Ashwagandha Ethanol Extract Attenuates Sarcopenia-Related Muscle Atrophy in Aged Mice
Abstract
1. Introduction
2. Materials and Methods
2.1. Preparation of WSE
2.2. The Analysis of Withanolide A Using HPLC
2.3. Mice and Design of the Animal Experiment
2.4. Assessment of Serum ALT and AST
2.5. Measurement of Grip Strength
2.6. Measurement of Exhaustion on the Treadmill
2.7. Assessment of Serum Cytokine Levels
2.8. Histological Analysis
2.9. Cell Culture and Differentiation
2.10. Measurement of Myotube Diameter
2.11. Protein Expression Analysis
2.12. Gene Expression Analysis
2.13. Statistical Analysis
3. Results
3.1. Standardization of WSE
3.2. Effect of WSE on Muscle Performance in Aged Mice
3.3. Effect of WSE on Chronic Low-Grade Inflammation in Aged Mice
3.4. Effect of WSE on Muscle Mass and Myofiber Cross-Sectional Area (CSA) in Aged Mice
3.5. Effect of WSE on Muscle Protein Synthesis and Proteolysis through the AKT/mTOR Pathway in Aged Mice
3.6. Effect of WSE on Mitochondrial Biogenesis through the SIRT1/PGC-1α Pathway in Aged Mice
3.7. Effect of WSE on the Formation of Myotubes in C2C12
3.8. Effect of WSE on Muscle Protein Synthesis and Protein Degradation through the PI3K/Akt Pathway in Dexamethasone-Induced C2C12 Muscle Atrophy
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Cruz-Jentoft, A.J.; Sayer, A.A. Sarcopenia. Lancet 2019, 393, 2636–2646. [Google Scholar] [CrossRef] [PubMed]
- Cho, M.R.; Lee, S. A Review of Sarcopenia Pathophysiology, Diagnosis, Treatment and Future Direction. J. Korean Med. Sci. 2022, 37, e146. [Google Scholar] [CrossRef] [PubMed]
- Nascimento, C.M.; Ingles, M.; Salvador-Pascual, A.; Cominetti, M.R.; Gomez-Cabrera, M.C.; Viña, J. Sarcopenia, frailty and their prevention by exercise. Free. Radic. Biol. Med. 2019, 132, 42–49. [Google Scholar] [CrossRef] [PubMed]
- Yuan, S.; Larsson, S.C. Epidemiology of sarcopenia: Prevalence, risk factors, and consequences. Metabolism 2023, 144, 155533. [Google Scholar] [CrossRef] [PubMed]
- Pan, L.; Xie, W.; Fu, X.; Lu, W.; Jin, H.; Lai, J.; Zhang, A.; Yu, Y.; Li, Y.; Xiao, W. Inflammation and sarcopenia: A focus on circulating inflammatory cytokines. Exp. Gerontol. 2021, 154, 111544. [Google Scholar] [CrossRef] [PubMed]
- Can, B.; Kara, O.; Kizilarslanoglu, M.C.; Arik, G.; Aycicek, G.S.; Sumer, F.; Civelek, R.; Demirtas, C.; Ulger, Z. Serum markers of inflammation and oxidative stress in sarcopenia. Aging Clin. Exp. Res. 2017, 29, 745–752. [Google Scholar] [CrossRef] [PubMed]
- da Costa Teixeira, L.A.; Avelar, N.C.P.; Peixoto, M.F.D.; Parentoni, A.N.; Santos, J.M.D.; Pereira, F.S.M.; Danielewicz, A.L.; Leopoldino, A.A.O.; Costa, S.P.; Arrieiro, A.N.; et al. Inflammatory biomarkers at different stages of Sarcopenia in older women. Sci. Rep. 2023, 13, 10367. [Google Scholar] [CrossRef]
