Effect of Elderberry (Sambucus nigra L.) Extract Intake on Normalizing Testosterone Concentration in Testosterone Deficiency Syndrome Rat Model Through Regulation of 17β-HSD, 5α-Reductase, and CYP19A1 Expression
Abstract
:1. Introduction
2. Materials and Methods
2.1. Preparation of the Extract
2.2. Isolation and Purification of KSB191 Components
2.3. Major Compounds Analysis in KSB191
2.4. Animal and Experimental Protocols
2.5. Measurement of TDS-Related Indicators in Serum
2.6. Quantitative Real-Time Polymerase Chain Reaction (qRT-PCR) Analysis in Testis Tissue
2.7. Western Blot Analysis in Testis Tissue
2.8. Sperm Motility Analysis
2.9. Prostatic Hyperplasia Markers Analysis
2.10. Biochemical Analysis in Serum
2.11. Statistical Analysis
3. Results
3.1. Compounds Isolated from KSB191
3.2. Effect of KSB191 on Hormone Indicators in Serum
3.3. Regulation of Testosterone Synthesis Pathway by KSB191
3.4. Effect of KSB191 on Sperm Motility
3.5. Safety of KSB191 on Prostatic Hyperplasia and Liver or Kidney Function
4. Discussion
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Guo, J.; Huang, X.; Dou, L.; Yan, M.; Shen, T.; Tang, W.; Li, J. Aging and aging-related diseases: From molecular mechanisms to interventions and treatments. Signal Transduct. Target. Ther. 2022, 7, 391. [Google Scholar] [CrossRef] [PubMed]
- Khaltourina, D.; Matveyev, Y.; Alekseev, A.; Cortese, F.; Ioviţă, A. Aging fits the disease criteria of the international classification of diseases. Mech. Ageing Dev. 2020, 189, 111230. [Google Scholar] [CrossRef] [PubMed]
- Song, J.; Xiao, L.; Zhang, Z.; Wang, Y.; Kouis, P.; Rasmussen, L.J.; Dai, F. Effects of reactive oxygen species and mitochondrial dysfunction on reproductive aging. Front. Cell Dev. Biol. 2024, 12, 1347286. [Google Scholar] [CrossRef]
- Hales, D.B.; Allen, J.A.; Shankara, T.; Janus, P.; Buck, S.; Diemer, T.; Hales, K.H. Mitochondrial function in Leydig cell steroidogenesis. Ann. N. Y. Acad. Sci. 2005, 1061, 120–134. [Google Scholar] [CrossRef] [PubMed]
- Decaroli, M.C.; Rochira, V. Aging and sex hormones in males. Virulence 2017, 8, 545–570. [Google Scholar] [CrossRef]
- Sattler, F.; Bhasin, S.; He, J.; Chou, C.-P.; Castaneda-Sceppa, C.; Yarasheski, K.; Binder, E.; Schroeder, E.T.; Kawakubo, M.; Zhang, A. Testosterone threshold levels and lean tissue mass targets needed to enhance skeletal muscle strength and function: The HORMA trial. J. Gerontol. Ser. A: Biomed. Sci. Med. Sci. 2011, 66, 122–129. [Google Scholar] [CrossRef]
- Tostain, J.L.; Blanc, F. Testosterone deficiency: A common, unrecognized syndrome. Nat. Clin. Pract. Urol. 2008, 5, 388–396. [Google Scholar] [CrossRef] [PubMed]
- George, A.; Henkel, R. Phytoandrogenic properties of E urycoma longifolia as natural alternative to testosterone replacement therapy. Andrologia 2014, 46, 708–721. [Google Scholar] [CrossRef]
