] [Scilit]
  25. Wahlström, A.; Sayin, S.I.; Marschall, H.U.; Bäckhed, F. Intestinal Crosstalk between Bile Acids and Microbiota and Its Impact on Host Metabolism. Cell Metab. 2016, 24, 41–50. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  26. Gege, C.; Hambruch, E.; Hambruch, N.; Kinzel, O.; Kremoser, C. Nonsteroidal FXR Ligands: Current Status and Clinical Applications. Handb. Exp. Pharmacol. 2019, 256, 167–205. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  27. Ren, J.; Sun, K.; Wu, Z.; Yao, J.; Guo, B. All 4 bile salt hydrolase proteins are responsible for the hydrolysis activity in Lactobacillus plantarum ST-III. J. Food Sci. 2011, 76, M622–M628. [Google Scholar] [CrossRef] [Scilit]
  28. Kumar, R.; Grover, S.; Batish, V.K. Bile Salt Hydrolase (Bsh) Activity Screening of Lactobacilli: In Vitro Selection of Indigenous Lactobacillus Strains with Potential Bile Salt Hydrolysing and Cholesterol-Lowering Ability. Probiotics Antimicrob. Proteins 2012, 4, 162–172. [Google Scholar] [CrossRef] [Scilit]
  29. Liong, M.T.; Shah, N.P. Bile salt deconjugation ability, bile salt hydrolase activity and cholesterol co-precipitation ability of lactobacilli strains. Int. Dairy J. 2005, 15, 391–398. [Google Scholar] [CrossRef] [Scilit]
  30. Zhu, H.; Zhao, F.; Zhang, W.; Xia, W.; Chen, Y.; Liu, Y.; Fan, Z.; Zhang, Y.; Yang, Y. Cholesterol-lowering effect of bile salt hydrolase from a Lactobacillus johnsonii strain mediated by FXR pathway regulation. Food Funct. 2022, 13, 725–736. [Google Scholar] [CrossRef] [Scilit]
  31. Zhao, M.; Kuang, W.; Yang, J.; Liu, Y.; Yang, M.; Chen, Y.; Zhu, H.; Yang, Y. Cholesterol lowering in diet-induced hypercholesterolemic mice using Lactobacillus bile salt hydrolases with different substrate specificities. Food Funct. 2024, 15, 1340–1354. [Google Scholar] [CrossRef] [Scilit]
  32. Cantarel, B.L.; Coutinho, P.M.; Rancurel, C.; Bernard, T.; Lombard, V.; Henrissat, B. The Carbohydrate-Active EnZymes database (CAZy): An expert resource for Glycogenomics. Nucleic Acids Res. 2009, 37, D233–D238. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  33. Ashburner, M.; Ball, C.A.; Blake, J.A.; Botstein, D.; Butler, H.; Cherry, J.M.; Davis, A.P.; Dolinski, K.; Dwight, S.S.; Eppig, J.T.; et al. Gene ontology: Tool for the unification of biology. The Gene Ontology Consortium. Nat. Genet. 2000, 25, 25–29. [Google Scholar] [CrossRef] [Scilit]
  34. Kanehisa, M.; Goto, S.; Kawashima, S.; Okuno, Y.; Hattori, M. The KEGG resource for deciphering the genome. Nucleic Acids Res. 2004, 32, D277–D280. [Google Scholar] [CrossRef] [Scilit]
  35. Galperin, M.Y.; Makarova, K.S.; Wolf, Y.I.; Koonin, E.V. Expanded microbial genome coverage and improved protein family annotation in the COG database. Nucleic Acids Res. 2015, 43, D261–D269. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  36. Saier, M.H.; Reddy, V.S.; Moreno-Hagelsieb, G.; Hendargo, K.J.; Zhang, Y.; Iddamsetty, V.; Lam, K.J.K.; Tian, N.; Russum, S.; Wang, J.; et al. The Transporter Classification Database (TCDB): 2021 update. Nucleic Acids Res. 2021, 49, D461–D467. [Google Scholar] [CrossRef] [Scilit]
  37. Alikhan, N.F.; Petty, N.K.; Ben Zakour, N.L.; Beatson, S.A. BLAST Ring Image Generator (BRIG): Simple prokaryote genome comparisons. BMC Genom. 2011, 12, 402. [Google Scholar] [CrossRef] [Scilit]
  38. Huo, Y.; Lu, X.; Wang, X.; Wang, X.; Chen, L.; Guo, H.; Zhang, M.; Li, Y. Bifidobacterium animalis subsp. lactis A6 Alleviates Obesity Associated with Promoting Mitochondrial Biogenesis and Function of Adipose Tissue in Mice. Molecules 2020, 25, 1490. [Google Scholar] [CrossRef] [Scilit]
  39. Tian, A.; Yang, Y. Diagnosis of nonalcoholic fatty liver disease: The importance of pathology. J. Clin. Hepatol. 2023, 39, 491–497. [Google Scholar]
  40. Schmittgen, T.D.; Livak, K.J. Analyzing real-time PCR data by the comparative C(T) method. Nat. Protoc. 2008, 3, 1101–1108. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  41. Bolyen, E.; Rideout, J.R.; Dillon, M.R.; Bokulich, N.A.; Abnet, C.C.; Al-Ghalith, G.A.; Alexander, H.; Alm, E.J.; Arumugam, M.; Asnicar, F. Reproducible, interactive, scalable and extensible microbiome data science using QIIME 2. Nat. Biotechnol. 2019, 37, 852–857. [Google Scholar] [CrossRef] [Scilit]
  42. Chen, S.; Zhou, Y.; Chen, Y.; Gu, J. fastp: An ultra-fast all-in-one FASTQ preprocessor. Bioinformatics 2018, 34, i884–i890. [Google Scholar] [CrossRef] [Scilit]
  43. Magoč, T.; Salzberg, S.L. FLASH: Fast length adjustment of short reads to improve genome assemblies. Bioinformatics 2011, 27, 2957–2963. [Google Scholar] [CrossRef] [Scilit]
  44. Callahan, B.J.; McMurdie, P.J.; Rosen, M.J.; Han, A.W.; Johnson, A.J.A.; Holmes, S.P. DADA2: High-resolution sample inference from Illumina amplicon data. Nat. Methods 2016, 13, 581–583. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  45. Amir, A.; McDonald, D.; Navas-Molina, J.A.; Kopylova, E.; Morton, J.T.; Zech Xu, Z.; Kightley, E.P.; Thompson, L.R.; Hyde, E.R.; Gonzalez, A. Deblur rapidly resolves single-nucleotide community sequence patterns. mSystems 2017, 2, 10–1128. [Google Scholar] [CrossRef] [Scilit]
  46. Lambert, J.M.; Bongers, R.S.; de Vos, W.M.; Kleerebezem, M. Functional analysis of four bile salt hydrolase and penicillin acylase family members in Lactobacillus plantarum WCFS1. Appl. Environ. Microbiol. 2008, 74, 4719–4726. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  47. Wang, B.; Kong, Q.; Li, X.; Zhao, J.; Zhang, H.; Chen, W.; Wang, G. A high-fat diet increases gut microbiota biodiversity and energy expenditure due to nutrient difference. Nutrients 2020, 12, 3197. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  48. Hariharan, R.; Odjidja, E.N.; Scott, D.; Shivappa, N.; Hébert, J.R.; Hodge, A.; de Courten, B. The dietary inflammatory index, obesity, type 2 diabetes, and cardiovascular risk factors and diseases. Obes. Rev. 2022, 23, e13349. [Google Scholar] [CrossRef] [Scilit]
  49. Auerbach, N.; Liu, V.N.; Huang, D.R.; Clift, A.K.; Al-Ammouri, M.; El-Osta, A. What are community perspectives and experiences around GLP-1 receptor agonist medications for weight loss? A cross-sectional survey study in the UK. BMJ Public Health 2025, 3, e002519. [Google Scholar] [CrossRef] [Scilit]
  50. Lin, J.; Nie, Q.; Cheng, J.; Zhong, Y.N.; Zhang, T.; Zhang, X.; Ge, X.; Ding, Y.; Niu, C.; Gao, Y.; et al. A microbial amino-acid-conjugated bile acid, tryptophan-cholic acid, improves glucose homeostasis via the orphan receptor MRGPRE. Cell 2025, 188, P4530–P4548.E25. [Google Scholar] [CrossRef] [Scilit]