- Rogeri, P.S.; Zanella, R., Jr.; Martins, G.L.; Garcia, M.D.A.; Leite, G.; Lugaresi, R.; Gasparini, S.O.; Sperandio, G.A.; Ferreira, L.H.B.; Souza-Junior, T.P.; et al. Strategies to Prevent Sarcopenia in the Aging Process: Role of Protein Intake and Exercise. Nutrients 2021, 14, 52. [Google Scholar] [CrossRef]
- Petersen, A.M.; Pedersen, B.K. The role of IL-6 in mediating the anti-inflammatory effects of exercise. J. Physiol. Pharmacol. Off. J. Pol. Physiol. Soc. 2006, 57 (Suppl. S10), 43–51. [Google Scholar]
- Suzuki, K. Chronic Inflammation as an Immunological Abnormality and Effectiveness of Exercise. Biomolecules 2019, 9, 223. [Google Scholar] [CrossRef]
- Wang, L.; Jiao, X.-F.; Wu, C.; Li, X.-Q.; Sun, H.-X.; Shen, X.-Y.; Zhang, K.-Z.; Zhao, C.; Liu, L.; Wang, M.; et al. Trimetazidine attenuates dexamethasone-induced muscle atrophy via inhibiting NLRP3/GSDMD pathway-mediated pyroptosis. Cell Death Discov. 2021, 7, 251. [Google Scholar] [CrossRef] [PubMed]
- Otrocka-Domagała, I.; Paździor-Czapula, K.; Gesek, M. Dexamethasone-induced impairment of post-injury skeletal muscle regeneration. BMC Vet. Res. 2019, 15, 56. [Google Scholar] [CrossRef] [PubMed]
- Beyer, I.; Mets, T.; Bautmans, I. Chronic low-grade inflammation and age-related sarcopenia. Curr. Opin. Clin. Nutr. Metab. Care 2012, 15, 12–22. [Google Scholar] [CrossRef] [PubMed]
- Antuña, E.; Cachán-Vega, C. Inflammaging: Implications in Sarcopenia. Int. J. Mol. Sci. 2022, 23. [Google Scholar] [CrossRef] [PubMed]
- Paul, S.; Chakraborty, S.; Anand, U.; Dey, S.; Nandy, S.; Ghorai, M.; Saha, S.C.; Patil, M.T.; Kandimalla, R.; Proćków, J.; et al. Withania somnifera (L.) Dunal (Ashwagandha): A comprehensive review on ethnopharmacology, pharmacotherapeutics, biomedicinal and toxicological aspects. Biomed. Pharmacother. 2021, 143, 112175. [Google Scholar] [CrossRef] [PubMed]
- Kaur, G.; Singh, N.; Samuel, S.S.; Bora, H.K.; Sharma, S.; Pachauri, S.D.; Dwivedi, A.K.; Siddiqui, H.H.; Hanif, K. Withania somnifera shows a protective effect in monocrotaline-induced pulmonary hypertension. Pharm. Biol. 2015, 53, 147–157. [Google Scholar] [CrossRef] [PubMed]
- Zaka, M.; Sehgal, S.A.; Shafique, S.; Abbasi, B.H. Comparative in silico analyses of Cannabis sativa, Prunella vulgaris and Withania somnifera compounds elucidating the medicinal properties against rheumatoid arthritis. J. Mol. Graph. Model. 2017, 74, 296–304. [Google Scholar] [CrossRef] [PubMed]
- Anwer, T.; Sharma, M.; Pillai, K.K.; Iqbal, M. Effect of Withania somnifera on insulin sensitivity in non-insulin-dependent diabetes mellitus rats. Basic Clin. Pharmacol. Toxicol. 2008, 102, 498–503. [Google Scholar] [CrossRef]
- Dar, N.J.; MuzamilAhmad. Neurodegenerative diseases and Withania somnifera (L.): An update. J. Ethnopharmacol. 2020, 256, 112769. [Google Scholar] [CrossRef]
- Gannon, J.M.; Brar, J.; Rai, A.; Chengappa, K.N.R. Effects of a standardized extract of Withania somnifera (Ashwagandha) on depression and anxiety symptoms in persons with schizophrenia participating in a randomized, placebo-controlled clinical trial. Ann. Clin. Psychiatry Off. J. Am. Acad. Clin. Psychiatr. 2019, 31, 123–129. [Google Scholar]
- Kushwaha, S.; Roy, S.; Maity, R.; Mallick, A.; Soni, V.K.; Singh, P.K.; Chaurasiya, N.D.; Sangwan, R.S.; Misra-Bhattacharya, S.; Mandal, C. Chemotypical variations in Withania somnifera lead to differentially modulated immune response in BALB/c mice. Vaccine 2012, 30, 1083–1093. [Google Scholar] [CrossRef] [PubMed]
- Dubey, S.; Singh, M.; Nelson, A.; Karan, D. A Perspective on Withania somnifera Modulating Antitumor Immunity in Targeting Prostate Cancer. J. Immunol. Res. 2021, 2021, 9483433. [Google Scholar] [CrossRef] [PubMed]
- Mukherjee, P.K.; Banerjee, S.; Biswas, S.; Das, B.; Kar, A.; Katiyar, C.K. Withania somnifera (L.) Dunal-Modern perspectives of an ancient Rasayana from Ayurveda. J. Ethnopharmacol. 2021, 264, 113157. [Google Scholar] [CrossRef] [PubMed]
- Dutta, R.; Khalil, R.; Green, R.; Mohapatra, S.S.; Mohapatra, S. Withania somnifera (Ashwagandha) and Withaferin A: Potential in Integrative Oncology. Int. J. Mol. Sci. 2019, 20, 5310. [Google Scholar] [CrossRef] [PubMed]
- Xie, W.Q.; He, M.; Yu, D.J.; Wu, Y.X.; Wang, X.H.; Lv, S.; Xiao, W.F.; Li, Y.S. Mouse models of sarcopenia: Classification and evaluation. J. Cachexia Sarcopenia Muscle 2021, 12, 538–554. [Google Scholar] [CrossRef] [PubMed]
- Cho, Y.H.; Lee, S.Y. Effect of Schisandra chinensis Baillon extracts and regular low-intensity exercise on muscle strength and mass in older adults: A randomized, double-blind, placebo-controlled trial. Am. J. Clin. Nutr. 2021, 113, 1440–1446. [Google Scholar] [CrossRef]
- Kim, J.S.; Takanche, J.S.; Kim, J.E.; Jeong, S.H.; Han, S.H.; Yi, H.K. Schisandra chinensis extract ameliorates age-related muscle wasting and bone loss in ovariectomized rats. Phytother. Res. 2019, 33, 1865–1877. [Google Scholar] [CrossRef]
- Shi, P.; Geng, Q.; Chen, L.; Du, T.; Lin, Y.; Lai, R.; Meng, F.; Wu, Z.; Miao, X.; Yao, H. Schisandra chinensis bee pollen’s chemical profiles and protective effect against H2O2-induced apoptosis in H9c2 cardiomyocytes. BMC Complement. Med. Ther. 2020, 20, 274. [Google Scholar] [CrossRef]
- Hu, L.; Mauro, T.M.; Dang, E.; Man, G.; Zhang, J.; Lee, D.; Wang, G.; Feingold, K.R.; Elias, P.M.; Man, M.Q. Epidermal Dysfunction Leads to an Age-Associated Increase in Levels of Serum Inflammatory Cytokines. J. Investig. Dermatol. 2017, 137, 1277–1285. [Google Scholar] [CrossRef]
- Erekat, N.; Al-Jarrah, M.D. Interleukin-1 Beta and Tumor Necrosis Factor Alpha Upregulation and Nuclear Factor Kappa B Activation in Skeletal Muscle from a Mouse Model of Chronic/Progressive Parkinson Disease. Med. Sci. Monit. Int. Med. J. Exp. Clin. Res. 2018, 24, 7524–7531. [Google Scholar] [CrossRef]
- Ji, Y.; Li, M.; Chang, M.; Liu, R.; Qiu, J.; Wang, K.; Deng, C.; Shen, Y. Inflammation: Roles in Skeletal Muscle Atrophy. Antioxidants 2022, 11, 1686. [Google Scholar] [CrossRef] [PubMed]
- Muñoz-Cánoves, P.; Scheele, C.; Pedersen, B.K.; Serrano, A.L. Interleukin-6 myokine signaling in skeletal muscle: A double-edged sword? FEBS J. 2013, 280, 4131–4148. [Google Scholar] [CrossRef] [PubMed]
- Derave, W.; Eijnde, B.O.; Ramaekers, M.; Hespel, P. Soleus muscles of SAMP8 mice provide an accelerated model of skeletal muscle senescence. Exp. Gerontol. 2005, 40, 562–572. [Google Scholar] [CrossRef] [PubMed]
- Takeda, T.; Hosokawa, M.; Higuchi, K. Senescence-accelerated mouse (SAM): A novel murine model of senescence. Exp. Gerontol. 1997, 32, 105–109. [Google Scholar] [CrossRef] [PubMed]
- Hambright, W.S.; Niedernhofer, L.J.; Huard, J.; Robbins, P.D. Murine models of accelerated aging and musculoskeletal disease. Bone 2019, 125, 122–127. [Google Scholar] [CrossRef] [PubMed]
- Sayed, R.K.; de Leonardis, E.C.; Guerrero-Martínez, J.A.; Rahim, I.; Mokhtar, D.M.; Saleh, A.M.; Abdalla, K.E.; Pozo, M.J.; Escames, G.; López, L.C.; et al. Identification of morphological markers of sarcopenia at early stage of aging in skeletal muscle of mice. Exp. Gerontol. 2016, 83, 22–30. [Google Scholar] [CrossRef] [PubMed]
- Toniolo, L.; Fusco, P.; Formoso, L.; Mazzi, A.; Canato, M.; Reggiani, C.; Giacomello, E. Resveratrol treatment reduces the appearance of tubular aggregates and improves the resistance to fatigue in aging mice skeletal muscles. Exp. Gerontol. 2018, 111, 170–179. [Google Scholar] [CrossRef]
- Shoji, H.; Takao, K.; Hattori, S.; Miyakawa, T. Age-related changes in behavior in C57BL/6J mice from young adulthood to middle age. Mol. Brain 2016, 9, 11. [Google Scholar] [CrossRef]
- Hamrick, M.W.; Ding, K.H.; Pennington, C.; Chao, Y.J.; Wu, Y.D.; Howard, B.; Immel, D.; Borlongan, C.; McNeil, P.L.; Bollag, W.B.; et al. Age-related loss of muscle mass and bone strength in mice is associated with a decline in physical activity and serum leptin. Bone 2006, 39, 845–853. [Google Scholar] [CrossRef]
- Boondam, Y.; Songvut, P.; Tantisira, M.H.; Tapechum, S.; Tilokskulchai, K.; Pakaprot, N. Inverted U-shaped response of a standardized extract of Centella asiatica (ECa 233) on memory enhancement. Sci. Rep. 2019, 9, 8404. [Google Scholar] [CrossRef]
- Yoshida, T.; Delafontaine, P. Mechanisms of IGF-1-Mediated Regulation of Skeletal Muscle Hypertrophy and Atrophy. Cells 2020, 9, 1970. [Google Scholar] [CrossRef] [PubMed]