- García-Cruz, E.; Alcaraz, A. Testosterone deficiency syndrome: Diagnosis and treatment. Actas Urológicas Españolas 2020, 44, 294–300. [Google Scholar] [CrossRef]
- Kang, B.; Noh, M.; Park, H.J. Compliance with testosterone replacement therapy in patients with testosterone deficiency syndrome: A 10-year observational study in Korea. World J. Men’s Health 2022, 40, 686. [Google Scholar] [CrossRef]
- Montano, L.M.; Sommer, B.; Solis-Chagoyan, H.; Romero-Martinez, B.S.; Aquino-Galvez, A.; Gomez-Verjan, J.C.; Calixto, E.; Gonzalez-Avila, G.; Flores-Soto, E. Could lower testosterone in older men explain higher COVID-19 morbidity and mortalities? Int. J. Mol. Sci. 2022, 23, 935. [Google Scholar] [CrossRef] [PubMed]
- Osterberg, E.C.; Bernie, A.M.; Ramasamy, R. Risks of testosterone replacement therapy in men. Indian J. Urol. 2014, 30, 2–7. [Google Scholar] [CrossRef] [PubMed]
- Park, H.J.; Lee, K.S.; Lee, E.K.; Park, N.C. Efficacy and safety of a mixed extract of Trigonella foenum-graecum seed and Lespedeza cuneata in the treatment of testosterone deficiency syndrome: A randomized, double-blind, placebo-controlled clinical trial. World J. Men’s Health 2018, 36, 230–238. [Google Scholar] [CrossRef] [PubMed]
- Uhl, K.; Mitchell, A.E. Elderberry, An Ancient Remedy: A Comprehensive Study of the Bioactive Compounds in Three Sambucus nigra L. Subspecies. Annu. Rev. Food Sci. Technol. 2024, 15, 27–51. [Google Scholar] [CrossRef]
- Ferreira, S.S.; Silva, A.M.; Nunes, F.M. Sambucus nigra L. fruits and flowers: Chemical composition and related bioactivities. Food Rev. Int. 2022, 38, 1237–1265. [Google Scholar] [CrossRef]
- Setz, C.; Fröba, M.; Große, M.; Rauch, P.; Auth, J.; Steinkasserer, A.; Plattner, S.; Schubert, U. European Black elderberry fruit extract inhibits replication of SARS-CoV-2 in vitro. Nutraceuticals 2023, 3, 91–106. [Google Scholar] [CrossRef]
- Domínguez, R.; Pateiro, M.; Munekata, P.E.; Santos López, E.M.; Rodríguez, J.A.; Barros, L.; Lorenzo, J.M. Potential use of elderberry (Sambucus nigra L.) as natural colorant and antioxidant in the food industry. A review. Foods 2021, 10, 2713. [Google Scholar] [CrossRef]
- Jeong, H.C.; Jeon, S.H.; Guan Qun, Z.; Bashraheel, F.; Choi, S.W.; Kim, S.J.; Bae, W.J.; Cho, H.J.; Ha, U.-S.; Hong, S.H. Lycium chinense Mill improves hypogonadism via anti-oxidative stress and anti-apoptotic effect in old aged rat model. Aging Male 2020, 23, 287–296. [Google Scholar] [CrossRef]
- Chinnappan, S.M.; George, A.; Pandey, P.; Narke, G.; Choudhary, Y.K. Effect of Eurycoma longifolia standardised aqueous root extract–Physta® on testosterone levels and quality of life in ageing male subjects: A randomised, double-blind, placebo-controlled multicentre study. Food Nutr. Res. 2021, 65. [Google Scholar] [CrossRef]
- Petruţ, G.S.; Muste, S.; Mureșan, C.; Păucean, A.; Mureşan, A.E.; Nagy, M. Chemical profiles and antioxidant activity of black elder (Sambucus nigra L.)-A Review. Bull. UASVM Food Sci. Technol. 2017, 74, 9–16. [Google Scholar] [CrossRef]
- Simonyi, A.; Chen, Z.; Jiang, J.; Zong, Y.; Chuang, D.Y.; Gu, Z.; Lu, C.-H.; Fritsche, K.L.; Greenlief, C.M.; Rottinghaus, G.E. Inhibition of microglial activation by elderberry extracts and its phenolic components. Life Sci. 2015, 128, 30–38. [Google Scholar] [CrossRef] [PubMed]
- Lee, S.; Kim, J.; Kong, H.; Kim, Y.-S. Ameliorative effects of elderberry (Sambucus nigra L.) extract and extract-derived monosaccharide-amino acid on H2O2-induced decrease in testosterone-deficiency syndrome in a TM3 Leydig cell. PLoS ONE 2024, 19, e0302403. [Google Scholar] [CrossRef] [PubMed]
- Afriyie, D.K.; Asare, G.A.; Bugyei, K.; Adjei, S.; Lin, J.-M.; Peng, J.; Hong, Z.-F. Treatment of benign prostatic hyperplasia with Croton membranaceus in an experimental animal model. J. Ethnopharmacol. 2014, 157, 90–98. [Google Scholar] [CrossRef] [PubMed]
- Kim, Y.-N.; Kim, M.-S.; Chun, S.-S.; Choi, J.-H. Effect of Phellius linteus water extract on benign prostatic hyperplasia. Nutr. Res. Pract. 2013, 7, 172–177. [Google Scholar] [CrossRef] [PubMed]
- Kim, E.H.; Brockman, J.A.; Andriole, G.L. The use of 5-alpha reductase inhibitors in the treatment of benign prostatic hyperplasia. Asian J. Urol. 2018, 5, 28–32. [Google Scholar] [CrossRef]
- Bratic, I.; Trifunovic, A. Mitochondrial energy metabolism and ageing. Biochim. Biophys. Acta (BBA)-Bioenerg. 2010, 1797, 961–967. [Google Scholar] [CrossRef]
- Zirkin, B.R.; Papadopoulos, V. Leydig cells: Formation, function, and regulation. Biol. Reprod. 2018, 99, 101–111. [Google Scholar] [CrossRef]
- Papadopoulos, V.; Miller, W.L. Role of mitochondria in steroidogenesis. Best Pract. Res. Clin. Endocrinol. Metab. 2012, 26, 771–790. [Google Scholar] [CrossRef]
- Payne, A.H.; Hales, D.B. Overview of steroidogenic enzymes in the pathway from cholesterol to active steroid hormones. Endocr. Rev. 2004, 25, 947–970. [Google Scholar] [CrossRef]
- Miller, W.L.; Auchus, R.J. The molecular biology, biochemistry, and physiology of human steroidogenesis and its disorders. Endocr. Rev. 2011, 32, 81–151. [Google Scholar] [CrossRef]
- Stanelle-Bertram, S.; Beck, S.; Mounogou, N.K.; Schaumburg, B.; Stoll, F.; Al Jawazneh, A.; Schmal, Z.; Bai, T.; Zickler, M.; Beythien, G. CYP19A1 mediates severe SARS-CoV-2 disease outcome in males. Cell Rep. Med. 2023, 4, 101152. [Google Scholar] [CrossRef] [PubMed]
- Shigehara, K.; Kato, Y.; Izumi, K.; Mizokami, A. Relationship between testosterone and sarcopenia in older-adult men: A narrative review. J. Clin. Med. 2022, 11, 6202. [Google Scholar] [CrossRef] [PubMed]
- Shea, J.L.; Wong, P.-Y.; Chen, Y. Free testosterone: Clinical utility and important analytical aspects of measurement. Adv. Clin. Chem. 2014, 63, 59–84. [Google Scholar] [CrossRef]
- Tsujimura, A. The relationship between testosterone deficiency and men’s health. World J. Men’s Health 2013, 31, 126. [Google Scholar] [CrossRef]
- Martínez-Jabaloyas, J.M.; Queipo-Zaragozá, A.; Rodríguez-Navarro, R.; Queipo-Zaragozá, J.A.; Gil-Salom, M.; Chuan-Nuez, P. Relationship between the Saint Louis University ADAM questionnaire and sexual hormonal levels in a male outpatient population over 50 years of age. Eur. Urol. 2007, 52, 1760–1767. [Google Scholar] [CrossRef]
- Basar, M.M.; Aydin, G.; Mert, H.C.; Keles, I.; Caglayan, O.; Orkun, S.; Batislam, E. Relationship between serum sex steroids and Aging Male Symptoms score and International Index of Erectile Function. Urology 2005, 66, 597–601. [Google Scholar] [CrossRef]
- Morley, J.E.; Perry Iii, H.; Kevorkian, R.; Patrick, P. Comparison of screening questionnaires for the diagnosis of hypogonadism. Maturitas 2006, 53, 424–429. [Google Scholar] [CrossRef] [PubMed]
- Morley, J.E.; Patrick, P.; Perry, H.R. Evaluation of assays available to measure free testosterone. Metab.-Clin. Exp. 2002, 51, 554–559. [Google Scholar] [CrossRef]
- Rato, L.; Alves, M.G.; Duarte, A.I.; Santos, M.S.; Moreira, P.I.; Cavaco, J.E.; Oliveira, P.F. Testosterone deficiency induced by progressive stages of diabetes mellitus impairs glucose metabolism and favors glycogenesis in mature rat Sertoli cells. Int. J. Biochem. Cell Biol. 2015, 66, 1–10. [Google Scholar] [CrossRef]
- Nassar, G.N.; Leslie, S.W. Physiology, Testosterone; StatPearls Publishing: Treasure Island, FL, USA, 2023. [Google Scholar]
- O’Donnell, L.; Stanton, P.; de Kretser, D.M. Endocrinology of the Male Reproductive System and Spermatogenesis; MDText.com, Inc.: South Dartmouth, MA, USA, 2017. [Google Scholar]
- Li, L.; Lin, W.; Wang, Z.; Huang, R.; Xia, H.; Li, Z.; Deng, J.; Ye, T.; Huang, Y.; Yang, Y. Hormone Regulation in Testicular Development and Function. Int. J. Mol. Sci. 2024, 25, 5805. [Google Scholar] [CrossRef]
- Eisenberg, M.L. Testosterone replacement therapy and prostate cancer incidence. World J. Men’s Health 2015, 33, 125–129. [Google Scholar] [CrossRef]
- Lo, E.M.; Rodriguez, K.M.; Pastuszak, A.W.; Khera, M. Alternatives to testosterone therapy: A review. Sex. Med. Rev. 2018, 6, 106–113. [Google Scholar] [CrossRef]
- Sachdev, S.; Cucchiara, A.J.; Snyder, P.J. Prostate-specific antigen concentrations in response to testosterone treatment of severely hypogonadal men. J. Endocr. Soc. 2020, 4, bvaa141. [Google Scholar] [CrossRef] [PubMed]
- Bratt, O.; Lilja, H. Serum markers in prostate cancer detection. Curr. Opin. Urol. 2015, 25, 59–64. [Google Scholar] [CrossRef] [PubMed]
- Vinken, M.; Maes, M.; Vanhaecke, T.; Rogiers, V. Drug-induced liver injury: Mechanisms, types and biomarkers. Curr. Med. Chem. 2013, 20, 3011–3021. [Google Scholar] [CrossRef] [PubMed]
- Kelly, D.; Jones, T. Testosterone and obesity. Obes. Rev. 2015, 16, 581–606. [Google Scholar] [CrossRef]
- Fernández-Miró, M.; Chillarón, J.J.; Pedro-Botet, J. Testosterone deficiency, metabolic syndrome and diabetes mellitus. Med. Clínica 2016, 146, 69–73. [Google Scholar] [CrossRef]
Target Gene | Primer Sequence 5′>3′ | |
---|---|---|
Forward | Reverse | |
3β-HSD | AGAACGGCCACGAAGAAGAG | TGGGTCTTAACGCACAAGTGT |
CYP17A1 | CTCTGGGCACTGCATCAC | CAAGTAACTCTGCGTGGGT |
17β-HSD | TGGGATCATGCCTAATCCACA | CCAGTTCCCGAATCAGGATAAAA |
5α-reductase (SRD5A2) | CGGTTTAGCTTGGGTGTCTTC | CCGAGGAAATTGGCTCCAGAA |
CYP19A1 | AACCCCATGCAGTATAATGTCAC | AGGACCTGGTATTGAAGACGAG |
GAPDH | CAACTTTGGCATTGTGGAAGG | ATGGAAATTGTGAGGGAGATGC |
KSB191 | ||||
---|---|---|---|---|
G1, Old Control | G2, 130 mg/kg | G3, 195 mg/kg | G4, 260 mg/kg | |
Body weight (g) | 712.5 ± 20.0 | 713.0 ± 17.1 | 646.2 ± 41.7 | 724.7 ± 17.4 |
Prostate Weight (g) | 1.558 ± 0.066 | 1.512 ± 0.173 | 1.410 ± 0.110 | 1.513 ± 0.122 |
Prostate Index (%) | 0.22 ± 0.01 | 0.21 ± 0.02 | 0.23 ± 0.03 | 0.21 ± 0.02 |
Prostate Volume (mm3) | 10,411.03 ± 697.69 | 8725.03 ± 654.32 | 10,584.27 ± 889.43 | 9353.07 ± 422.38 |
PSA (pg/mL) | 19.802 ± 0.993 | 17.316 ± 1.173 | 15.354 ± 1.801 | 14.460 ± 0.855 ##,* |
KSB191 | ||||
---|---|---|---|---|
G1, Old Control | G2, 130 mg/kg | G3, 195 mg/kg | G4, 260 mg/kg | |
AST (U/L) | 113.3 ± 10.4 | 87.0 ± 6.9 | 100.4 ± 9.8 | 85.9 ± 6.5 |
ALT (U/L) | 47.4 ± 3.4 | 43.7 ± 2.7 | 44.6 ± 1.8 | 39.3 ± 1.6 |
CRE (mg/dL) | 0.5 ± 0.08 | 0.3 ± 0.03 | 0.4 ± 0.13 | 0.4 ± 0.08 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Kim, J.; An, J.; Song, Y.; Jang, M.; Kong, H.; Kim, S. Effect of Elderberry (Sambucus nigra L.) Extract Intake on Normalizing Testosterone Concentration in Testosterone Deficiency Syndrome Rat Model Through Regulation of 17β-HSD, 5α-Reductase, and CYP19A1 Expression. Nutrients 2024, 16, 4169. https://doi.org/10.3390/nu16234169
Kim J, An J, Song Y, Jang M, Kong H, Kim S. Effect of Elderberry (Sambucus nigra L.) Extract Intake on Normalizing Testosterone Concentration in Testosterone Deficiency Syndrome Rat Model Through Regulation of 17β-HSD, 5α-Reductase, and CYP19A1 Expression. Nutrients. 2024; 16(23):4169. https://doi.org/10.3390/nu16234169
Chicago/Turabian StyleKim, Jiyeon, Jinho An, Youngcheon Song, Mincheol Jang, Hyunseok Kong, and Sangbum Kim. 2024. "Effect of Elderberry (Sambucus nigra L.) Extract Intake on Normalizing Testosterone Concentration in Testosterone Deficiency Syndrome Rat Model Through Regulation of 17β-HSD, 5α-Reductase, and CYP19A1 Expression" Nutrients 16, no. 23: 4169. https://doi.org/10.3390/nu16234169
APA StyleKim, J., An, J., Song, Y., Jang, M., Kong, H., & Kim, S. (2024). Effect of Elderberry (Sambucus nigra L.) Extract Intake on Normalizing Testosterone Concentration in Testosterone Deficiency Syndrome Rat Model Through Regulation of 17β-HSD, 5α-Reductase, and CYP19A1 Expression. Nutrients, 16(23), 4169. https://doi.org/10.3390/nu16234169