  51. Guzior, D.V.; Okros, M.; Shivel, M.; Armwald, B.; Bridges, C.; Fu, Y.; Martin, C.; Schilmiller, A.L.; Miller, W.M.; Ziegler, K.M.; et al. Bile salt hydrolase acyltransferase activity expands bile acid diversity. Nature 2024, 626, 852–858. [Google Scholar] [CrossRef] [Scilit]
  52. Prete, R.; Long, S.L.; Gallardo, A.L.; Gahan, C.G.; Corsetti, A.; Joyce, S.A. Beneficial bile acid metabolism from Lactobacillus plantarum of food origin. Sci. Rep. 2020, 10, 1165. [Google Scholar] [CrossRef] [Scilit]
  53. Pasolli, E.; De Filippis, F.; Mauriello, I.E.; Cumbo, F.; Walsh, A.M.; Leech, J.; Cotter, P.D.; Segata, N.; Ercolini, D. Large-scale genome-wide analysis links lactic acid bacteria from food with the gut microbiome. Nat. Commun. 2020, 11, 2610. [Google Scholar] [CrossRef] [Scilit]
  54. Jones, B.V.; Begley, M.; Hill, C.; Gahan, C.G.; Marchesi, J.R. Functional and comparative metagenomic analysis of bile salt hydrolase activity in the human gut microbiome. Proc. Natl. Acad. Sci. USA 2008, 105, 13580–13585. [Google Scholar] [CrossRef] [Scilit]
  55. Duar, R.M.; Lin, X.B.; Zheng, J.; Martino, M.E.; Grenier, T.; Pérez-Muñoz, M.E.; Leulier, F.; Gänzle, M.; Walter, J. Lifestyles in transition: Evolution and natural history of the genus Lactobacillus. FEMS Microbiol. Rev. 2017, 41, S27–S48. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  56. Wang, G.; Yu, H.; Feng, X.; Tang, H.; Xiong, Z.; Xia, Y.; Ai, L.; Song, X. Specific bile salt hydrolase genes in Lactobacillus plantarum AR113 and relationship with bile salt resistance. LWT 2021, 145, 111208. [Google Scholar] [CrossRef] [Scilit]
  57. Leung, C.; Rivera, L.; Furness, J.B.; Angus, P.W. The role of the gut microbiota in NAFLD. Nat. Rev. Gastroenterol. Hepatol. 2016, 13, 412–425. [Google Scholar] [CrossRef] [Scilit]
  58. García-Ruiz, I.; Solís-Muñoz, P.; Fernández-Moreira, D.; Grau, M.; Colina, F.; Muñoz-Yagüe, T.; Solís-Herruzo, J.A. High-fat diet decreases activity of the oxidative phosphorylation complexes and causes nonalcoholic steatohepatitis in mice. Dis. Model. Mech. 2014, 7, 1287–1296. [Google Scholar] [CrossRef] [Scilit]
  59. Pratt, D.S.; Kaplan, M.M. Evaluation of abnormal liver-enzyme results in asymptomatic patients. N. Engl. J. Med. 2000, 342, 1266–1271. [Google Scholar] [CrossRef] [Scilit]
  60. Kong, B.; Wang, L.; Chiang, J.Y.; Zhang, Y.; Klaassen, C.D.; Guo, G.L. Mechanism of tissue-specific farnesoid X receptor in suppressing the expression of genes in bile-acid synthesis in mice. Hepatology 2012, 56, 1034–1043. [Google Scholar] [CrossRef] [Scilit]
  61. Stanimirov, B.; Stankov, K.; Mikov, M. Bile acid signaling through farnesoid X and TGR5 receptors in hepatobiliary and intestinal diseases. Hepatobiliary Pancreat. Dis. Int. 2015, 14, 18–33. [Google Scholar] [CrossRef] [Scilit] [PubMed]
Figure 1. Assessment of BSH activity. (A,B) Precipitation halos around L. plantarum WCFS1 (A) and L. plantarum Lp20 (B) colonies on MRS-GDCA plates. (C,D) No precipitation halos around WCFS1 (C) and L. plantarum Lp20 (D) on MRS-TDCA plates. (E) BSH activities of twenty-eight Lactiplantibacillus plantarum strains toward GDCA.
Figure 1. Assessment of BSH activity. (A,B) Precipitation halos around L. plantarum WCFS1 (A) and L. plantarum Lp20 (B) colonies on MRS-GDCA plates. (C,D) No precipitation halos around WCFS1 (C) and L. plantarum Lp20 (D) on MRS-TDCA plates. (E) BSH activities of twenty-eight Lactiplantibacillus plantarum strains toward GDCA.
Nutrients 17 03555 g001
Figure 2. CGH genes were located in chromosome of L. plantarum Lp20 by comparing genomes with L. plantarum WCFS1. (A) Comparative genomic analysis of L. plantarum Lp20 strains based on BLAST_VERSION1 bin analysis. Matches with <50% identity or regions with no BLAST matches appear as blank spaces in the outer ring. The inner circle represents the reference sequence of L. plantarum Lp20. Ring of outer strain is L. plantarum WCFS1. (B) Schematic diagram of L. plantarum Lp20 cholylglycine hydrolase.
Figure 2. CGH genes were located in chromosome of L. plantarum Lp20 by comparing genomes with L. plantarum WCFS1. (A) Comparative genomic analysis of L. plantarum Lp20 strains based on BLAST_VERSION1 bin analysis. Matches with <50% identity or regions with no BLAST matches appear as blank spaces in the outer ring. The inner circle represents the reference sequence of L. plantarum Lp20. Ring of outer strain is L. plantarum WCFS1. (B) Schematic diagram of L. plantarum Lp20 cholylglycine hydrolase.
Nutrients 17 03555 g002
Figure 3. Identification of hydrolase activity of wild type and mutant strains. Bile salt agar precipitation halos assay of L. plantarum Lp20 wild type strain (A) and L. plantarum Lp20-Δbsh1 strain (B). (C) GDCA hydrolysis rate of L. plantarum Lp20 and its bsh1 mutant strain L. plantarum Lp20-Δbsh1. (D) Bsh1 complementation strain L. plantarum Lp20-Δbsh1+. (E) GDCA hydrolysis rate of bile salt in the L. plantarum Lp20-Δbsh1 and L. plantarum Lp20-Δbsh1+ strains complemented with pNZ11 (as control) and pNZbsh1 vector. Data are reported as the mean ± SEM from three independent experiments (*** p < 0.001). Red arrows denote the absence of bile salt agar precipitation halos; green arrows denote the presence of bile salt agar precipitation halos.
Figure 3. Identification of hydrolase activity of wild type and mutant strains. Bile salt agar precipitation halos assay of L. plantarum Lp20 wild type strain (A) and L. plantarum Lp20-Δbsh1 strain (B). (C) GDCA hydrolysis rate of L. plantarum Lp20 and its bsh1 mutant strain L. plantarum Lp20-Δbsh1. (D) Bsh1 complementation strain L. plantarum Lp20-Δbsh1+. (E) GDCA hydrolysis rate of bile salt in the L. plantarum Lp20-Δbsh1 and L. plantarum Lp20-Δbsh1+ strains complemented with pNZ11 (as control) and pNZbsh1 vector. Data are reported as the mean ± SEM from three independent experiments (*** p < 0.001). Red arrows denote the absence of bile salt agar precipitation halos; green arrows denote the presence of bile salt agar precipitation halos.
Nutrients 17 03555 g003
Figure 4. Effects of Lp20-WT and Lp20-Δbsh1 on bodyweight and adipose tissue mass analysis in mice. (A) Animal experiment design. (B,C) Body weight change (B) and net body weight gain (C) of four treatment groups. (DH) Body composition analysis (D,E) and adipose tissue mass analysis including eWAT (F), iWAT (G) and mesenteric fat mass (H). Values are expressed as mean ± SEM (n = 6). ns, no significant difference; * p < 0.05, ** p < 0.01, *** p < 0.001 and **** p < 0.0001 represent differences between HFD-induced obese mice and LFD-fed mice during 1–12 weeks. ## p < 0.01 and ### p < 0.001 represent differences between HFD group and Lp20-WT group. $ p < 0.05 represents difference between Lp20-WT and Lp20-Δbsh1 group.
Figure 4. Effects of Lp20-WT and Lp20-Δbsh1 on bodyweight and adipose tissue mass analysis in mice. (A) Animal experiment design. (B,C) Body weight change (B) and net body weight gain (C) of four treatment groups. (DH) Body composition analysis (D,E) and adipose tissue mass analysis including eWAT (F), iWAT (G) and mesenteric fat mass (H). Values are expressed as mean ± SEM (n = 6). ns, no significant difference; * p < 0.05, ** p < 0.01, *** p < 0.001 and **** p < 0.0001 represent differences between HFD-induced obese mice and LFD-fed mice during 1–12 weeks. ## p < 0.01 and ### p < 0.001 represent differences between HFD group and Lp20-WT group. $ p < 0.05 represents difference between Lp20-WT and Lp20-Δbsh1 group.
Nutrients 17 03555 g004
Figure 5. The impact of a HFD and L. plantarum Lp20 bile salt hydrolase on liver steatosis and serum bio-markers levels. H&E (A) and PAS (B) stained liver sections from LFD, HFD, Lp20-WT, and Lp20-Δbsh1 group. (CE) represent serum TC, high-density lipoprotein cholesterol, and LDL-C, respectively. (F) Serum alanine aminotransferase. (G) Serum AST. Values are expressed as mean ± SEM (n = 6). (HK) The mRNA expression of CYP7a1, CYP27a1, FXR, TGR5 in mice liver (n = 5). ns, no significant difference; * p < 0.05, ** p < 0.01, *** p < 0.001 and **** p < 0.0001 showed the significant difference with ANOVA analysis.
Figure 5. The impact of a HFD and L. plantarum Lp20 bile salt hydrolase on liver steatosis and serum bio-markers levels. H&E (A) and PAS (B) stained liver sections from LFD, HFD, Lp20-WT, and Lp20-Δbsh1 group. (CE) represent serum TC, high-density lipoprotein cholesterol, and LDL-C, respectively. (F) Serum alanine aminotransferase. (G) Serum AST. Values are expressed as mean ± SEM (n = 6). (HK) The mRNA expression of CYP7a1, CYP27a1, FXR, TGR5 in mice liver (n = 5). ns, no significant difference; * p < 0.05, ** p < 0.01, *** p < 0.001 and **** p < 0.0001 showed the significant difference with ANOVA analysis.
Nutrients 17 03555 g005
Figure 6. Variation of fecal microbiota composition in response to L. plantarum Lp20 intervention. (A) PCoA of the community structure. (B,C) Gut Microbiota Health Index at the genus level. (D) Differential species testing at the genus level. (E,F) Linear discriminant analysis effect size (LEfSe). (G) Heat map depicting Spearman correlations between fecal microbial ASV abundances (16S rRNA sequencing) and host metabolic phenotypes. * p < 0.05, ** p < 0.01, *** p < 0.001; n = 4 mice per group.