- Schiaffino, S.; Mammucari, C. Regulation of skeletal muscle growth by the IGF1-Akt/PKB pathway: Insights from genetic models. Skelet. Muscle 2011, 1, 4. [Google Scholar] [CrossRef] [PubMed]
- Wang, P.; Kang, S.Y.; Kim, S.J.; Park, Y.K.; Jung, H.W. Monotropein Improves Dexamethasone-Induced Muscle Atrophy via the AKT/mTOR/FOXO3a Signaling Pathways. Nutrients 2022, 14, 1859. [Google Scholar] [CrossRef] [PubMed]
- Mammucari, C.; Milan, G.; Romanello, V.; Masiero, E.; Rudolf, R.; Del Piccolo, P.; Burden, S.J.; Di Lisi, R.; Sandri, C.; Zhao, J.; et al. FoxO3 controls autophagy in skeletal muscle in vivo. Cell Metab. 2007, 6, 458–471. [Google Scholar] [CrossRef] [PubMed]
- Milan, G.; Romanello, V.; Pescatore, F.; Armani, A.; Paik, J.-H.; Frasson, L.; Seydel, A.; Zhao, J.; Abraham, R.; Goldberg, A.L.; et al. Regulation of autophagy and the ubiquitin–proteasome system by the FoxO transcriptional network during muscle atrophy. Nat. Commun. 2015, 6, 6670. [Google Scholar] [CrossRef] [PubMed]
- Foletta, V.C.; White, L.J.; Larsen, A.E.; Léger, B.; Russell, A.P. The role and regulation of MAFbx/atrogin-1 and MuRF1 in skeletal muscle atrophy. Pflug. Arch. Eur. J. Physiol. 2011, 461, 325–335. [Google Scholar] [CrossRef] [PubMed]
- Shi, Y.; Zhang, Z.W.; Du, M.M.; Wu, J.; Li, J.X. Saponin extract from Achyranthes bidentata Blume alleviates disuse-induced muscle atrophy through PI3K/Akt signaling pathway. J. Ethnopharmacol. 2023, 312, 116458. [Google Scholar] [CrossRef]
- Chang, J.S.; Kong, I.D. Irisin prevents dexamethasone-induced atrophy in C2C12 myotubes. Pflügers Arch.-Eur. J. Physiol. 2020, 472, 495–502. [Google Scholar] [CrossRef]
- Bodine, S.C.; Baehr, L.M. Skeletal muscle atrophy and the E3 ubiquitin ligases MuRF1 and MAFbx/atrogin-1. Am. J. Physiol. Endocrinol. Metab. 2014, 307, E469–E484. [Google Scholar] [CrossRef]
- Nguyen, M.T.; Dash, R. Role of Actin-Binding Proteins in Skeletal Myogenesis. Cells 2023, 12, 2523. [Google Scholar] [CrossRef]
- Zammit, P.S. Function of the myogenic regulatory factors Myf5, MyoD, Myogenin and MRF4 in skeletal muscle, satellite cells and regenerative myogenesis. Semin. Cell Dev. Biol. 2017, 72, 19–32. [Google Scholar] [CrossRef] [PubMed]
- Gurd, B.J. Deacetylation of PGC-1α by SIRT1: Importance for skeletal muscle function and exercise-induced mitochondrial biogenesis. Appl. Physiol. Nutr. Metab. Physiol. Appl. Nutr. Metab. 2011, 36, 589–597. [Google Scholar] [CrossRef] [PubMed]
- Cantó, C.; Auwerx, J. PGC-1alpha, SIRT1 and AMPK, an energy sensing network that controls energy expenditure. Curr. Opin. Lipidol. 2009, 20, 98–105. [Google Scholar] [CrossRef] [PubMed]
- Kim, Y.; Park, Y. Conjugated linoleic acid (CLA) stimulates mitochondrial biogenesis signaling by the upregulation of PPARγ coactivator 1α (PGC-1α) in C2C12 cells. Lipids 2015, 50, 329–338. [Google Scholar] [CrossRef] [PubMed]
- Kim, R.; Kim, J.W.; Lee, S.J.; Bae, G.U. Ginsenoside Rg3 protects glucocorticoid-induced muscle atrophy in vitro through improving mitochondrial biogenesis and myotube growth. Mol. Med. Rep. 2022, 25, 94. [Google Scholar] [CrossRef]
- Yang, L.; Chen, X.; Chen, D.; Yu, B.; He, J.; Luo, Y.; Zheng, P.; Chen, H.; Yan, H.; Huang, Z. Effects of protocatechuic acid on antioxidant capacity, mitochondrial biogenesis and skeletal muscle fiber transformation. J. Nutr. Biochem. 2023, 116, 109327. [Google Scholar] [CrossRef]
- Wang, J.; Zhang, H.; Kaul, A.; Li, K.; Priyandoko, D.; Kaul, S.C.; Wadhwa, R. Effect of Ashwagandha Withanolides on Muscle Cell Differentiation. Biomolecules 2021, 11, 1454. [Google Scholar] [CrossRef]
- Marzetti, E.; Calvani, R.; Cesari, M.; Buford, T.W.; Lorenzi, M.; Behnke, B.J.; Leeuwenburgh, C. Mitochondrial dysfunction and sarcopenia of aging: From signaling pathways to clinical trials. Int. J. Biochem. Cell Biol. 2013, 45, 2288–2301. [Google Scholar] [CrossRef]
Gene Name | Forward | Reverse |
---|---|---|
Myogenin | CAACTGCTCTGATGGCATGATGG | TGTTCTGCATCGCTTGAGGATGTC |
MyoD | CAACTGCTCTGATGGCATGATGG | TGTTCTGCATCGCTTGAGGATGTC |
MuRF1 | AAGACTGAGCTGAGTAACTG | TAGAGGGTGTCAAACTTCTG |
Atrogin-1 | AGAAAGAAAGACATTCAGAACA | GCTCCTTCGTACTTCCTT |
Myostatin | ACTGGACCTCTCGATAGAACACT | ACTTAGTGCTGTGTGTGTGGAGAT |
Sirt1 | CAAGATGCTGTTGCAAAGGAACC | CAAGATGCTGTTGCAAAGGAACC |
PGC1α | AAGTGTGGAACTCTCTGGAACTG | GGGTTATCTTGGTTGGCTTTATG |
TNF-α | CCCGAGTGACAAGCCTGTAG | GATGGCAGAGAGGAGGTTGAC |
IL-1β | AGATGATAAGCCCACTCTACAG | ACATTCAGCACAGGACTCTC |
IL-6 | ACAGCCACTCACCTCTTCAG | CCATCTTTTTCAGCCATCTTT |
β-actin | ATATCGCTGCGCTGGTCGTC | AGGATGGCGTGAGGGAGAGC |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Ko, J.-S.; Chang, B.-Y.; Choi, Y.-J.; Choi, J.-S.; Kwon, H.-Y.; Lee, J.-Y.; Kim, S.-Y.; Choung, S.-Y. Ashwagandha Ethanol Extract Attenuates Sarcopenia-Related Muscle Atrophy in Aged Mice. Nutrients 2024, 16, 157. https://doi.org/10.3390/nu16010157
Ko J-S, Chang B-Y, Choi Y-J, Choi J-S, Kwon H-Y, Lee J-Y, Kim S-Y, Choung S-Y. Ashwagandha Ethanol Extract Attenuates Sarcopenia-Related Muscle Atrophy in Aged Mice. Nutrients. 2024; 16(1):157. https://doi.org/10.3390/nu16010157
Chicago/Turabian StyleKo, Jin-Sung, Bo-Yoon Chang, Young-Ju Choi, Ji-Soo Choi, Hee-Yeon Kwon, Jae-Yeon Lee, Sung-Yeon Kim, and Se-Young Choung. 2024. "Ashwagandha Ethanol Extract Attenuates Sarcopenia-Related Muscle Atrophy in Aged Mice" Nutrients 16, no. 1: 157. https://doi.org/10.3390/nu16010157
APA StyleKo, J.-S., Chang, B.-Y., Choi, Y.-J., Choi, J.-S., Kwon, H.-Y., Lee, J.-Y., Kim, S.-Y., & Choung, S.-Y. (2024). Ashwagandha Ethanol Extract Attenuates Sarcopenia-Related Muscle Atrophy in Aged Mice. Nutrients, 16(1), 157. https://doi.org/10.3390/nu16010157