Next Article in Journal
Membrane Lipids in Ultra-High-Risk Patients: Potential Predictive Biomarkers of Conversion to Psychosis
Next Article in Special Issue
Sleep Patterns, Eating Behavior and the Risk of Noncommunicable Diseases
Previous Article in Journal
An Evolving Definition of a “Healthy Diet”
Previous Article in Special Issue
Systematic Breakfast Consumption of Medium-Quantity and High-Quality Food Choices Is Associated with Better Vascular Health in Individuals with Cardiovascular Disease Risk Factors
 
 
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Influence of the TAS2R38 Gene Single Nucleotide Polymorphisms in Metabolism and Anthropometry in Thyroid Dysfunction

by
Marta Mendes Costa
1,†,
Alda Pereira Da Silva
1,2,†,
Carolina Santos
1,
Joana Ferreira
1,3,
Mário Rui Mascarenhas
1,4,
Manuel Bicho
1,3,* and
Ana Paula Barbosa
1,4,5
1
Ecogenetics and Human Health Unity, Institute for Environmental Health (ISAMB), Genetics Laboratory, Associate Laboratory TERRA, Faculty of Medicine, Lisbon University, 1649-028 Lisbon, Portugal
2
Faculty of Medicine, University Clinic for General and Family Medicine, Lisbon University,1649-028 Lisbon, Portugal
3
Institute for Scientific Research Bento Rocha Cabral, Calçada Bento da Rocha Cabral 14, 1250-012 Lisbon, Portugal
4
Clinic of Endocrinology (CEDML), Diabetes and Metabolism of Lisbon Lda, 1050-017 Lisbon, Portugal
5
Faculty of Medicine, University Clinic of Endocrinology, Lisbon University, 1649-028 Lisbon, Portugal
*
Author to whom correspondence should be addressed.
These authors contributed equally to this work.
Nutrients 2023, 15(9), 2214; https://doi.org/10.3390/nu15092214
Submission received: 21 February 2023 / Revised: 27 April 2023 / Accepted: 2 May 2023 / Published: 6 May 2023
(This article belongs to the Special Issue The Effect of Nutritional Aspect on Obesity and Hypertension)

Abstract

The gene TAS2R38 single nucleotide polymorphisms (SNPs-P49A, A262V and V296I) can condition bitter tasting by PAV (proline–alanine–valine) and non-bitter-tasting by AVI (alanine–valine–isoleucine) homozygosity. We evaluated this polymorphisms association with thyroid function, metabolism and anthropometry parameters determined by: Endpoint analysis (SNPs); DXA (fat mass-%, total fat mass—kg, lean mass—kg); Standard methods (lipid metabolism parameters, HbA1c-%, glycemia—mg/dL, insulinemia—µIU/mL, HOMA-IR, uricemia—mg/dL, calcemia—mg/dL and BMI—kg/m2); ELISA (leptinemia—ng/mL); Spectrophotometry (Angiotensin Converting Enzyme activity—UI/L). Statistics: SPSS program; OR [IC95%]; p < 0.05. Sample: 114 hypothyroid, 49 hyperthyroid, and 179 controls. An association between A262V-valine–valine and hypothyroidism/hyperthyroidism was verified (OR = 2.841; IC95% [1.726–4.676]), p < 0.001/OR = 8.915; IC95% [4.286–18.543]), p < 0.001). Protector effect from thyroid dysfunction: A262V-alanine–valine (OR = 0.467; IC95% [0.289–0.757], p = 0.002/OR = 0.132; IC95% [0.056–0.309], p < 0.001) and PAV (OR = 0.456; IC95% [0.282–0.737], p = 0.001/OR = 0.101; IC95% [0.041–0.250], p < 0.001). Higher parameter values associated with genotypes were: fat-mass-% (V296I-valine–isoleucine), lean-mass (P49A-proline–proline; PVI), leptin (AVI), HbA1c (A262V-alanine–valine) and lower values in lean-Mass (AVI; PVV), leptin (A262V-alanine–alanine), HbA1c (PVV), uricemia (V296I-valine–isoleucine), glycemia (A262V-alanine–alanine; AAV) and plasma triglycerides (PVV). In conclusion, TAS2R38 influences thyroid function, body composition and metabolism. Bitter taste perception (PAV) and the genotype A262V-alanine–valine can protect from thyroid dysfunction. AVV, PVV and genotype A262V-valine–valine may confer higher predisposition for thyroid dysfunction, particularly PVV for hyperthyroidism.

1. Introduction

Taste has been listed as one of the five main factors involved in food choice, along with health, cost, time, and social interactions [1]. Five different tastes have been described: sweet, bitter, umami, salted, and sour. Recently, the existence of the taste of fat has been proposed [2,3]. The chemical compounds in food activate the receptors of taste. The genotypes of these receptors, particularly their genetic single nucleotide polymorphisms (SNPs), contribute to interindividual variability in taste perception [4]. The stimuli that lead to perception of the bitter taste bind to members of the receptor protein family TAS2R, coded in the 5p, 7q, and 12p chromosomes [5].
The bitter taste receptor, type 2 member 38 (TAS2R38) is one of the members of the TAS2R family and is responsible for the perception of the bitter taste of compounds that contain the thiocyanate chemical group, such as Phenylthiocarbamide (PTC) and Propylthiouracil (PROP), which are absent in nature, but also glucosinolates present in the vegetables of the Brassica family [6,7]. The TAS2R38 receptor is coded by the gene TAS2R38, which is composed of 1002 nucleotides in chromosome 7 with only one exon and three single nucleotide polymorphisms: P49A, A262V and V296I [6]. These SNPs are responsible for the presence of different amino acids in the receptor protein. In this regard, P49A can lead to the presence of proline or alanine, A262V to alanine or valine, and V296I to valine or isoleucine [6]. A haplotype consists of the sequence of the three amino acids in the taste receptor protein coded by the three SNPs present in one chromosome (maternal or paternal). The association of the two haplotypes present in each chromosome comprises the TAS2R38 diplotype, which determines the expression of the receptor protein for bitter tasting (Figure 1) [8,9]. The PAV haplotype (proline–alanine–valine) is the dominant TAS2R38 variant and is associated with the bitter tasting phenotype. The recessive haplotype is the AVI variant, which is associated with the non-bitter tasting phenotype in the form of homozygosity (AVI/AVI) [6]. An individual with both PAV variants (PAV/PAV diplotype) is classified as a supertaster of the bitter taste [6]. There are also individuals with intermediate bitter tasting, which is associated with the existence of one of the haplotypes AAI, AAV or PAI with another haplotype (other than PAV), or AVI in heterozygosity with another haplotype (other than PAV) [9]. Individuals with PVV, AVV or PVI haplotypes have had no bitter tasting phenotypes described to date (Figure 1) [9].
The PAV and AVI genetic variants are described as being the most prevalent worldwide (PAV = 50.76%; AVI = 42.70%), while AAV and AAI are considered as being rare (<5% prevalence) and PAI and PVI as very rare (<1% prevalence) [10]. The PVV and AVV haplotypes only appear in a few studies in diseased samples [7,11,12,13,14].
The TAS2R38 gene is not only expressed in the gustative papillae, but is also expressed in different body locations such as the respiratory tract, genitourinary, immune and gastrointestinal systems, heart, brain, thyroid, skin, pancreas, bladder, testis and the placenta [15,16,17,18,19,20,21].
Thyroid dysfunction in general was found to be more prevalent in non-bitter tasters (68%) than in bitter tasters (32%) [22,23]. Specifically, in a sample of people with thyroid dysfunction, bitter tasting was more prevalent in those with hypothyroidism (60% of bitter tasters) than with hyperthyroidism (40% of bitter tasters) [23]. The TAS2R38 receptor is thought to influence thyroid function for the following reasons: (1) PROP is an agonist of TAS2R38 which has been indicated in the treatment of hyperthyroidism by thyroid peroxidase inhibition [24]; (2) It was found that some members of the TAS2R family (TAS2R4, TAS2R10 and TAS2R40) inhibit the TSH-dependent increase in Ca2+ and iodine efflux in thyrocytes [21]; (3) Non-bitter tasters demonstrated higher ingestion of bitter tasting compounds such as vegetables of the Brassica family, which can inhibit thyroid hormonal synthesis [7,25,26].

2. Materials and Methods

The study sample was randomly selected from a database of the Endocrinology, Diabetes and Metabolism Clinic of Lisbon.
Thyroid function was classified as either hypothyroidism, euthyroidism, or hyperthyroidism. The following parameters were determined and evaluated: clinical history, physical examination, serum values of fT4 (free thyroxine), fT3 (free tri-iodothyronine), TSH (thyroid-stimulating hormone), Tg Abs (thyroglobulin antibodies), TPOAbs (thyroid peroxidase antibodies) and TRAbs (TSH receptor antibodies). Individuals with hyperthyroidism consisted of 14.3% of the total sample (49 individuals), with 19 diagnosed with Graves’ disease and 30 with toxic goiter. The group with hypothyroidism comprised 33.3% of the total sample (114 individuals). All cases in the hypothyroidism sample had primary hypothyroidism, with 15 cases originated by surgical causes (8 by total thyroidectomy, 4 by subtotal thyroidectomy, and 3 by lobectomy), 21 by chronic lymphocytic thyroiditis, and 78 by non-immune causes. The control group represented 52.35% of the total sample (179 individuals) and was diagnosed with euthyroidism, having no previous clinical history of thyroid dysfunction. Diagnosis of thyroid function for all individuals in this study was made before the intake of any medication that could alter this function.
The sample of this study consisted of adult individuals with the following criteria: thyroid function classification available, oral and reading understanding of the Portuguese language, available data about the parameters in evaluation, and voluntary informed consent for study participation including DNA collection and analysis. Individuals outside of these criteria were excluded from this study.
Anthropometric parameters were determined by DXA: fat mass (%), total fat mass (kg), and lean mass (kg). The BMI (kg/m2) was calculated and classified according to WHO (World Health Organization) classification: underweight (<18.5 kg/m2); eutrophic (18.5–24.9 kg/m2); overweight (25–29.9 kg/m2); obese (≥30 kg/m2). Sociodemographic parameters were age and sex. Metabolic parameters were determined by standard methods of serum analysis: HbA1c (%), glycemia (mg/dL), insulinemia (µIU/mL), HOMA-IR, uricemia (mg/dL), calcemia (mg/dL) and lipid metabolism parameters (total cholesterol—mg/dl, plasma triglycerides—mg/dL, high-density lipoprotein—mg/dL and low-density lipoprotein—mg/dL). Leptinemia (ng/mL) was determined using ELISA, and Angiotensin Converting Enzyme (ACE) activity (UI/L) by using spectrophotometry.
For the genetic study, genomic DNA was first extracted in EDTA via the salting-out method, followed by the evaluation of DNA concentration and purity via spectrophotometry, and finally, the three TAS2R38 SNPs were genotyped by Endpoint genotyping. TaqMan Probes were used for each SNP. The following primers were used:
Forward Primer: CTTGGAGCAGTAAAGCAGGCTGAG
Reverse Primer: GATCTAGGCAAAGAGCTGGATGCT
The genotyping process included an initial pre-heating (95 °C, 10 min) followed by amplification of the DNA (95 °C, 5s, and then 60 °C for 1 min, 40 cycles). The SNPs were detected with a hydrolysis probe with fluorescence emission in a thermocycler.
The genetic parameters studied were the TAS2R38 haplotypes (e.g., PAV), diplotypes (e.g., PAV/PVI), and the genotype of each TAS2R38 SNPs, according to their homozygosity or heterozygosity considering both maternal and paternal chromosomes:
P49A-CG (proline–alanine) or CC (proline–proline) or GG (alanine–alanine).
A262V-CT (alanine–valine) or TT (valine–valine) or CC (alanine–alanine).
V296I-GA (valine–isoleucine) or GG (valine–valine) or AA (isoleucine–isoleucine).
The genetic additive model was used once all possible genotypes were considered, with no known dominant or recessive alleles.
Statistical analysis was performed using SPSS 25.0 for Windows (IBM, New York, NY, USA). Significance was assumed for p-values < 0.05. Analysis of the qualitative parameters was conducted on absolute and relative (%) frequencies with χ2 Pearson test. For the quantitative parameters, the Kolmogorov–Smirnov normality test was performed. Parameters with normal distributions were described as mean values ± S.D. (standard deviation) and associations were analyzed using ANOVA/Student’s t-test. Parameters with a non-normal distribution were described using median values (25th–75th percentiles) and their associations were analyzed with the non-parametric test of Mann–Whitney/Kruskal–Wallis. Genotypes associated with thyroid function present in the control group were evaluated by logistic multinomial regression (OR—Odds Ratio; IC 95%—confidence interval; χ2 Pearson test). Multiple comparison (Dunnett’s Test) was performed between thyroid function groups and between the different genotypes for each TAS2R38 SNP.

3. Results

The total sample comprised 342 individuals (83% women) with a mean age of 56.42 ± 13.83 years old.

3.1. Parameters According to Thyroid Function

3.1.1. Distribution of BMI (WHO Group Classification) According to Thyroid Function

We performed a χ2 Pearson Test to evaluate whether there is a statistically significant difference in the categorical BMI between the groups with hypothyroidism and/or hyperthyroidism and/or the control (Table 1). A significant difference was found with a p-value of 0.004. Differences between each thyroid function group were studied for the BMI as a continuous variable (Table 2).
The BMI was classified according to the WHO (World Health Organization) with 1.75% of the sample being classified as underweight, 20.76% as eutrophic, 42.11% as overweight, and 3.51% as obese.

3.1.2. Metabolic, Anthropometric and Sociodemographic Variables According to Thyroid Function

To understand if there was any statistically significant difference in the studied parameters between the three sample groups (hypothyroidism, hyperthyroidism, and control), we first performed an ANOVA test for age (normal distribution) and a Mann–Whitney test for the other parameters (non-normal distribution).
Thyroid function was also significantly associated with other parameters besides BMI. These associations were found for fat mass (%), total fat mass (kg), lean mass (kg), and glycemia (mg/dL) (Table 2). Significant p-values derived from this first analysis mean that at least one of the groups of the sample had a significantly different mean/median parameter value when comparing to the other groups of the sample.
We then proceeded to perform multiple comparison tests to determine exactly which groups (hypothyroidism, hyperthyroidism, and control) differed from each other in terms of the significant anthropometric parameters from in Table 2 (i.e., total fat mass (kg), fat mass (%) and BMI (kg/m2)).
Significant statistical differences were found between thyroid function groups (hypothyroidism, hyperthyroidism, and euthyroidism) for the median values of total fat mass (kg), fat mass (%), and BMI (kg/m2), as shown in Table 3.

3.2. TA2R38 Genotypes According to Thyroid Function

3.2.1. TAS2R38 SNPs Genotypes According to Thyroid Function

Results obtained from the analysis of the TAS2R38 SNPs showed significant associations between thyroid function and the genotypes A626V-valine–valine (Table 4) and A626V-alanine–valine (Table 5).

3.2.2. TAS2R38 Haplotypes According to Thyroid Function

The prevalence of the TAS2R38 haplotypes in the total sample was as follows: PAV (46.3%); AVI (48.1%); PVI (33%); AAV (15.3%); PVV (12.4%); AVV (3.2%); PAI (0.3%) and AAI (0.3%). The haplotype PAV was significantly associated with the absence of thyroid dysfunction (Table 6), while the presence of either PVV (Table 7) or AVV (Table 8) was associated with thyroid dysfunction.
We observed 39.82% of PAV in the group with hypothyroidism and 12.77% of PAV in the group with hyperthyroidism.

3.2.3. TAS2R38 Diplotypes According to Thyroid Function

The frequency of TAS2R38 diplotypes in the total sample varied significantly with thyroid function (p < 0.001) by χ2 Pearson Test (Table 9).

3.3. TAS2R38 Genotypes According to Metabolic, Anthropometric and Sociodemographic (Age) Parameters

3.3.1. TAS2R38 SNPs Genotypes According to Metabolic, Anthropometric and Sociodemographic (Age) Parameters

TAS2R38 SNP genotypes were significantly associated with anthropometric, metabolic and sociodemographic parameters (Table 10).

3.3.2. TAS2R38 Haplotypes According to Metabolic, Anthropometric and Sociodemographic (Age) Parameters

TAS2R38 haplotypes were significantly associated with anthropometric, metabolic and sociodemographic parameters (Table 11): PAV with HbA1c; AAV with age and with glycemia; PAI with age; PVV with lean mass, plasma triglycerides, and HbA1c; AVI with lean mass and with leptin and PVI haplotype with lean mass. The only haplotype in the sample with no significant association with any of the studied parameters was the AAI haplotype.

3.3.3. TAS2R38 Diplotypes According to Anthropometric and Metabolic Parameters

The only anthropometric parameters significantly associated with the TAS2R38 diplotype distribution in the total sample were BMI (p = 0.004) and total fat mass (p = 0.038). Median (25th–75th percentile) values for these parameters in the most prevalent diplotypes (Table 9) were:
PAV/AVI: total fat mass (kg) = 25.39 [20.54–30.47]; BMI (kg/m2) = 27.87 [25.36–31.87];
PVI/PVI: total fat mass (kg) = 25.40 [20.15–3.52]; BMI (kg/m2) = 28.03 [25.09–31.58];
AAV/AAV: total fat mass (kg) = 23.31 [19.53–30.10]; BMI (kg/m2) = 26.60 [24.03–31.94];
PVV/AVI: total fat mass (kg) = 24.54 [21.28–28.39]; BMI (kg/m2) =27.10 [25.30–30.90].
Higher values for both total fat mass and BMI were obtained for the PAV/PVI diplotype when compared with the other diplotypes in total sample (PAV/PVI: total fat mass (kg) = 30.05 [26.60–35.71]; BMI (kg/m2) = 31.62 [29.15–34.99]).

4. Discussion

The anthropometric and body composition parameters (Table 2) obtained reflected the decreased basal energetic expenditure described for hypothyroidism, and the opposite phenomenon for hyperthyroidism.
Regarding the analysis of the TAS2R38 SNPs in thyroid function, the SNP A262V was the only SNP with significant influence, with the genotype A262V-valine–valine associated with the presence of thyroid dysfunction (hypo- or hyperthyroidism) and in opposition, the genotype A262V-alanine–valine associated with the absence of thyroid dysfunction (Table 4 and Table 5).
It is important to mention that, as the controls were recruited in a metabolic clinic, it raises the suspicion that they were not entirely free of disease. Despite this, we are certain that these controls did not suffer from thyroid dysfunction, which was the object of this study. In fact, the controls may suffer from other diseases that may or not be correlated with the prevalence of PAV in this sample, which could be addressed in future studies.
The fact that the frequency of some usually rare haplotypes was non-negligible in the samples with thyroid dysfunction is in line with previously published studies in diseased samples [7,11,12,13,14], and not in the global population.
Additionally, the PVV and AVV haplotypes (both with unknown bitter tasting phenotypes) [9] showed a statistically significant difference between the sample groups (hypothyroidism and/or hyperthyroidism and/or control), both with higher prevalence in hyperthyroidism and absence in the control group (Table 7 and Table 8).
On the other hand, PAV (bitter tasting haplotype) [6] showed a significantly lower risk of thyroid dysfunction according to the multiple regression (Table 6).
We suggest that the statistically significant prevalence of this haplotype could derive from the contribution of bitter food ingestion (such as vegetables of the Brassica family) [17,25,26] and/or cellular expression of TAS2R38 in thyrocytes [21] to thyroid function. This suggestion warrants further study.
Considering the possible contribution of both food ingestion and TAS2R38 cellular expression (in thyrocytes) to thyroid function, the higher tendency of PVV and AVV for either hypo- or hyperthyroidism could vary according to the degree of influence of each one of these two factors in thyroid function. In this way, a higher tendency to develop hypothyroidism could be due to increased ingestion of bitter goitrogenic compounds with an ability to inhibit thyroid function [25,26,27,28]. In this way, the ingestion of these bitter compounds in individuals with the PVV and/or AVV haplotypes could indicate a lower perception of bitter taste in these haplotypes. However, this hypothesis needs to be investigated in further studies, as there is not yet a description of the bitter tasting phenotypes associated with these haplotypes [9].
In relation to hyperthyroidism, its predominance associated with PVV and/or AVV (Table 7 and Table 8) could be mainly due to the possibility of TAS2R38 expression in thyrocytes with lower sensitivity to antithyroid effects exerted by the exposition of individuals with these haplotypes to TAS2R38 agonists [21]. This high thyroid hormonal production could be explained by three possible mechanisms: less thyroid peroxidase (TPO) inhibition; higher deiodinases activity and decreased inhibition of the TSH-dependent Ca2+ signaling and/or iodine efflux in the thyrocytes [21]. The first two mechanisms mentioned could be related to hyperthyroidism propension because TAS2R agonists such as propylthiouracil, approved for hyperthyroidism treatment [24,29], can inhibit TPO [21] and type 1 deiodinase activity [30,31,32]. As for the increased TSH-dependent Ca2+ and iodine efflux in thyrocytes, it has been shown that some members of the TAS2R family (TAS2R4, TAS2R10 and TAS2R40) inhibit both of these mechanisms [21].
The different TAS2R38 SNPs and haplotypes influenced anthropometry and metabolism (Table 10 and Table 11). An increase in lean mass median value was verified for both PVI haplotype and P49A-proline–proline genotype. In contrast, the AVI haplotype showed a lower lean mass median value but also a higher median value for leptin, which could be related to behaviors of higher food disinhibition [33] and higher fat-rich food consumption [34,35,36,37,38], both described for this haplotype.
On the other hand, leptin showed a significantly lower median value for the A262V-alanine–alanine genotype; this is possibly associated with higher levels of satiety in individuals with this genotype in line with the lower values of leptin associated with the “T” allele (valine) of the SNP A26V in a previous study [33]. When compared to other haplotypes in the total sample, the AAV haplotype (intermediate bitter taster) showed a significantly lower glycemic median value. Individuals with this haplotype also had a lower mean age value compared to other TAS2R38 haplotypes. Lower glycemic values can lead to a lower risk of diabetes, which has been previously associated with the bitter tasting phenotype [39,40]. On the contrary, the prevalence of younger individuals with this haplotype can indicate a propensity towards less longevity, which has been previously associated with the non-bitter tasting phenotype [19]. In this way, considering that the AAV haplotype corresponds to an intermediate bitter tasting phenotype, it could present results associated with both bitter and non-bitter tasting phenotypes.
Fat mass (%) and uricemia were associated with only one SNP genotype, namely the V296I-valine–isoleucine. This genotype, despite showing higher median value for fat mass (%), also showed an inferior median value for uricemia when compared to other SNP V26I genotypes. This result for uricemia is thought to be not correlated directly with fat body mass but to other risk factors for hyperuricemia that can possibly be diminished for this genotype, such as ingestion of red meat, sweet beverages, seafood, and fructose, among other factors [41,42,43,44].
The PVV haplotype showed significant associations with parameters that can be related to its higher prevalence in the group diagnosed with hyperthyroidism. Such results were lower median values for lean mass, Hb1Ac, and plasma triglycerides. In hyperthyroidism, there is a known increase in basal energetic expenditure, which could be related to a reduction in lean mass [45,46,47,48]. The lower Hb1Ac (without significant difference in glycemic values) and plasma triglyceride median values observed in the PVV haplotype could be caused by an increase in erythropoiesis [49,50] and higher lipoprotein lipase activity with higher removal rate of triglycerides from blood circulation [51,52,53], respectively, which could result from the prevalence of PVV in hyperthyroidism.
Of the eleven TAS2R38 diplotypes observed in the total sample, four corresponded to bitter tasting phenotypes (PAV/PVI; PAV/AVI; PAV/AAV; PAV/AAI) and one corresponded to an intermediate bitter tasting phenotype (AAV/AAV). The remaining TAS2R38 diplotypes were composed of PVI and/or PVV and/or AVV and a haplotype other than PAV, resulting in unknown bitter tasting phenotypes. There were no non-bitter taster phenotypes in the sample, as no AVI/AVI homozygous genotypes were detected. Regarding the prevalence of bitter tasting (PAV) in the thyroid dysfunction sample, the results from this study were in line with the ones described in a previous study [23], since most bitter tasters in the thyroid dysfunction sample were observed in hypothyroidism when compared to hyperthyroidism.
TAS2R38 diplotypes were associated with thyroid function (Table 9). The PVV/AVI and AVV/AVV diplotypes were absent from the control group, with the PVV/AVI showing a higher prevalence in thyroid dysfunction, mainly in hyperthyroidism. The most prevalent TAS2R38 diplotype in the control group was PAV/AVI, which was associated with euthyroidism. The influence of these diplotypes on thyroid function can be related to the changes in the anthropometric parameters [54,55,56,57,58], with PVV/AVI having lower BMI, total fat mass, and lean mass median values when compared to the PAV/AVI diplotype. These results can be related to the higher metabolic rate that occurs in hyperthyroidism [59,60,61], since the PVV/AVI diplotype was most prevalent in the sample with hyperthyroidism than in the sample with hypothyroidism. Additionally, the PAV/PVI diplotype showed higher total fat mass, and BMI median values comparing to the other TAS2R38 diplotypes in the sample, which could be related to its absence from the hyperthyroidism sample (Table 9).
A limitation of this study is that we only analyzed the association between the studied parameters and thyroid function. In future studies, it would be interesting to discriminate these associations according to the underlying pathology that leads to thyroid dysfunction (these data were not provided for this study).
In future studies, it would be of value to analyze the food consumption patterns associated with different TAS2R38 genotypes and corresponding bitter tasting phenotypes. It would also be of interest to study the contribution of hormonal thyroid synthesis to the origin and progression of thyroid dysfunction in the TAS2R38 genotypes. Finally, aligned with this purpose, it would be useful to obtain more knowledge about the variety of compounds with agonist action in the TAS2R38 receptors expressed in the thyroid.

5. Conclusions

The TAS2R38 genotype showed an association with thyroid function, body composition and metabolism. The only TAS2R38 SNP with significant association with thyroid function was the A262V.
The results from this study indicate that bitter taste perception (PAV) and the genotype (A262V-alanine–valine) present a lower risk of thyroid dysfunction. Instead, the TAS2R38 haplotypes AVV and PVV had statistically significant different distribution in the samples studied, showing absence from the controls.
The SNP A262V-valine–valine genotype presented a higher risk for thyroid dysfunction according to the multiple regression analysis performed.
However, the absence of homozygous non-bitter tasters (AVI/AVI) and the presence of unknown bitter perception for PVV and AVV haplotypes limits the comprehension of this genotype’s influence on the studied parameters. In conclusion, genetic variation of TAS2R38 showed a significant association with thyroid function with modulation of satiety and metabolism associated with body composition and anthropometry.

Author Contributions

Conceptualization, M.B.; methodology, C.S., J.F. and A.P.D.S.; software A.P.D.S. and M.M.C.; validation, M.B. and A.P.B.; formal analysis, M.M.C. and A.P.D.S.; investigation, M.M.C.; resources, A.P.B., M.R.M. and M.B.; data curation M.C and A.P.D.S.; writing—original draft preparation, M.M.C.; writing—review and editing, A.P.B. and A.P.D.S.; visualization, M.M.C.; supervision, M.B. and A.P.B.; project administration M.B.; funding acquisition, M.B. The authors M.M.C. and A.P.D.S. contributed equally to this work. All authors have read and agreed to the published version of the manuscript.

Funding

The writing of the manuscript was also supported by funds from the Foundation for Science and Technology to ISAMB (ref. UIDB/04295/2020 and UIDP/04295/2020).

Institutional Review Board Statement

The study was conducted according to the guidelines of the Declaration of Helsinki and approved by the Institutional Review Board (or Ethics Committee) of Lisbon Academic Centre of Medicine (protocol code Nº 105/16 approval on 30 September 2016). All consultations and exams were carried out in the context of usual care. Participation in the study was considered only after agreement and signature of the informed consent document (emphasizing the voluntary nature and the possibility of abandoning the study if desired without compromising clinical assistance and administration of appropriate treatment). Results will be published, assuring participants’ anonymity. Data were stored securely for exclusive use by the research team.

Informed Consent Statement

Informed consent was obtained from all subjects involved in the study.

Data Availability Statement

The datasets used and or analyzed during the current study are available from the corresponding author upon reasonable request.

Conflicts of Interest

The authors declare no conflict of interest.

References

  1. Diószegi, J.; Llanaj, E.; Ádány, R. Genetic background of taste perception, taste preferences, and its nutritional implications: A systematic review. Front. Genet. 2019, 10, 1272. [Google Scholar] [CrossRef] [PubMed][Green Version]
  2. Running, C.A.; Craig, B.A.; Mattes, R.D. Oleogustus: The unique taste of fat. Chem. Senses 2015, 40, 507–516. [Google Scholar] [CrossRef] [PubMed][Green Version]
  3. Malles, R.D. Fat Taste in Humans: Is It a Primary? In Fat Detection: Taste, Texture, and Post Ingestive Effects; Montmayeur, J.P., Coutre, J.L., Eds.; CRC Press/Taylor & Francis: Boca Raton, FL, USA, 2010; pp. 167–193. [Google Scholar]
  4. Loper, H.B.; La Sala, M.; Dotson, C.; Steinle, N. Taste perception, associated hormonal modulation, and nutrient intake. Nutr. Rev. 2015, 73, 83–91. [Google Scholar] [CrossRef] [PubMed][Green Version]
  5. Roudnitzky, N.; Behrens, M.; Engel, A.; Kohl, S.; Thalmann, S.; Hübner, S.; Lossow, K.; Wooding, S.P.; Meyerhof, W. Receptor polymorphism and genomic structure interact to shape bitter taste perception. PLoS Genet. 2015, 11, e1005530. [Google Scholar] [CrossRef][Green Version]
  6. Orrù, R.; Atzori, E.; Padiglia, A. Development of a molecular method for the rapid screening and identification of the three functionally relevant polymorphisms in the human TAS2R38 receptor gene in studies of sensitivity to the bitter taste of PROP. SpringerPlus 2015, 4, 246. [Google Scholar] [CrossRef][Green Version]
  7. Bufe, B.; Breslin, P.A.S.; Kuhn, C.; Reed, D.R.; Tharp, C.D.; Slack, J.P.; Kim, U.-K.; Drayna, D.; Meyerhof, W. The molecular basis of individual differences in phenylthiocarbamide and propylthiouracil bitterness perception. Curr. Biol. CB 2005, 15, 322–327. [Google Scholar] [CrossRef][Green Version]
  8. Choi, J.-H. Variation in the TAS2R38 bitterness receptor gene was associated with food consumption and obesity risk in Koreans. Nutrients 2019, 11, 1973. [Google Scholar] [CrossRef][Green Version]
  9. Boxer, E.E.; Garneau, N.L. Rare haplotypes of the gene TAS2R38 confer bitter taste sensitivity in humans. SpringerPlus 2015, 4, 505. [Google Scholar] [CrossRef][Green Version]
  10. Risso, D.S.; Mezzavilla, M.; Pagani, L.; Robino, A.; Morini, G.; Tofanelli, S.; Carrai, M.; Campa, D.; Barale, R.; Caradonna, F.; et al. Global diversity in the TAS2R38 bitter taste receptor: Revisiting a classic evolutionary PROPosal. Sci. Rep. 2016, 6, 25506. [Google Scholar] [CrossRef][Green Version]
  11. Mennella, J.A.; Pepino, M.Y.; Reed, D.R. Genetic and environmental determinants of bitter perception and sweet preferences. Pediatrics 2005, 115, e216. [Google Scholar] [CrossRef][Green Version]
  12. Pemberton, T.J.; Mehta, N.U.; Witonsky, D.; Di Rienzo, A.; Allayee, H.; Conti, D.V.; Patel, P.I. Prevalence of common disease-associated variants in Asian Indians. BMC Genet. 2008, 9, 13. [Google Scholar] [CrossRef] [PubMed][Green Version]
  13. Carrai, M.; Steinke, V.; Vodicka, P.; Pardini, B.; Rahner, N.; Holinski-Feder, E.; Morak, M.; Schackert, H.K.; Görgens, H.; Stemmler, S.; et al. Association between TAS2R38 gene polymorphisms and colorectal cancer risk: A case-control study in two independent populations of caucasian origin. PLoS ONE 2011, 6, e20464. [Google Scholar] [CrossRef] [PubMed]
  14. Kim, U.K.; Jorgenson, E.; Coon, H.; Leppert, M.; Risch, N.; Drayna, D. Positional cloning of the human quantitative trait locus underlying taste sensitivity to phenylthiocarbamide. Science 2003, 299, 1221–1225. [Google Scholar] [CrossRef] [PubMed]
  15. Wölfle, U.; Elsholz, F.A.; Kersten, A.; Haarhaus, B.; Schumacher, U.; Schempp, C.M. Expression and functional activity of the human bitter taste receptor TAS2R38 in human placental tissues and JEG-3 cells. Molecules 2016, 21, 306. [Google Scholar] [CrossRef] [PubMed][Green Version]
  16. Yamamoto, K.; Ishimaru, Y. Oral and extra-oral taste perception. Semin. Cell Dev. Biol. 2013, 24, 240–246. [Google Scholar] [CrossRef]
  17. Lipchock, S.V.; Mennella, J.A.; Spielman, A.I.; Reed, D.R. Human bitter perception correlates with bitter receptor messenger RNA expression in taste cells. Am. J. Clin. Nutr. 2013, 98, 1136–1143. [Google Scholar] [CrossRef][Green Version]
  18. Cancello, R.; Micheletto, G.; Meta, D.; Lavagno, R.; Bevilacqua, E.; Panizzo, V.; Invitti, C. Expanding the role of bitter taste receptor in extra oral tissues: TAS2R38 is expressed in human adipocytes. Adipocyte 2020, 9, 7–15. [Google Scholar] [CrossRef][Green Version]
  19. Melis, M.; Errigo, A.; Crnjar, R.; Pes, G.M.; Tomassini Barbarossa, I. TAS2R38 bitter taste receptor and attainment of exceptional longevity. Sci. Rep. 2019, 9, 18047. [Google Scholar] [CrossRef][Green Version]
  20. Rozengurt, E. Taste receptors in the gastrointestinal tract. I. Bitter taste receptors and alpha-gustducin in the mammalian gut. Am. J. Physiol. Gastrointest. Liver Physiol. 2006, 291, G171–G177. [Google Scholar] [CrossRef][Green Version]
  21. Clark, A.A.; Dotson, C.D.; Elson, A.E.T.; Voigt, A.; Boehm, U.; Meyerhof, W.; Steinle, N.I.; Munger, S.D. TAS2R bitter taste receptors regulate thyroid function. FASEB J. 2015, 29, 164–172. [Google Scholar] [CrossRef][Green Version]
  22. Shivaprasad, H.S.; Chaithra, P.T.; Kavitha, P.; Malini, S.S. Role of phenylthiocarbamide as a genetic marker in predicting the predisposition of disease traits in humans. J. Nat. Sci. Biol. Med. 2012, 3, 43–47. [Google Scholar] [CrossRef][Green Version]
  23. Bhatia, S.; Sircar, S.S.; Ghorai, B. Gustatory differences in hypothyroid and hyperthyroid tasters and nontasters. Indian J. Physiol. Pharmacol. 1990, 34, 201–205. [Google Scholar] [PubMed]
  24. Admeda Arzneimittel GmbH. INFARMED Approved. Summary of Product Characteristics (SPC) Propycil 50 mg Pills. 2020. Available online: https://extranet.infarmed.pt/INFOMED-fo/detalhes-medicamento.xhtml (accessed on 21 February 2023).
  25. Kitchin, F.D.; Howel-Evans, W.; Clarke, C.A.; McConnell, R.B.; Sheppard, P. PTC taste response and thyroid disease. Br. Med. J. 1959, 1, 1069. [Google Scholar] [CrossRef] [PubMed][Green Version]
  26. Felker, P.; Bunch, R.; Leung, A.M. Concentrations of thiocyanate and goitrin in human plasma, their precursor concentrations in brassica vegetables, and associated potential risk for hypothyroidism. Nutr. Rev. 2016, 74, 248–258. [Google Scholar] [CrossRef] [PubMed][Green Version]
  27. Di Bernardo, J.; Iosco, C.; Rhoden, K.J. Intracellular anion fluorescence assay for sodium/iodide symporter substrates. Anal. Biochem. 2011, 415, 32–38. [Google Scholar] [CrossRef] [PubMed]
  28. Dai, G.; Levy, O.; Carrasco, N. Cloning and characterization of the thyroid iodide transporter. Nature 1996, 379, 458–460. [Google Scholar] [CrossRef] [PubMed]
  29. Luongo, C.; Trivisano, L.; Alfano, F.; Salvatore, D. Type 3 deiodinase and consumptive hypothyroidism: A common mechanism for a rare disease. Front. Endocrinol. 2013, 4, 115. [Google Scholar] [CrossRef] [PubMed][Green Version]
  30. Leonard, J.; Koèhrle, J. Intracellular pathways of iodothyronine metabolism. In The Thyroid; Braverman, L.E., Utiger, R., Eds.; Lippincott-Raven: Philadelphia, PA, USA, 1996; pp. 125–161. [Google Scholar]
  31. Larsen, P.R.; Berry, M.J. Nutritional and hormonal regulation of thyroid hormone deiodinases. Annu. Rev. Nutr. 1995, 15, 323–352. [Google Scholar] [CrossRef]
  32. Yoshihara, A.; Luo, Y.; Ishido, Y.; Usukura, K.; Oda, K.; Sue, M.; Kawashima, A.; Hiroi, N.; Suzuki, K. Inhibitory effects of methimazole and propylthiouracil on iodotyrosine deiodinase 1 in thyrocytes. Endocr. J. 2019, 66, 349–357. [Google Scholar] [CrossRef][Green Version]
  33. Dotson, C.D.; Shaw, H.L.; Mitchell, B.D.; Munger, S.D.; Steinle, N.I. Variation in the gene TAS2R38 is associated with the eating behavior disinhibition in Old Order Amish women. Appetite 2010, 54, 93–99. [Google Scholar] [CrossRef][Green Version]
  34. Shizukuda, S.; Marchini, J.S.; Adell, A.; Santos, M.A.; Brandao, C.F.C.; Lima, C.M.M.; Cunha, S.F.C.; Itikawa, E.N.; Silvah, J.H. Influences of weight, age, gender, genetics, diseases, and ethnicity on bitterness perception: A narrative review of current methodological aspects. Nutrire 2018, 43, 4. [Google Scholar] [CrossRef]
  35. Tepper, B.J.; Koelliker, Y.; Zhao, L.; Ullrich, N.V.; Lanzara, C.; d’Adamo, P.; Ferrara, A.; Ulivi, S.; Esposito, L.; Gasparini, P. Variation in the bitter-taste receptor gene TAS2R38, and adiposity in a genetically isolated population in Southern Italy. Obesity 2008, 16, 2289–2295. [Google Scholar] [CrossRef] [PubMed]
  36. Tepper, B.J. 6-n-Propylthiouracil: A genetic marker for taste, with implications for food preference and dietary habits. Am. J. Hum. Genet. 1998, 63, 1271–1276. [Google Scholar] [CrossRef] [PubMed][Green Version]
  37. Duffy, V.B.; Davidson, A.C.; Kidd, J.R.; Kidd, K.K.; Speed, W.C.; Pakstis, A.J.; Reed, D.R.; Snyder, D.J.; Bartoshuk, L.M. Bitter receptor gene (TAS2R38), 6-n-propylthiouracil (PROP) bitterness and alcohol intake. Alcohol. Clin. Exp. Res. 2004, 28, 1629–1637. [Google Scholar] [CrossRef][Green Version]
  38. Keller, K.L.; Adise, S. Variation in the Ability to Taste Bitter Thiourea Compounds: Implications for Food Acceptance, Dietary Intake, and Obesity Risk in Children. Annu. Rev. Nutr. 2016, 36, 157–182. [Google Scholar] [CrossRef]
  39. Ali, S.G.; Azad Khan, A.K.; Mahtab, H.; Khan, A.R.; Muhibullah, M. Association of phenylthiocarbamide taste sensitivity with diabetes mellitus in Bangladesh. Hum. Hered. 1994, 44, 14–17. [Google Scholar] [CrossRef]
  40. Igbeneghu, C.; Olisekodiaka, J.; Onuegbu, J.; Oyeyode, O.H. Phenylthiocarbamide taste perception among patients with type 2 Diabetes mellitus. Asian J. Health Sci. 2019, 14, 1–5. [Google Scholar] [CrossRef]
  41. Li, R.; Yu, K.; Li, C. Dietary factors and risk of gout and hyperuricemia: A meta-analysis and systematic review. Asia Pac. J. Clin. Nutr. 2018, 27, 1344–1356. [Google Scholar]
  42. Clebak, K.T.; Morrison, A.; Croad, J.R. Gout: Rapid evidence review. Am. Fam. Physician 2020, 102, 533–538. [Google Scholar]
  43. Choi, H.K.; Atkinson, K.; Karlson, E.W.; Curhan, G. Obesity, weight change, hypertension, diuretic use, and risk of gout in men: The health professionals follow-up study. Arch. Intern. Med. 2005, 165, 742–748. [Google Scholar] [CrossRef][Green Version]
  44. Rospleszcz, S.; Dermyshi, D.; Müller-Peltzer, K.; Strauch, K.; Bamberg, F.; Peters, A. Association of serum uric acid with visceral, subcutaneous and hepatic fat quantified by magnetic resonance imaging. Sci. Rep. 2020, 10, 442. [Google Scholar] [CrossRef] [PubMed][Green Version]
  45. Sánchez, A.; Carretto, H.; Ulla, M.R.; Capozza, R. Body composition of patients with primary hypothyroidism evaluated by dual-energy X-ray absorptiometry and its changes after treatment with levo-thyroxine. Endocrinologist 2004, 14, 321–327. [Google Scholar] [CrossRef]
  46. Karmisholt, J.; Andersen, S.; Laurberg, P. Weight loss after therapy of hypothyroidism is mainly caused by excretion of excess body water associated with myxoedema. J. Clin. Endocrinol. Metab. 2011, 96, E99–E103. [Google Scholar] [CrossRef] [PubMed][Green Version]
  47. Timpson, N.J.; Christensen, M.; Lawlor, D.A.; Gaunt, T.R.; Day, I.N.; Ebrahim, S.; Smith, G.D. TAS2R38 (phenylthiocarbamide) haplotypes, coronary heart disease traits, and eating behavior in the british women’s heart and health study. Am. J. Clin. Nutr. 2005, 81, 1005–1011. [Google Scholar] [CrossRef][Green Version]
  48. Santini, F.; Pinchera, A.; Marsili, A.; Ceccarini, G.; Castagna, M.G.; Valeriano, R.; Giannetti, M.; Taddei, D.; Centoni, R.; Scartabelli, G.; et al. Lean body mass is a major determinant of levothyroxine dosage in the treatment of thyroid diseases. J. Clin. Endocrinol. Metab. 2005, 90, 124–127. [Google Scholar] [CrossRef][Green Version]
  49. Mani Deepthi, D.; Vaikkakara, S.; Patil, A.; Ganta, S.; Sachan, A.; Raghavendra, K.; Kiranmayi, V.S.; Chowhan, A.K. Effect of correction of hyperthyroidism with anti-thyroid drugs on the glycated hemoglobin in non-diabetic patients with primary hyperthyroidism. Int. J. Endocrinol. Metab. 2021, 19, e105751. [Google Scholar] [CrossRef]
  50. Kim, M.K.; Kwon, H.S.; Baek, K.-H.; Lee, J.H.; Park, W.C.; Sohn, H.S.; Lee, K.-W.; Song, K.-H. Effects of thyroid hormone on glycated hemoglobin and glycated albumin levels in non-diabetic subjects with overt hypothyroidism. Diabetes Care 2010, 33, 2546–2548. [Google Scholar] [CrossRef][Green Version]
  51. Nikkilä, E.A.; Kekki, M. Plasma triglyceride metabolism in thyroid disease. J. Clin. Investig. 1972, 51, 2103–2114. [Google Scholar] [CrossRef][Green Version]
  52. Ferreira, C.; Neves, C.; Neves, J.; Oliveira, S.; Sokhatska, O.; Pereira, M.; Oliveira, A.; Medina, J.; Delgado, L.; Carvalho, D. Cardiovascular risk factors, autoimmunity and insulin resistance in Graves’ disease. Rev. Port. Endocrinol. Diabetes Metab. 2020, 15, 44–50. [Google Scholar] [CrossRef]
  53. Yuan, G.; Al-Shali, K.Z.; Hegele, R.A. Hypertriglyceridemia: Its etiology, effects and treatment. CMAJ 2007, 176, 1113–1120. [Google Scholar] [CrossRef][Green Version]
  54. Knudsen, N.; Laurberg, P.; Rasmussen, L.B.; Bülow, I.; Perrild, H.; Ovesen, L.; Jørgensen, T. Small differences in thyroid function may be important for body mass index and the occurrence of obesity in the population. J. Clin. Endocrinol. Metab. 2005, 90, 4019–4024. [Google Scholar] [CrossRef] [PubMed][Green Version]
  55. Makepeace, A.E.; Bremner, A.P.; O’Leary, P.; Leedman, P.J.; Feddema, P.; Michelangeli, V.; Walsh, J.P. Significant inverse relationship between serum free T4 concentration and body mass index in euthyroid subjects: Differences between smokers and nonsmokers. Clin. Endocrinol. 2008, 69, 648–652. [Google Scholar] [CrossRef] [PubMed]
  56. Alevizaki, M.; Saltiki, K.; Voidonikola, P.; Mantzou, E.; Papamichael, C.; Stamatelopoulos, K. Free thyroxine is an independent predictor of subcutaneous fat in euthyroid individuals. Eur. J. Endocrinol. 2009, 161, 459–465. [Google Scholar] [CrossRef] [PubMed][Green Version]
  57. Garduño-Garcia Jde, J.; Alvirde-Garcia, U.; López-Carrasco, G.; Padilla Mendoza, M.E.; Mehta, R.; Arellano-Campos, O.; Choza, R.; Sauque, L.; Garay-Sevilla, M.E.; Malacara, J.M.; et al. TSH and free thyroxine concentrations are associated with differing metabolic markers in euthyroid subjects. Eur. J. Endocrinol. 2010, 163, 273–278. [Google Scholar] [CrossRef][Green Version]
  58. Liu, Y.-Y.; Brent, G.A. Thyroid hormone crosstalk with nuclear receptor signaling in metabolic regulation. Trends Endocrinol. Metab. 2010, 21, 166–173. [Google Scholar] [CrossRef][Green Version]
  59. Tohma, Y.; Akturk, M.; Altinova, A.; Yassibas, E.; Cerit, E.T.; Gulbahar, O.; Arslan, M.; Sanlier, N.; Toruner, F. Circulating levels of Orexin-A, Nesfatin-1, Agouti-Related peptide, and neuropeptide Y in patients with hyperthyroidism. Thyroid 2015, 25, 776–783. [Google Scholar] [CrossRef]
  60. Lönn, L.; Stenlöf, K.; Ottosson, M.; Lindroos, A.-K.; Nyström, E.; Sjöström, L. Body weight and body composition changes after treatment of hyperthyroidism. J. Clin. Endocr. 1998, 83, 4269–4273. [Google Scholar] [CrossRef]
  61. Kim, B. Thyroid hormone as a determinant of energy expenditure and the basal metabolic rate. Thyroid 2008, 18, 141–144. [Google Scholar] [CrossRef]
Figure 1. Tasting genotype–phenotype correspondence. (a) TAS2R38 SNPs genotypes; dbSNP: The Single Nucleotide Polymorphism Database; rs#: reference SNP ID number; P = proline; A = alanine; V = valine; I = isoleucine; (b) TAS2R38 diplotypes and correspondent bitter tasting phenotypes [6,9].
Figure 1. Tasting genotype–phenotype correspondence. (a) TAS2R38 SNPs genotypes; dbSNP: The Single Nucleotide Polymorphism Database; rs#: reference SNP ID number; P = proline; A = alanine; V = valine; I = isoleucine; (b) TAS2R38 diplotypes and correspondent bitter tasting phenotypes [6,9].
Nutrients 15 02214 g001
Table 1. Distribution of BMI (WHO group classification) according to thyroid function.
Table 1. Distribution of BMI (WHO group classification) according to thyroid function.
BMI (kg/m2)
WHO Classification
Hypothyroidism
N (%)
Hyperthyroidism
N (%)
Control
N (%)
Total Sample
N (%)
<18.50 (0.00)2 (4.08)4 (2.23)6 (1.75)
18.5–24.919 (16.67)17 (34.69)35 (19.55)71 (20.76)
25–29.949 (42.98)24 (48.98)71 (39.66)144 (42.11)
≥3046 (40.35)6 (12.24)69 (38.55)121 (35.38)
Total114 (100)49 (100)179 (100)342 (100)
N: number of individuals in each BMI group; %: Percentage of individuals in each BMI group; WHO (World Health Organization); BMI: body mass index; p2 Pearson Test; Significance: p < 0.05.
Table 2. Statistically significant associations between the presence or absence of hypothyroidism/hyperthyroidism and metabolic, anthropometric and sociodemographic (age) parameters.
Table 2. Statistically significant associations between the presence or absence of hypothyroidism/hyperthyroidism and metabolic, anthropometric and sociodemographic (age) parameters.
ParametersThyroid FunctionNMean ± S.D./Median [Percentile 25th–75th]p-Value
Total fat mass
(kg)
Hypothyroidism10926.21 [21.63–30.99]0.004
Hyperthyroidism4822.76 [17.16–7.68]
Control17124.98 [19.94–30.93]
Total32825.08 [20.31–30.45]
Lean mass
(kg)
Hypothyroidism10942.80 [39.37–47.47]0.019
Hyperthyroidism4839.99 [17.16–5.92]
Control17143.25 [38.73–50.87]
Total32842.80 [38.65–48.96]
Fat mass
(%)
Hypothyroidism10938% [35–42%]0.025
Hyperthyroidism4835% [30–40%]
Control17137% [31–41%]
Total32838% [32–41%]
BMI
(kg/m2)
Hypothyroidism10928.76 [26.03–31.93]<0.001
Hyperthyroidism4825.85 [22.42–25.85]
Control17128.14 [25.20–32.19]
Total32827.89 [25.19–31.58]
Age
(years)
Hypothyroidism11458.46 ± 12.500.036
Hyperthyroidism4956.21 ± 13.81
Control17956.21 ± 13.81
Total34256.42 ± 13.83
Glycemia
(mg/dL)
Hypothyroidism9884.00 [76.75–93.00]0.014
Hyperthyroidism3382.00 [79.00–92.00]
Control15786.00 [77.00–103.00]
Total28884.00 [77.00–97.00]
N: Valid number of individuals for each analyzed parameter; BMI: body mass index (kg/m2); p-ANOVA (age) and p-test of Mann–Whitney (all other parameters); S.D.: Standard Deviation; Significant values for p < 0.05. Only parameters with significant association with thyroid function are shown.
Table 3. Statistically significant differences between hypothyroidism, hyperthyroidism and control for anthropometric, metabolic and sociodemographic (age) parameters.
Table 3. Statistically significant differences between hypothyroidism, hyperthyroidism and control for anthropometric, metabolic and sociodemographic (age) parameters.
ParametersThyroid FunctionMedian DifferenceS.D.p-Value
Total fat mass (kg)Hypothyroidism–Hyperthyroidism+0.931.140.001
Hyperthyroidism–Control−3.071.100.019
Fat mass (%)Hypothyroidism–Hyperthyroidism+2.941.110.029
BMI (kg/m2)Hypothyroidism–Hyperthyroidism+3.510.72<0.001
Hyperthyroidism–Control−3.070.70<0.001
Lean mass (kg)Hyperthyroidism–Control−3.831.200.005
S.D.: Standard deviation; BMI: Body mass index (kg/m2); p-Dunnett’s Test; Statistical significance for p < 0.05.
Table 4. Distribution of the genotype SNP A262V-valine–valine of the TAS2R38 gene according to thyroid function.
Table 4. Distribution of the genotype SNP A262V-valine–valine of the TAS2R38 gene according to thyroid function.
Sample According to Thyroid FunctionA262V Alanine–Valine or
Alanine–Alanine
N (%)
A262V
Valine–Valine
N (%)
OR; [IC95%];
(p-Value)
Hypothyroidism57 (50.4)56 (49.6)2.841; [1.726–4.676]; (<0.001)
Hyperthyroidism12 (24.5)37 (75.5)8.915; [4.286–18.543]; (<0.001)
Control133 (74.3)46 (25.7)Reference
Total202 (59.2)139 (40.8)___
N: Valid number of individuals for the analyzed parameter; %: percentage of the TAS2R38 genotype in hypo/hyperthyroidism, control, or total sample. OR: Odds Ratio by logistic multinomial regression with statistical significance for p < 0.05; IC: confidence interval.
Table 5. Distribution of the genotype SNP A262V-alanine–valine of the TAS2R38 gene according to thyroid function.
Table 5. Distribution of the genotype SNP A262V-alanine–valine of the TAS2R38 gene according to thyroid function.
Sample According to Thyroid
Functions
A262V
Alanine–Alanine or
Valine–Valine
N (%)
A262V
Alanine–Valine
N (%)
OR; [IC95%];
(p-Value)
Hypothyroidism71 (62.8)42 (37.2)0.467; [0.289–0.757] (0.002)
Hyperthyroidism42 (85.7)7 (14.3)0.132; [0.056–0.309] (0.001)
Control79 (44.1)100 (55.9)Reference
Total192 (56.3)149 (43.7)____
N: Valid number of individuals for the analyzed parameter; %: percentage of the TAS2R38 genotype in hypo/hyperthyroidism, control, or total sample. OR: Odds Ratio by logistic multinomial regression with statistical significance for p < 0.05; IC: confidence interval.
Table 6. Distribution of the PAV (proline–alanine–valine) haplotype in the sample according to thyroid function.
Table 6. Distribution of the PAV (proline–alanine–valine) haplotype in the sample according to thyroid function.
Sample According to Thyroid Function Non-PAV Haplotypes
N (%)
PAV
N (%)
OR; [IC95%]; (p-Value)
Hypothyroidism 68 (60.21)45 (39.8)0.456; [0.282–0.737]; (0.001)
Hyperthyroidism41 (87.2)6 (12.8)0.101; [0.041–0.250]; (0.001)
Control 73 (40.8)106 (59.2)Reference
Total 182 (53.7)157 (46.3)____
N: Valid number of individuals for the analyzed parameter; %: percentage of the TAS2R38 haplotype in hypothyroidism, hyperthyroidism, control, or total sample. Statistical significance for p < 0.05; OR: Odds Ratio by logistic multinomial regression; IC: confidence interval.
Table 7. Distribution of the PVV (proline-valine–valine) haplotype in the sample according to thyroid function.
Table 7. Distribution of the PVV (proline-valine–valine) haplotype in the sample according to thyroid function.
Sample According to
Thyroid Function
Non-PVV Haplotypes
N (%)
PVV
N (%)
p-Value
Hypothyroidism 94 (83.2)19 (16.8)0.001
Hyperthyroidism 24 (51.1)23 (48.9)
Control 179 (100)0 (0.0)
Total 297 (87.6)42 (12.4)
N: Number of valid individuals for the analyzed parameter; %: percentage of the TAS2R38 haplotype in hypothyroidism, hyperthyroidism, control or total sample; p2 Pearson Test; Statistical significance for p < 0.05.
Table 8. Distribution of the AVV (alanine–valine–valine) haplotype in the sample according to thyroid function.
Table 8. Distribution of the AVV (alanine–valine–valine) haplotype in the sample according to thyroid function.
Sample According to
Thyroid Function
Non-AVV Haplotypes
N (%)
AVV
N (%)
p-Value
Hypothyroidism 107 (94.7)6 (5.3)0.001
Hyperthyroidism 42 (89.4)5 (10.6)
Control 179 (100)0 (0.0)
Total 328 (96.8)11 (3.2)
N: Number of valid individuals for the analyzed parameter; %: percentage of the TAS2R38 haplotype in hypothyroidism, hyperthyroidism, control or total sample; p2 Pearson Test; Statistical significance for p < 0.05.
Table 9. TAS2R38 distribution according to thyroid function.
Table 9. TAS2R38 distribution according to thyroid function.
Sample According to Thyroid Function PVI/
PVI
N (%)
PVV/
PVI
N (%)
PVV/
AVI
N (%)
PVV/
AVV
N (%)
AVV/
AVV
N (%)
PAI/
PVI
N (%)
PAV/
PVI
N (%)
PAV/
AVI
N (%)
AAV/
AAV
N (%)
PAV/
AAV
N (%)
PAV/
AAI
N (%)
Hypothyroidism 32 0181508341230
(28)(0)(15.9)(0.9)(4.4)(0)(7.1)(30.1)(10.6)(2.7)(0)
Hyperthyroidism 1031823006500
(21.3)(6.4)(38.3)(4.3)(6.4)(0)(0)(12.8)(10.6)(0)(0)
Control 460000112872661
(25.7)(0)(0)(0)(0)(0.6)(6.7)(48.6)(14.5)(3.4)(0.6)
Total 88 33638 1 2012743 91
(26)(0.9)(10.6)(0.9)(2.4)(0.3)(5.9)(37.5)(12.7)(2.7)(0.3)
N: Number of valid individuals for the analyzed parameter; %: TAS2R38 diplotype percentage for each thyroid function group, and total sample; Statistical significance for p < 0.05.
Table 10. Statistically significant associations between TAS2R38 SNPs and metabolic, anthropometric, and sociodemographic (age) parameters.
Table 10. Statistically significant associations between TAS2R38 SNPs and metabolic, anthropometric, and sociodemographic (age) parameters.
TAS2R38 SNPsParametersSNPs GenotypesMean ± S.D./Median
[Percentile 25th–75th]
p-Value
P49ALean mass (kg)P49A-proline–proline 43.53 [39.86–51.33]0.031
Non-P49A-proline–proline42.48 [38.24–47.43]
A626VLeptin (ng/dL)A626V-alanine–alanine 23.59 [14.10–52.62]0.037
Non-A626V-alanine–alanine37.05 [22.74–66.78]
Age (years)A626V-alanine–alanine52.31 ± 13.190.029
Non-A626V-alanine–alanine57.12 ± 13.87
Glycemia (mg/dL)A626V-alanine–alanine78.00 [76.00–89.50]0.020
Non-A626V-alanine–alanine85.00 [79.00–98.00]
HbA1c (%)A626V-alanine–valine4.60 [3.60–6.33]0.030
Non-A626V-alanine–valine4.00 [3.55–5.20]
V296IAge (years)V296I-valine–valine other 53.18 ± 13.290.046
Non-V296I-valine–valine other57.02 ± 13.84
Uricemia (mg/dL)V296I-valine–isoleucine4.58 ± 1.330.026
Non-V296I-valine–isoleucine5.03 ± 1.42
Fat mass (%)V296I-valine–isoleucine 38% [32–41%]0.048
Non-V296I-valine–isoleucine37% [31–41%]
S.D.: Standard Deviation; p-Student’s t-test (age) or Kruskal–Wallis test; Significant values for p < 0.05.
Table 11. Statistically significant associations found between TAS2R38 haplotypes and metabolic, anthropometric and sociodemographic (age) parameters.
Table 11. Statistically significant associations found between TAS2R38 haplotypes and metabolic, anthropometric and sociodemographic (age) parameters.
ParametersTAS2R38
Haplotypes
Mean ± S.D./Median
[Percentile 25th–75th]
p-Value
HbA1c (%)PAV5.60 [3.60–7.30]0.048
Non-PAV4.00 [3.60–5.20]
PVV3.10 [3.05–3.90]0.025
Non-PVV4.90 [3.60–6.45]
Plasma triglycerides (mg/dL)PVV80.00 [66.00–98.00]0.038
Non-PVV98.00 [74.00–126.00]
Glycemia (mg/dL)AAV78.50 [76.00–89.75]0.027
Non-AAV85.00 [79.00–98.00]
Age (years)AAV52.98 ± 13.310.033
Non-AAV56.98 ± 13.8
PAI24.600.021
Non-PAI56.4 ± 13.72
Leptin (ng/mL)AVI42.25 [26.31–65.41]0.019
Non-AVI29.79 [16.32–62.48]
Lean mass (kg)PVV41.00 [36.86–45.31]0.036
Non-PVV43.01 [38.72–49.38]
AVI42.12 [38.50–46.75]0.043
Non-AVI43.25 [38.89–50.97]
PVI43.48 [39.83–51.35]0.039
Non-PVI42.49 [38.18–47.46]
S.D.: Standard Deviation; p-Student’s t-test (age) or Kruskal–Wallis test; Significant values for p < 0.05.
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Costa, M.M.; Da Silva, A.P.; Santos, C.; Ferreira, J.; Mascarenhas, M.R.; Bicho, M.; Barbosa, A.P. Influence of the TAS2R38 Gene Single Nucleotide Polymorphisms in Metabolism and Anthropometry in Thyroid Dysfunction. Nutrients 2023, 15, 2214. https://doi.org/10.3390/nu15092214

AMA Style

Costa MM, Da Silva AP, Santos C, Ferreira J, Mascarenhas MR, Bicho M, Barbosa AP. Influence of the TAS2R38 Gene Single Nucleotide Polymorphisms in Metabolism and Anthropometry in Thyroid Dysfunction. Nutrients. 2023; 15(9):2214. https://doi.org/10.3390/nu15092214

Chicago/Turabian Style

Costa, Marta Mendes, Alda Pereira Da Silva, Carolina Santos, Joana Ferreira, Mário Rui Mascarenhas, Manuel Bicho, and Ana Paula Barbosa. 2023. "Influence of the TAS2R38 Gene Single Nucleotide Polymorphisms in Metabolism and Anthropometry in Thyroid Dysfunction" Nutrients 15, no. 9: 2214. https://doi.org/10.3390/nu15092214

APA Style

Costa, M. M., Da Silva, A. P., Santos, C., Ferreira, J., Mascarenhas, M. R., Bicho, M., & Barbosa, A. P. (2023). Influence of the TAS2R38 Gene Single Nucleotide Polymorphisms in Metabolism and Anthropometry in Thyroid Dysfunction. Nutrients, 15(9), 2214. https://doi.org/10.3390/nu15092214

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop