Lactobacillus plantarum L11 and Lactobacillus reuteri LR: Ameliorate Obesity via AMPK Pathway
Abstract
1. Introduction
2. Materials and Methods
2.1. Preparation of Lyophilized Probiotics for Animal Test
2.2. Animals and the Experiment Design
2.3. Blood Biochemical Test
2.4. ELISA
2.5. Organizational Analysis
2.6. Quantitative Real-Time PCR
2.7. Western Blot Analysis
2.8. PCR Amplication for Gut Microbiota
2.9. Data Analysis
3. Results
3.1. Lactobacillus Reduced Fat Accumulation in HFD Mice
3.2. Lactobacillus Reduced Lipid Content in HFD Mice
3.3. Lactobacillus Reduced the Inflammation in HFD Mice
3.4. Lactobacillus Reduced the Expression of Liver Lipid-Related Proteins in HFD Mice
3.5. Lactobacillus Improved Intestinal Microbiota in HFD Mice
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Data Availability Statement
Conflicts of Interest
References
- Südy, R.; Peták, F.; Kiss, L.; Balogh, A.L.; Fodor, G.H.; Korsós, A.; Schranc, Á.; Babik, B. Obesity and diabetes: Similar respiratory mechanical but different gas exchange defects. Am. J. Physiol. Lung Cell Mol. Physiol. 2021, 320, L368–L376. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Inaishi, J.; Saisho, Y. Beta-Cell Mass in Obesity and Type 2 Diabetes, and Its Relation to Pancreas Fat: A Mini-Review. Nutrients 2020, 12, 3846. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Polyzos, S.A.; Kountouras, J.; Mantzoros, C.S. Obesity and nonalcoholic fatty liver disease: From pathophysiology to therapeutics. Metabolism 2019, 92, 82–97. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Xenoulis, P.G.; Steiner, J.M. Canine hyperlipidaemia. J. Small Anim. Pract. 2015, 56, 595–605. [Google Scholar] [CrossRef] [Scilit]
- Fanti, M.; Mishra, A.; Longo, V.D.; Brandhorst, S. Time-Restricted Eating, Intermittent Fasting, and Fasting-Mimicking Diets in Weight Loss. Curr. Obes. Rep. 2021, 10, 70–80. [Google Scholar] [CrossRef] [Scilit]
- Alvarez-Arrano, V.; Martin-Pelaez, S. Effects of Probiotics and Synbiotics on Weight Loss in Subjects with Overweight or Obesity: A Systematic Review. Nutrients 2021, 13, 3627. [Google Scholar] [CrossRef] [Scilit]
- Reuben, R.C.; Roy, P.C.; Sarkar, S.L.; Rubayet Ul Alam, A.S.M.; Jahid, I.K. Characterization and evaluation of lactic acid bacteria from indigenous raw milk for potential probiotic properties. J. Dairy Sci. 2020, 103, 1223–1237. [Google Scholar] [CrossRef] [Scilit]
- Ondee, T.; Pongpirul, K.; Visitchanakun, P.; Saisorn, W.; Kanacharoen, S.; Wongsaroj, L.; Kullapanich, C.; Ngamwongsatit, N.; Settachaimongkon, S.; Somboonna, N.; et al. Lactobacillus acidophilus LA5 improves saturated fat-induced obesity mouse model through the enhanced intestinal Akkermansia muciniphila. Sci. Rep. 2021, 11, 6367. [Google Scholar] [CrossRef] [Scilit]
- Kang, Y.; Kang, X.; Yang, H.; Liu, H.; Yang, X.; Liu, Q.; Tian, H.; Xue, Y.; Ren, P.; Kuang, X.; et al. Lactobacillus acidophilus ameliorates obesity in mice through modulation of gut microbiota dysbiosis and intestinal permeability. Pharmacol. Res. 2022, 175, 106020. [Google Scholar] [CrossRef] [Scilit]
- Lee, Y.-S.; Park, E.-J.; Park, G.-S.; Ko, S.-H.; Park, J.; Lee, Y.-K.; Kim, J.-Y.; Lee, D.; Kang, J.; Lee, H.-J. Lactiplantibacillusplantarum ATG-K2 Exerts an Anti-Obesity Effect in High-Fat Diet-Induced Obese Mice by Modulating the Gut Microbiome. Int. J. Mol. Sci. 2021, 22, 12665. [Google Scholar] [CrossRef] [Scilit]
- Ondee, T.; Pongpirul, K.; Janchot, K.; Kanacharoen, S.; Lertmongkolaksorn, T.; Wongsaroj, L.; Somboonna, N.; Ngamwongsatit, N.; Leelahavanichkul, A. Lactiplantibacillus plantarum dfa1 Outperforms Enterococcus faecium dfa1 on Anti-Obesity in High Fat-Induced Obesity Mice Possibly through the Differences in Gut Dysbiosis Attenuation, despite the Similar Anti-Inflammatory Properties. Nutrients 2021, 14, 80. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Sun, Y.; Tang, Y.; Hou, X.; Wang, H.; Huang, L.; Wen, J.; Niu, H.; Zeng, W.; Bai, Y. Novel Lactobacillus reuteri HI120 Affects Lipid Metabolism in C57BL/6 Obese Mice. Front. Vet. Sci. 2020, 7, 560241. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Liang, S.; Kang, Y.; Zhao, Y.; Sun, J.; Wang, X.; Tao, H.; Wang, Z.; Wang, J.; Zhong, Y.; Han, B. Characterization and potential lipid-lowering effects of lactic acid bacteria isolated from cats. Front. Microbiol. 2024, 15, 1392864. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Chan, W.K. Comparison between obese and non-obese nonalcoholic fatty liver disease. Clin. Mol. Hepatol. 2023, 29, S58–S67. [Google Scholar] [CrossRef] [Scilit]
- Sutthasupha, P.; Lungkaphin, A. The potential roles of chitosan oligosaccharide in prevention of kidney injury in obese and diabetic conditions. Food Funct. 2020, 11, 7371–7388. [Google Scholar] [CrossRef] [Scilit]
- Cai, M.; Zou, Z. Effect of aerobic exercise on blood lipid and glucose in obese or overweight adults: A meta-analysis of randomised controlled trials. Obes. Res. Clin. Pract. 2016, 10, 589–602. [Google Scholar] [CrossRef] [Scilit]
- Kawai, T.; Autieri, M.V.; Scalia, R. Adipose tissue inflammation and metabolic dysfunction in obesity. Am. J. Physiol. Cell Physiol. 2021, 320, C375–C391. [Google Scholar] [CrossRef] [Scilit]
- Jia, X.; Xu, W.; Zhang, L.; Li, X.; Wang, R.; Wu, S. Impact of Gut Microbiota and Microbiota-Related Metabolites on Hyperlipidemia. Front. Cell Infect. Microbiol. 2021, 11, 634780. [Google Scholar] [CrossRef] [Scilit]
- Cândido, F.G.; Valente, F.X.; Grześkowiak, Ł.M.; Moreira, A.P.B.; Rocha, D.M.U.P.; Alfenas, R.C.G. Impact of dietary fat on gut microbiota and low-grade systemic inflammation: Mechanisms and clinical implications on obesity. Int. J. Food Sci. Nutr. 2018, 69, 125–143. [Google Scholar] [CrossRef] [Scilit]
- Baek, G.H.; Yoo, K.M.; Kim, S.Y.; Lee, D.H.; Chung, H.; Jung, S.C.; Park, S.K.; Kim, J.S. Collagen Peptide Exerts an Anti-Obesity Effect by Influencing the Firmicutes/Bacteroidetes Ratio in the Gut. Nutrients 2023, 15, 2610. [Google Scholar] [CrossRef] [Scilit]
- Zhang, J.; Li, L.; Zhang, T.; Zhong, J. Characterization of a novel type of glycogen-degrading amylopullulanase from Lactobacillus crispatus. Appl. Microbiol. Biotechnol. 2022, 106, 4053–4064. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Li, X.; Liu, Y.; Guo, X.; Ma, Y.; Zhang, H.; Liang, H. Effect of Lactobacillus casei on lipid metabolism and intestinal microflora in patients with alcoholic liver injury. Eur. J. Clin. Nutr. 2021, 75, 1227–1236. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Chen, L.-H.; Chen, Y.-H.; Cheng, K.-C.; Chien, T.-Y.; Chan, C.-H.; Tsao, S.-P.; Huang, H.-Y. Antiobesity effect of Lactobacillus reuteri 263 associated with energy metabolism remodeling of white adipose tissue in high-energy-diet-fed rats. J. Nutr. Biochem. 2018, 54, 87–94. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Gan, Y.; Chen, H.; Zhou, X.; Chu, L.; Ran, W.; Tan, F.; Zhao, X. Regulating effect of Lactobacillus plantarum CQPC03 on lipid metabolism in high-fat diet-induced obesity in mice. J. Food Biochem. 2020, 44, e13495. [Google Scholar] [CrossRef] [Scilit]
- Al-Thepyani, M.; Algarni, S.; Gashlan, H.; Elzubier, M.; Baz, L. Evaluation of the Anti-Obesity Effect of Zeaxanthin and Exercise in HFD-Induced Obese Rats. Nutrients 2022, 14, 4944. [Google Scholar] [CrossRef] [Scilit]
- Jabłonowska-Lietz, B.; Wrzosek, M.; Włodarczyk, M.; Nowicka, G. New indexes of body fat distribution, visceral adiposity index, body adiposity index, waist-to-height ratio, and metabolic disturbances in the obese. Kardiol. Pol. 2017, 75, 1185–1191. [Google Scholar] [CrossRef] [Scilit]
- Piché, M.E.; Tchernof, A.; Després, J.P. Obesity Phenotypes, Diabetes, and Cardiovascular Diseases. Circ. Res. 2020, 126, 1477–1500. [Google Scholar] [CrossRef] [Scilit]
- Ye, B.; Zhang, J.; Tan, Z.; Chen, J.; Pan, X.; Zhou, Y.; Wang, W.; Liu, L.; Zhu, W.; Sun, Y.; et al. Association of liver function with health-related physical fitness: A cross-sectional study. BMC Public Health 2023, 23, 1797. [Google Scholar] [CrossRef] [Scilit]
- Oettl, K.; Birner-Gruenberger, R.; Spindelboeck, W.; Stueger, H.P.; Dorn, L.; Stadlbauer, V.; Putz-Bankuti, C.; Krisper, P.; Graziadei, I.; Vogel, W.; et al. Oxidative albumin damage in chronic liver failure: Relation to albumin binding capacity, liver dysfunction and survival. J. Hepatol. 2013, 59, 978–983. [Google Scholar] [CrossRef] [Scilit]
- Lu, H.; You, Y.; Zhou, X.; He, Q.; Wang, M.; Chen, L.; Zhou, L.; Sun, X.; Liu, Y.; Jiang, P.; et al. Citrus reticulatae pericarpium Extract Decreases the Susceptibility to HFD-Induced Glycolipid Metabolism Disorder in Mice Exposed to Azithromycin in Early Life. Front. Immunol. 2021, 12, 774433. [Google Scholar] [CrossRef] [Scilit]
- Pirimoğlu, B.; Sade, R.; Polat, G.; İşlek, A.; Kantarcı, M. Analysis of correlation between liver fat fraction and AST and ALT levels in overweight and obese children by using new magnetic resonance imaging technique. Turk. J. Gastroenterol. 2020, 31, 156–162. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Qi, M.-Y.; He, Y.-H.; Cheng, Y.; Fang, Q.; Ma, R.-Y.; Zhou, S.-J.; Hao, J.-Q. Icariin ameliorates streptozocin-induced diabetic nephropathy through suppressing the TLR4/NF-κB signal pathway. Food Funct. 2021, 12, 1241–1251. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Hoofnagle, A.N.; Peterson, G.N.; Kelly, J.L.; Sayre, C.A.; Chou, D.; Hirsch, I.B. Use of serum and plasma glucose measurements as a benchmark for improved hospital-wide glycemic control. Endocr. Pract. 2008, 14, 556–563. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Verde, L.; Lucà, S.; Cernea, S.; Sulu, C.; Yumuk, V.D.; Jenssen, T.G.; Savastano, S.; Sarno, G.; Colao, A.; Barrea, L.; et al. The Fat Kidney. Curr. Obes. Rep. 2023, 12, 86–98. [Google Scholar] [CrossRef] [Scilit]
- Xian, Y.; Wu, Y.; He, M.; Cheng, J.; Lv, X.; Ren, Y. Sleeve Gastrectomy Attenuates the Severity of Cerulein-Induced Acute Pancreatitis in Obese Rats. Obes. Surg. 2021, 31, 4107–4117. [Google Scholar] [CrossRef] [Scilit]
- Wolf, G. High-fat, high-cholesterol diet raises plasma HDL cholesterol: Studies on the mechanism of this effect. Nutr. Rev. 1996, 54 Pt 1, 34–35. [Google Scholar] [CrossRef] [Scilit]
- Deng, Z.; Meng, C.; Huang, H.; Song, S.; Fu, L.; Fu, Z. The different effects of psyllium husk and orlistat on weight control, the amelioration of hypercholesterolemia and non-alcohol fatty liver disease in obese mice induced by a high-fat diet. Food Funct. 2022, 13, 8829–8849. [Google Scholar] [CrossRef] [Scilit]
- Liu, H.; Liu, J.; Liu, Z.; Wang, Q.; Liu, J.; Feng, D.; Zou, J. Lycopene Reduces Cholesterol Absorption and Prevents Atherosclerosis in ApoE-/- Mice by Downregulating HNF-1α and NPC1L1 Expression. J. Agric. Food Chem. 2021, 69, 10114–10120. [Google Scholar] [CrossRef] [Scilit]
- He, Z.; Zhang, Z.; Xu, P.; Dirsch, V.M.; Wang, L.; Wang, K. Laminarin Reduces Cholesterol Uptake and NPC1L1 Protein Expression in High-Fat Diet (HFD)-Fed Mice. Mar. Drugs 2023, 21, 624. [Google Scholar] [CrossRef] [Scilit]
- Toyoda, Y.; Takada, T.; Yamanashi, Y.; Suzuki, H. Pathophysiological importance of bile cholesterol reabsorption: Hepatic NPC1L1-exacerbated steatosis and decreasing VLDL-TG secretion in mice fed a high-fat diet. Lipids Health Dis. 2019, 18, 234. [Google Scholar] [CrossRef] [Scilit]
- Silva-Veiga, F.M.; Miranda, C.S.; Vasques-Monteiro, I.M.L.; Souza-Tavares, H.; Martins, F.F.; Daleprane, J.B.; Souza-Mello, V. Peroxisome proliferator-activated receptor-alpha activation and dipeptidyl peptidase-4 inhibition target dysbiosis to treat fatty liver in obese mice. World J. Gastroenterol. 2022, 28, 1814–1829. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Santana-Oliveira, D.A.; Fernandes-da-Silva, A.; Miranda, C.S.; Martins, F.F.; Mandarim-de-Lacerda, C.A.; Souza-Mello, V. A PPAR-alpha agonist and DPP-4 inhibitor mitigate adipocyte dysfunction in obese mice. J. Mol. Endocrinol. 2022, 68, 225–241. [Google Scholar] [CrossRef] [Scilit]
- Manoharan, I.; Suryawanshi, A.; Hong, Y.; Ranganathan, P.; Shanmugam, A.; Ahmad, S.; Swafford, D.; Manicassamy, B.; Ramesh, G.; Koni, P.A.; et al. Homeostatic PPARα Signaling Limits Inflammatory Responses to Commensal Microbiota in the Intestine. J. Immunol. 2016, 196, 4739–4749. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Wang, Q.; Liu, S.; Zhai, A.; Zhang, B.; Tian, G. AMPK-Mediated Regulation of Lipid Metabolism by Phosphorylation. Biol. Pharm. Bull. 2018, 41, 985–993. [Google Scholar] [CrossRef] [Scilit]
- Huang, R.; Guo, F.; Li, Y.; Liang, Y.; Li, G.; Fu, P.; Ma, L. Activation of AMPK by triptolide alleviates nonalcoholic fatty liver disease by improving hepatic lipid metabolism, inflammation and fibrosis. Phytomedicine 2021, 92, 153739. [Google Scholar] [CrossRef] [Scilit]
- Rohr, M.W.; Narasimhulu, C.A.; Rudeski-Rohr, T.A.; Parthasarathy, S. Negative Effects of a High-Fat Diet on Intestinal Permeability: A Review. Adv. Nutr. 2020, 11, 77–91. [Google Scholar] [CrossRef] [Scilit]
- Tan, B.L.; Norhaizan, M.E. Effect of High-Fat Diets on Oxidative Stress, Cellular Inflammatory Response and Cognitive Function. Nutrients 2019, 11, 2579. [Google Scholar] [CrossRef] [Scilit]
- Malesza, I.J.; Malesza, M.; Walkowiak, J.; Mussin, N.; Walkowiak, D.; Aringazina, R.; Bartkowiak-Wieczorek, J.; Mądry, E. High-Fat, Western-Style Diet, Systemic Inflammation, and Gut Microbiota: A Narrative Review. Cells 2021, 10, 3164. [Google Scholar] [CrossRef] [Scilit]
- Xie, Y.; Ding, F.; Di, W.; Lv, Y.; Xia, F.; Sheng, Y.; Yu, J.; Ding, G. Impact of a high-fat diet on intestinal stem cells and epithelial barrier function in middle-aged female mice. Mol. Med. Rep. 2020, 21, 1133–1144. [Google Scholar] [CrossRef] [Scilit]
- Ghaben, A.L.; Scherer, P.E. Adipogenesis and metabolic health. Nat. Rev. Mol. Cell Biol. 2019, 20, 242–258. [Google Scholar] [CrossRef] [Scilit]
- Díez-Sainz, E.; Milagro, F.I.; Riezu-Boj, J.I.; Lorente-Cebrián, S. Effects of gut microbiota-derived extracellular vesicles on obesity and diabetes and their potential modulation through diet. J. Physiol. Biochem. 2022, 78, 485–499. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Li, Z.; Zhou, E.; Liu, C.; Wicks, H.; Yildiz, S.; Razack, F.; Ying, Z.; Kooijman, S.; Koonen, D.P.; Heijink, M.; et al. Dietary butyrate ameliorates metabolic health associated with selective proliferation of gut Lachnospiraceae bacterium 28-4. JCI Insight. 2023, 8, e166655. [Google Scholar] [CrossRef] [Scilit]





| Gene | Organism | Sequence5’~3’ | AnnealingT °C |
|---|---|---|---|
| PPARalpha | Liver | FW:CAAGTGCCTGTCTGTCGGG RV: GCGGGTTGTTGCTGGTCT | 50 |
| AMPK | Liver | FW:CGTCGCCTACCACCTCATC RV: ATTTTGCCTTCCGTACACCTT | 50 |
| Beta-actin | Liver | FW:GTGCTATGTTGCTCTAGACTTCG RV: ATGCCACAGGATTCCATACC | 50 |
| Biochemical Indicator | Group * | |||
|---|---|---|---|---|
| LR | L11 | CK | M | |
| Mg | 1.10 ± 0.09 b | 1.25 ± 0.05 ab | 1.20 ± 0.06 ab | 1.32 ± 0.23 a |
| Ca × P | 57.83 ± 8.04 | 60.83 ± 7.65 | 64.83 ± 8.04 | 54.83 ± 30.76 |
| P | 2.19 ± 0.17 | 2.37 ± 0.29 | 2.52 ± 0.16 | 2.35 ± 0.69 |
| Ca | 2.12 ± 0.16 | 2.07 ± 0.04 | 2.08 ± 0.14 | 2.10 ± 0.09 |
| tCO2 | 16.50 ± 1.87 | 15.83 ± 0.75 | 16.67 ± 1.21 | 16.00 ± 1.10 |
| BUN/CRE | 43.83 ± 12.44 | 30.50 ± 10.56 | 37.17 ± 18.53 | 44.83 ± 24.23 |
| BUN | 6.94 ± 0.79 ab | 5.68 ± 0.26 c | 6.06 ± 0.66 bc | 7.73 ± 1.04 a |
| CRE | 43.00 ± 16.35 | 51.00 ± 17.56 | 48.33 ± 21.57 | 52.83 ± 24.21 |
| GLU | 5.72 ± 0.87 b | 4.28 ± 0.57 c | 7.32 ± 1.20 a | 4.92 ± 0.81 bc |
| AMY | 936.67 ± 106.15 c | 1218.83 ± 68.71 ab | 1129.67 ± 106.67 b | 1342.33 ± 127.80 a |
| CK | 124.83 ± 67.80 b | 180.17 ± 89.95 ab | 342.83 ± 236.18 a | 135.83 ± 63.13 b |
| TBA | 3.18 ± 1.32 | 3.50 ± 1.26 | 3.87 ± 2.63 | 1.98 ± 0.35 |
| ALP | 86.67 ± 12.08 | 109.67 ± 20.77 | 116.33 ± 31.44 | 92.33 ± 12.50 |
| GGT | 1.25 ± 0.58 ab | 1.5 ± 0.34 a | 0.83 ± 0.54 ab | 0.70 ± 0.51 b |
| AST/ALT | 4.44 ± 1.07 | 5.98 ± 1.51 | 3.76 ± 0.64 | 5.21 ± 2.77 |
| AST | 104.83 ± 9.93 b | 154.83 ± 36.81 a | 126.67 ± 42.25 ab | 129.33 ± 35.41 ab |
| ALT | 24.67 ± 5.82 | 27.00 ± 9.30 | 33.00 ± 5.73 | 31.00 ± 16.60 |
| TBIL | 3.11 ± 0.60 | 3.68 ± 1.01 | 3.33 ± 1.11 | 2.71 ± 1.21 |
| A/G | 1.43 ± 0.05 b | 1.45 ± 0.054 b | 1.58 ± 0.075 a | 1.40 ± 0.06 b |
| GLO | 22.42 ± 3.58 ab | 22.6 ± 1.056 ab | 21.03 ± 1.30 b | 23.10 ± 0.87 a |
| ALB | 32.38 ± 2.11 | 32.60 ± 0.72 | 33.48 ± 1.59 | 32.73 ± 1.94 |
| TP | 54.80 ± 3.58 | 55.20 ± 1.06 | 54.52 ± 2.71 | 55.83 ± 2.72 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Liang, S.; Sun, J.; Gu, X.; Zhao, Y.; Wang, X.; Tao, H.; Wang, Z.; Zhong, Y.; Wang, J.; Han, B. Lactobacillus plantarum L11 and Lactobacillus reuteri LR: Ameliorate Obesity via AMPK Pathway. Nutrients 2025, 17, 4. https://doi.org/10.3390/nu17010004
Liang S, Sun J, Gu X, Zhao Y, Wang X, Tao H, Wang Z, Zhong Y, Wang J, Han B. Lactobacillus plantarum L11 and Lactobacillus reuteri LR: Ameliorate Obesity via AMPK Pathway. Nutrients. 2025; 17(1):4. https://doi.org/10.3390/nu17010004
Chicago/Turabian StyleLiang, Shukun, Jintao Sun, Xinshu Gu, Ya Zhao, Xiumin Wang, Hui Tao, Zhenlong Wang, Yougang Zhong, Jinquan Wang, and Bing Han. 2025. "Lactobacillus plantarum L11 and Lactobacillus reuteri LR: Ameliorate Obesity via AMPK Pathway" Nutrients 17, no. 1: 4. https://doi.org/10.3390/nu17010004
APA StyleLiang, S., Sun, J., Gu, X., Zhao, Y., Wang, X., Tao, H., Wang, Z., Zhong, Y., Wang, J., & Han, B. (2025). Lactobacillus plantarum L11 and Lactobacillus reuteri LR: Ameliorate Obesity via AMPK Pathway. Nutrients, 17(1), 4. https://doi.org/10.3390/nu17010004