Figure 6. Variation of fecal microbiota composition in response to L. plantarum Lp20 intervention. (A) PCoA of the community structure. (B,C) Gut Microbiota Health Index at the genus level. (D) Differential species testing at the genus level. (E,F) Linear discriminant analysis effect size (LEfSe). (G) Heat map depicting Spearman correlations between fecal microbial ASV abundances (16S rRNA sequencing) and host metabolic phenotypes. * p < 0.05, ** p < 0.01, *** p < 0.001; n = 4 mice per group.
Nutrients 17 03555 g006
Table 1. Dietary composition and energy density in animal experiments.
Table 1. Dietary composition and energy density in animal experiments.
ProductD12450J (LFD)D12492 (HFD) *
gm%kcal%gm%kcal%
Protein19.220.02620.0
Carbohydrate67.370.02620.0
Fat4.310.03560.0
Ingredientgmkcalgmkcal
Casein, 30 Mesh200800200800
L-Cystine312312
Corn Starch506.22024.800
Maltodextrin 10125500125500
Sucrose68.8275.268.8275.2
Cellulose, BW 200500500
Soybean Oil2522525225
Lard201802452205
Mineral Mix S10026100100
Dicalcium Phosphate130130
Calcium Carbonate5.505.50
Potassium Citrate·1H2O16.5016.50
Vitamin Mix V1000110401040
Choline Bitartrate2020
FD&C Yellow Dye #50.04000
FD&C Red Dye #400000
FD&C Blue Day #10.0100.050
Total1055.054057773.854057
kcal/gm3.855.24
* As for D12492, the content of cholesterol is 279.6 mg/kg.
Table 2. Primers used in this study.
Table 2. Primers used in this study.
GenePrimer Sequence (5′-3′)
CYP7a1Forward: GGGATTGCTGTGGTAGTGAGC
Reverse: GGTATGGAATCAACCCGTTGTC
CYP27a1Forward: CCAGGCACAGGAGAGTACG
Reverse: GGGCAAGTGCAGCACATAG
FXRForward: GCTTGATGTGCTACAAAAGCTG
Reverse: CGTGGTGATGGTTGAATGTCC
TGR5Forward: CCTGGCAAGCCTCATCGTC
Reverse: AGCAGCCCGGCTAGTAGTAG
β-actinForward: GTGACGTTGACATCCGTAAAGA
Reverse: GCCGGACTCATCGTACTCC
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Bai, X.; Lu, F.; Jing, Y.; Wang, H.; Qian, H.; Zhang, M.; Zhai, Z.; Hao, Y. Lactiplantibacillus plantarum Lp20 Alleviates High Fat Diet-Induced Obesity in Mice via Its Bile Salt Hydrolase Activity. Nutrients 2025, 17, 3555. https://doi.org/10.3390/nu17223555

AMA Style

Bai X, Lu F, Jing Y, Wang H, Qian H, Zhang M, Zhai Z, Hao Y. Lactiplantibacillus plantarum Lp20 Alleviates High Fat Diet-Induced Obesity in Mice via Its Bile Salt Hydrolase Activity. Nutrients. 2025; 17(22):3555. https://doi.org/10.3390/nu17223555

Chicago/Turabian Style

Bai, Xiaoyue, Fangzhou Lu, Yizhi Jing, Hui Wang, Haidong Qian, Ming Zhang, Zhengyuan Zhai, and Yanling Hao. 2025. "Lactiplantibacillus plantarum Lp20 Alleviates High Fat Diet-Induced Obesity in Mice via Its Bile Salt Hydrolase Activity" Nutrients 17, no. 22: 3555. https://doi.org/10.3390/nu17223555

APA Style

Bai, X., Lu, F., Jing, Y., Wang, H., Qian, H., Zhang, M., Zhai, Z., & Hao, Y. (2025). Lactiplantibacillus plantarum Lp20 Alleviates High Fat Diet-Induced Obesity in Mice via Its Bile Salt Hydrolase Activity. Nutrients, 17(22), 3555. https://doi.org/10.3390/nu17223555

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop