Korean Red Ginseng Polysaccharides Enhance Intestinal IgA Production and Barrier Function via Peyer’s Patch Activation in Mice
Abstract
1. Introduction
2. Materials and Methods
2.1. Preparation of KRG-P
2.2. Reagents
2.3. Animal Experiment Design
2.4. Determination of IgA Content in Mouse Feces
2.5. Determination of IgA Content in Peyer’s Patches
2.6. Immuno-Blotting
2.7. RT-qPCR
2.8. Determination of SCFAs Content
2.9. Statistical Analysis
3. Results
3.1. Evaluation of Intestinal Immune Responses to Oral Administration of KRG-P
3.2. Analysis of Intestine mRNA Expression of α-Defensin and Lysozyme Following Oral Administration of KRG-P
3.3. Analysis of Intestinal Homeostasis and Strengthening of Intestinal Wall Proteins Following Oral Administration of KRG-P
3.4. Analysis of SCFAs in Cecum of Mice Following Oral Administration of KRG-P
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
Abbreviations
References
- Park, H.J.; Kim, D.H.; Park, S.J.; Kim, J.M.; Ryu, J.H. Ginseng in traditional herbal prescriptions. J. Ginseng Res. 2012, 36, 225–241. [Google Scholar] [CrossRef] [PubMed]
- Lee, O.-R.; Sathiyaraj, G.; Kim, Y.-J.; In, J.-G.; Kwon, W.-S.; Kim, J.-H.; Yang, D.-C. Defense Genes Induced by Pathogens and Abiotic Stresses in Panax ginseng C.A. Meyer. J. Ginseng Res. 2011, 35, 1–11. [Google Scholar] [CrossRef][Green Version]
- Saba, E.; Lee, Y.Y.; Kim, M.; Kim, S.H.; Hong, S.B.; Rhee, M.H. A comparative study on immune-stimulatory and antioxidant activities of various types of ginseng extracts in murine and rodent models. J. Ginseng Res. 2018, 42, 577–584. [Google Scholar] [CrossRef] [PubMed]
- Kang, S.; Min, H. Ginseng, the ‘Immunity Boost’: The Effects of Panax ginseng on Immune System. J. Ginseng Res. 2012, 36, 354–368. [Google Scholar] [CrossRef]
- Ahuja, A.; Kim, J.H.; Kim, J.H.; Yi, Y.S.; Cho, J.Y. Functional role of ginseng-derived compounds in cancer. J. Ginseng Res. 2018, 42, 248–254. [Google Scholar] [CrossRef] [PubMed]
- Lee, S.J.; In, G.; Han, S.T.; Lee, M.H.; Lee, J.W.; Shin, K.S. Structural characteristics of a red ginseng acidic polysaccharide rhamnogalacturonan I with immunostimulating activity from red ginseng. J. Ginseng Res. 2020, 44, 570–579. [Google Scholar] [CrossRef]
- Xu, X.F.; Gao, Y.; Xu, S.Y.; Liu, H.; Xue, X.; Zhang, Y.; Zhang, H.; Liu, M.N.; Xiong, H.; Lin, R.C.; et al. Remarkable impact of steam temperature on ginsenosides transformation from fresh ginseng to red ginseng. J. Ginseng Res. 2018, 42, 277–287. [Google Scholar] [CrossRef]
- Ratan, Z.A.; Haidere, M.F.; Hong, Y.H.; Park, S.H.; Lee, J.O.; Lee, J.; Cho, J.Y. Pharmacological potential of ginseng and its major component ginsenosides. J. Ginseng Res. 2021, 45, 199–210. [Google Scholar] [CrossRef]
- Cheon, J.M.; Kim, D.I.; Kim, K.S. Insulin sensitivity improvement of fermented Korean Red Ginseng (Panax ginseng) mediated by insulin resistance hallmarks in old-aged ob/ob mice. J. Ginseng Res. 2015, 39, 331–337. [Google Scholar] [CrossRef]
- Cho, D.E.; Choi, G.M.; Lee, Y.S.; Hong, J.P.; Yeom, M.; Lee, B.; Hahm, D.H. Long-term administration of red ginseng non-saponin fraction rescues the loss of skeletal muscle mass and strength associated with aging in mice. J. Ginseng Res. 2022, 46, 657–665. [Google Scholar] [CrossRef]
- Heo, S.B.; Lim, S.W.; Jhun, J.Y.; Cho, M.L.; Chung, B.H.; Yang, C.W. Immunological benefits by ginseng through reciprocal regulation of Th17 and Treg cells during cyclosporine-induced immunosuppression. J. Ginseng Res. 2016, 40, 18–27. [Google Scholar] [CrossRef] [PubMed]
- Kim, S.J.; Shin, M.-S.; Kim, M.; Baek, S.-H.; Kang, K.S. Characterization of an immune-enhancing polysaccharide fraction isolated from heat-processed ginseng derived from Panax ginseng CA Meyer. Appl. Sci. 2021, 11, 10835. [Google Scholar] [CrossRef]
- Kim, S.J.; Nah, S.-Y.; Park, I.-H.; Shin, M.-S.; Kang, K.S. Gintonin Isolated from Ginseng Inhibits the Epithelial—Mesenchymal Transition Induced by TGF-β in A549 Lung Cancer Cells. Plants 2023, 12, 2013. [Google Scholar] [CrossRef] [PubMed]
- Zhu, H.; Cao, J.; Liang, X.; Luo, M.; Wang, A.; Hu, L.; Li, R. Polysaccharides from Panax ginseng promote intestinal epithelial cell migration through affecting the Ca(2+) related regulators. J. Ginseng Res. 2023, 47, 89–96. [Google Scholar] [CrossRef]
- Wang, Y.; Huang, M.; Sun, R.; Pan, L. Extraction, characterization of a Ginseng fruits polysaccharide and its immune modulating activities in rats with Lewis lung carcinoma. Carbohydr. Polym. 2015, 127, 215–221. [Google Scholar] [CrossRef]
- Akhter, K.F.; Mumin, M.A.; Lui, E.M.K.; Charpentier, P.A. Immunoengineering with Ginseng Polysaccharide Nanobiomaterials through Oral Administration in Mice. ACS Biomater. Sci. Eng. 2019, 5, 2916–2925. [Google Scholar] [CrossRef]
- Tao, R.; Lu, K.; Zong, G.; Xia, Y.; Han, H.; Zhao, Y.; Wei, Z.; Lu, Y. Ginseng polysaccharides: Potential antitumor agents. J. Ginseng Res. 2023, 47, 9–22. [Google Scholar] [CrossRef]
- Jiao, L.; Li, B.; Wang, M.; Liu, Z.; Zhang, X.; Liu, S. Antioxidant activities of the oligosaccharides from the roots, flowers and leaves of Panax ginseng C.A. Meyer. Carbohydr. Polym. 2014, 106, 293–298. [Google Scholar] [CrossRef] [PubMed]
- Kim, H.-J.; Chae, I.-G.; Lee, S.-G.; Jeong, H.-J.; Lee, E.-J.; Lee, I.-S. Effects of Fermented Red Ginseng Extracts on Hyperglycemia in Streptozotocin-induced Diabetic Rats. J. Ginseng Res. 2010, 34, 104–112. [Google Scholar] [CrossRef]
- Zhang, G.; Lu, B.; Wang, E.; Wang, W.; Li, Z.; Jiao, L.; Li, H.; Wu, W. Panax ginseng improves physical recovery and energy utilization on chronic fatigue in rats through the PI3K/AKT/mTOR signalling pathway. Pharm. Biol. 2023, 61, 316–323. [Google Scholar] [CrossRef]
- Sindhu, R.K.; Goyal, A.; Das, J.; Choden, S.; Kumar, P. Immunomodulatory potential of polysaccharides derived from plants and microbes: A narrative review. Carbohydr. Polym. Technol. Appl. 2021, 2, 100044. [Google Scholar] [CrossRef]
- Li, Y.; Qin, J.; Cheng, Y.; Lv, D.; Li, M.; Qi, Y.; Lan, J.; Zhao, Q.; Li, Z. Marine sulfated polysaccharides: Preventive and therapeutic effects on metabolic syndrome: A review. Mar. Drugs 2021, 19, 608. [Google Scholar] [CrossRef] [PubMed]
- Craig, S.W.; Cebra, J.J. Peyer’s patches: An enriched source of precursors for IgA-producing immunocytes in the rabbit. J. Exp. Med. 1971, 134, 188–200. [Google Scholar] [CrossRef]
- Reboldi, A.; Arnon, T.I.; Rodda, L.B.; Atakilit, A.; Sheppard, D.; Cyster, J.G. IgA production requires B cell interaction with subepithelial dendritic cells in Peyer’s patches. Science 2016, 352, aaf4822. [Google Scholar] [CrossRef]
- Fagarasan, S.; Kawamoto, S.; Kanagawa, O.; Suzuki, K. Adaptive immune regulation in the gut: T cell–dependent and T cell–independent IgA synthesis. Annu. Rev. Immunol. 2010, 28, 243–273. [Google Scholar] [CrossRef] [PubMed]
- Min, S.J.; Kim, H.; Yambe, N.; Shin, M.-S. Ameliorative effects of Korean-red-ginseng-derived polysaccharide on antibiotic-associated diarrhea. Polymers 2024, 16, 231. [Google Scholar] [CrossRef]
- Park, D.H.; Han, B.; Shin, M.-S.; Hwang, G.S. Enhanced intestinal immune response in mice after oral administration of Korea red ginseng-derived polysaccharide. Polymers 2020, 12, 2186. [Google Scholar] [CrossRef]
- Di Sotto, A.; Vitalone, A.; Di Giacomo, S. Plant-derived nutraceuticals and immune system modulation: An evidence-based overview. Vaccines 2020, 8, 468. [Google Scholar] [CrossRef]
- Zhao, G.; Nyman, M.; Åke Jönsson, J. Rapid determination of short-chain fatty acids in colonic contents and faeces of humans and rats by acidified water-extraction and direct-injection gas chromatography. Biomed. Chromatogr. 2006, 20, 674–682. [Google Scholar] [CrossRef]
- Woof, J.M.; Kerr, M.A. The function of immunoglobulin A in immunity. J. Pathol. 2006, 208, 270–282. [Google Scholar] [CrossRef]
- Brandtzaeg, P. Secretory IgA: Designed for anti-microbial defense. Front. Immunol. 2013, 4, 222. [Google Scholar] [CrossRef] [PubMed]
- Venegas, D.P.; Marjorie, K.; Landskron, G.; González, M.J.; Quera, R.; Dijkstra, G.; Harmsen, H.J.M.; Faber, K.N.; Hermoso, M.A. Corrigendum: Short chain fatty acids (SCFAs)-mediated gut epithelial and immune regulation and its relevance for inflammatory bowel diseases. Front. Immunol. 2019, 10, 1486. [Google Scholar]
- Nogal, A.; Valdes, A.M.; Menni, C. The role of short-chain fatty acids in the interplay between gut microbiota and diet in cardio-metabolic health. Gut Microbes 2021, 13, 1897212. [Google Scholar] [CrossRef] [PubMed]
- Meijer, K.; de Vos, P.; Priebe, M.G. Butyrate and other short-chain fatty acids as modulators of immunity: What relevance for health? Curr. Opin. Clin. Nutr. Metab. Care 2021, 13, 715–721. [Google Scholar] [CrossRef]
- Blaak, E.E.; Canfora, E.E.; Theis, S.; Frost, G.; Groen, A.K.; Mithieux, G.; Nauta, A.; Scott, K.; Stahl, B.; Van Harsselaar, J.; et al. Short chain fatty acids in human gut and metabolic health. Benef. Microbes 2020, 11, 411–455. [Google Scholar] [CrossRef] [PubMed]
- Bhaskaran, N.; Quigley, C.; Paw, C.; Butala, S.; Schneider, E.; Pandiyan, P. Role of short chain fatty acids in controlling Tregs and immunopathology during mucosal infection. Front. Microbial. 2018, 9, 1995. [Google Scholar] [CrossRef]
- Jiang, Y.; Li, X.; Wu, Y.; Zhou, L.; Wang, Z.; Xiao, W. Effect of Lentinan on Peyer’s patch structure and function in an immunosuppressed mouse model. Int. J. Biol. Macromol. 2019, 137, 169–176. [Google Scholar] [CrossRef] [PubMed]
- Chidley, C.; Davison, G. The effect of Chlorella pyrenoidosa supplementation on immune responses to 2 days of intensified training. Eur. J. Nutr. 2018, 57, 2529–2536. [Google Scholar] [CrossRef]
- Trachsel, J.; Briggs, C.; Gabler, N.K.; Allen, H.K.; Loving, C.L. Dietary resistant potato starch alters intestinal microbial communities and their metabolites, and markers of immune regulation and barrier function in swine. Front. Immunol. 2019, 10, 1381. [Google Scholar] [CrossRef]
- Wang, L.Y.; He, L.H.; Xu, L.J.; Li, S.B. Short-chain fatty acids: Bridges between diet, gut microbiota, and health. J. Gastroenterol. Hepatol. 2024, 39, 1728–1736. [Google Scholar] [CrossRef]
- Cummings, J.H.; Pomare, E.W.; Branch, W.J.; Naylor, C.P.; Macfarlane, G.T. Short chain fatty acids in human large intestine, portal, hepatic and venous blood. Gut 1987, 28, 1221–1227. [Google Scholar] [CrossRef] [PubMed]
- Singh, N.; Gurav, A.; Sivaprakasam, S.; Brady, E.; Padia, R.; Shi, H.; Thangaraju, M.; Prasad, P.D.; Manicassamy, S.; Munn, D.H.; et al. Activation of Gpr109a, receptor for niacin and the commensal metabolite butyrate suppresses colonic inflammation and carcinogenesis. Immunity 2014, 40, 128–139. [Google Scholar] [CrossRef] [PubMed]
- Donohoe, D.R.; Holley, D.; Collins, L.B.; Montgomery, S.A.; Whitmore, A.C.; Hillhouse, A.; Curry, K.P.; Renner, S.W.; Greenwalt, A.; Ryan, E.P.; et al. A gnotobiotic mouse model demonstrates that dietary fiber protects against colorectal tumorigenesis in a microbiota- and butyrate-dependent manner. Cancer Discov. 2014, 4, 1387–1397. [Google Scholar] [CrossRef] [PubMed]
- Takahashi, K.; Nishida, A.; Fujimoto, T.; Fujii, M.; Shioya, M.; Imaeda, H.; Inatomi, O.; Bamba, S.; Andoh, A.; Sugimoto, M. Reduced abundance of butyrate-producing bacteria species in the fecal microbial community in Crohn’s disease. Digestion 2016, 93, 59–65. [Google Scholar] [CrossRef]
Forward (5′ -> 3′) | Reverse (5′ -> 3′) | |
---|---|---|
α-defensin | TaqMan Mm02524428 | |
Lysozyme-1 | CCAGGCCAAGGTCTACAATC | TGAGCTAAACACACCCAGTC |
GAPDH | CTCATGACCACAGTCCATGC | CACATTGGGGGTAGGAACAC |
SCFAs | Normal | KRG-P 50 mg/kg | KRG-P 200 mg/kg |
---|---|---|---|
Acetic acid | 14.0 ± 2.4 | 17.9 ± 2.1 ** | 15.2 ± 0.8 |
Propionic acid | 1.7 ± 0.3 | 1.5 ± 0.1 | 1.8 ± 0.2 |
Butyric acid | 4.1 ± 0.9 | 6.3 ± 1.2 ** | 6.5 ± 1.0 ** |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Kim, S.J.; Lee, H.-K.; Kang, K.S.; Lee, M.-G.; Shin, M.-S. Korean Red Ginseng Polysaccharides Enhance Intestinal IgA Production and Barrier Function via Peyer’s Patch Activation in Mice. Nutrients 2024, 16, 3816. https://doi.org/10.3390/nu16223816
Kim SJ, Lee H-K, Kang KS, Lee M-G, Shin M-S. Korean Red Ginseng Polysaccharides Enhance Intestinal IgA Production and Barrier Function via Peyer’s Patch Activation in Mice. Nutrients. 2024; 16(22):3816. https://doi.org/10.3390/nu16223816
Chicago/Turabian StyleKim, Sung Jin, Hae-Kyung Lee, Ki Sung Kang, Mi-Gi Lee, and Myoung-Sook Shin. 2024. "Korean Red Ginseng Polysaccharides Enhance Intestinal IgA Production and Barrier Function via Peyer’s Patch Activation in Mice" Nutrients 16, no. 22: 3816. https://doi.org/10.3390/nu16223816
APA StyleKim, S. J., Lee, H.-K., Kang, K. S., Lee, M.-G., & Shin, M.-S. (2024). Korean Red Ginseng Polysaccharides Enhance Intestinal IgA Production and Barrier Function via Peyer’s Patch Activation in Mice. Nutrients, 16(22), 3816. https://doi.org/10.3390/nu16223816