Dose–Response Efficacy and Mechanisms of Orally Administered Bifidobacterium breve CCFM683 on IMQ-Induced Psoriasis in Mice
Abstract
1. Introduction
2. Materials and Methods
2.1. Strain Culture Conditions
2.2. Animal Experiment Design
2.3. Assessment of Psoriasis
2.4. Biochemical Assays
2.5. Quantitative RT-PCR
2.6. Protein Expression Determination
2.7. Bile Acid Analysis
2.8. Fecal DNA Sequencing and Bioinformatics Analysis
2.9. Statistical Analysis
3. Results
3.1. The Effect of B. breve CCFM683 on Psoriasis Symptoms
3.2. The Effect of B. breve CCFM683 on Histological Characteristics in Psoriasis Mice
3.3. Dose–Effect Curve between Gavage Doses and Psoriasis Remission
3.4. The Effect of B. breve CCFM683 on Keratinocytes and Epidermal Barrier in Psoriasis Mice
3.5. The Effect of B. breve CCFM683 on Bile Acid Metabolism in Psoriasis Mice
3.6. The Effect of B. breve CCFM683 on FXR/NF-κB Pathway and Immune Responses in Psoriasis
3.7. The Effect of B. breve CCFM683 on Gut Microbiota
4. Discussion
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Greb, J.E.; Goldminz, A.M.; Elder, J.T.; Lebwohl, M.G.; Gladman, D.D.; Wu, J.J.; Mehta, N.N.; Finlay, A.Y.; Gottlieb, A.B. Psoriasis. Nat. Rev. Dis. Primers 2016, 2, 16082. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Rizova, E.; Corroller, M. Topical calcitriol-studies on local tolerance and systemic safety. Br. J. Dermatol. 2001, 144 (Suppl. S58), 3–10. [Google Scholar] [PubMed]
- Deng, Y.; Fang, Z.; Cui, S.; Zhao, J.; Zhang, H.; Chen, W. Evaluation of probiotics for inhibiting hyperproliferation and inflammation relevant to psoriasis in vitro. J. Funct. Foods 2021, 81, 104433. [Google Scholar] [CrossRef] [Scilit]
- Chen, H.; Wang, C.; Tang, B.; Yu, J.; Lu, Y.; Zhang, J.; Yan, Y.; Deng, H.; Han, L.; Li, S.; et al. Punica granatum peel polysaccharides ameliorate imiquimod-induced psoriasis-like dermatitis in mice via suppression of NF-κB and STAT3 pathways. Front. Pharmacol. 2022, 12, 806844. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Chen, Y.H.; Wu, C.S.; Chao, Y.H.; Lin, C.C.; Tsai, H.Y.; Li, Y.R.; Chen, Y.Z.; Tsai, W.H.; Chen, Y.K. Lactobacillus pentosus GMNL-77 inhibits skin lesions in imiquimod-induced psoriasis-like mice. J. Food Drug Anal. 2017, 25, 559–566. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Lu, W.; Deng, Y.; Fang, Z.; Zhai, Q.; Cui, S.; Zhao, J.; Chen, W.; Zhang, H. Potential role of probiotics in ameliorating psoriasis by modulating gut microbiota in imiquimod-induced psoriasis-like mice. Nutrients 2021, 13, 2010. [Google Scholar] [CrossRef] [Scilit]
- Ogawa, C.; Inoue, R.; Yonejima, Y.; Hisa, K.; Yamamoto, Y.; Suzuki, T. Supplemental Leuconostoc mesenteroides strain NTM048 attenuates imiquimod-induced psoriasis in mice. J. Appl. Microbiol. 2021, 131, 3043–3055. [Google Scholar] [CrossRef] [Scilit]
- Gómez-Chávez, F.; Cedillo-Peláez, C.; Zapi-Colín, L.A.; Gutierrez-Gonzalez, G.; Martinez-Torres, I.; Peralta, H.; Chavez-Galan, L.; Avila-Calderon, E.D.; Contreras-Rodriguez, A.; Bartolo-Aguilar, Y.; et al. The extracellular vesicles from the commensal Staphylococcus epidermidis ATCC12228 strain regulate skin inflammation in the imiquimod-induced psoriasis murine model. Int. J. Mol. Sci. 2022, 22, 13029. [Google Scholar] [CrossRef] [Scilit]
- Rather, I.A.; Bajpai, V.K.; Huh, Y.S.; Han, Y.K.; Bhat, E.A.; Lim, J.; Paek, W.K.; Park, Y.H. Probiotic Lactobacillus sakei proBio-65 extract ameliorates the severity of imiquimod induced psoriasis-like skin inflammation in a mouse model. Front. Microbiol. 2018, 9, 1021. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Guo, H.; Li, M.; Liu, H. Selenium-rich yeast peptide fraction ameliorates imiquimod-induced psoriasis-like dermatitis in mice by inhibiting inflammation via MAPK and NF-κB signaling pathways. Int. J. Mol. Sci. 2022, 23, 2112. [Google Scholar] [CrossRef] [Scilit]
- Suriano, E.S.; Souza, M.D.M.; Kobata, C.M.; Santos, F.H.Y.; Mimica, M.J. Efficacy of an adjuvant Lactobacillus rhamnosus formula in improving skin lesions as assessed by PASI in patients with plaque psoriasis from a university-affiliated, tertiary-referral hospital in Sao Paulo (Brazil): A parallel, double-blind, randomized clinical trial. Arch. Dermatol. Res. 2023, 2023, 1–9. [Google Scholar]
- Zangrilli, A.; Diluvio, L.; Di Stadio, A.; Di Girolamo, S. Improvement of Psoriasis Using Oral Probiotic Streptococcus salivarius K-12: A Case-Control 24-Month Longitudinal Study. Probiotics Antimicrob. Proteins. 2022, 14, 573–578. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Groeger, D.; O’Mahony, L.; Murphy, E.F.; Bourke, J.F.; Dinan, T.G.; Kiely, B.; Shanahan, F.; Quigley, E.M.M. Bifidobacterium infantis 35624 modulates host inflammatory processes beyond the gut. Gut Microbes 2013, 4, 325–339. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Haidmayer, A.; Bosch, P.; Lackner, A.; D’Orazio, M.; Fessler, J.; Stradner, M.H. Effects of Probiotic Strains on Disease Activity and Enteric Permeability in Psoriatic Arthritis-A Pilot Open-Label Study. Nutrients 2020, 12, 2337. [Google Scholar] [CrossRef] [Scilit]
- Hill, C.; Guarner, F.; Reid, G.; Gibson, G.R.; Merenstein, D.J.; Pot, B.; Morelli, L.; Canani, R.B.; Flint, H.J.; Salminen, S.; et al. Expert consensus document: The international scientific association for probiotics and prebiotics consensus statement on the scope and appropriate use of the term probiotic. Nat. Rev. Gastroenterol. Hepatol. 2014, 11, 506–514. [Google Scholar] [CrossRef] [Scilit]
- Yang, B.; Chen, H.; Gao, H.; Wang, J.; Stanton, C.; Ross, R.P.; Zhang, H.; Chen, W. Bifidobacterium breve CCFM683 could ameliorate DSS-induced colitis in mice primarily via conjugated linoleic acid production and gut microbiota modulation. J. Funct. Foods 2018, 49, 61–72. [Google Scholar] [CrossRef] [Scilit]
- Luo, D.Q.; Wu, H.H.; Zhao, Y.K.; Liu, J.H.; Wang, F. Original research: Different imiquimod creams resulting in differential effects for imiquimod-induced psoriatic mouse models. Exp. Biol. Med. 2016, 241, 1733–1738. [Google Scholar] [CrossRef] [Scilit]
- Chen, Y.; Jin, Y.; Stanton, C.; Ross, R.P.; Wang, Z.; Zhao, J.; Zhang, H.; Yang, B.; Chen, W. Dose-response efficacy and mechanisms of orally administered CLA-producing Bifidobacterium breve CCFM683 on DSS-induced colitis in mice. J. Funct. Foods 2020, 75, 104245. [Google Scholar] [CrossRef] [Scilit]
- Wang, M.; Li, T.; Ouyang, Z.; Tang, K.; Zhu, Y.; Song, C.; Sun, H.; Yu, B.; Ji, X.; Sun, Y. SHP2 allosteric inhibitor TK-453 alleviates psoriasis-like skin inflammation in mice via inhibition of IL-23/Th17 axis. iScience 2022, 25, 104009. [Google Scholar] [CrossRef] [Scilit]
- Chen, C.; Hu, B.Y.; Wu, T.Z.; Zhang, Y.; Xu, Y.; Feng, Y.L.; Jiang, H.L. Bile acid profiles in diabetic (db/db) mice and their wild type littermates. J. Pharm. Biomed. Anal. 2016, 131, 473–481. [Google Scholar] [CrossRef] [Scilit]
- Feng, H.; Wu, Y.Q.; Xu, Y.S.; Wang, K.X.; Qin, X.M.; Lu, Y.F. LC-MS-Based Metabolomic Study of Oleanolic Acid-Induced Hepatotoxicity in Mice. Front. Pharmacol. 2020, 11, 747. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Chong, J.; Liu, P.; Zhou, G.; Xia, J. Using MicrobiomeAnalyst for comprehensive statistical, functional, and meta-analysis of microbiome data. Nat. Protoc. 2020, 15, 799–821. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Guo, W.G.; Xiang, Q.; Mao, B.; Tang, X.; Cui, S.; Li, X.; Zhao, J.; Zhang, H.; Chen, W. Protective effects of microbiome-derived inosine on lipopolysaccharide-induced acute liver damage and inflammation in mice via mediating the TLR4/NF-κB pathway. J. Agric. Food Chem. 2021, 69, 7619–7628. [Google Scholar] [CrossRef] [Scilit]
- Miranda, V.C.; Santos, S.S.; Assis, H.C.; Faria, A.; Quintanilha, M.F.; Morao, R.P.; Nicoli, J.R.; Cara, D.C.; Martins, F.S. Effect of Saccharomyces cerevisiae UFMG A-905 in a murine model of food allergy. Benefic. Microbes. 2020, 11, 255–268. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Zhou, X.; Chen, Y.F.; Ma, X.; Yu, Y.; Yu, X.P.; Chen, X.Y.; Suo, H.Y. Efficacy of Bacillus coagulans BC01 on loperamide hydrochloride-induced constipation model in Kunming mice. Front. Nutr. 2022, 9, 964257. [Google Scholar] [CrossRef] [Scilit]
- Xu, J.; Chen, H.; Chu, Z.; Li, Z.; Chen, B.; Sun, J.; Lai, W.; Ma, Y.; He, Y.; Qian, H.; et al. A multifunctional composite hydrogel as an intrinsic and extrinsic coregulator for enhanced therapeutic efficacy for psoriasis. J. Nanobiotechnol. 2022, 20, 1–17. [Google Scholar] [CrossRef] [Scilit]
- Thewes, M.; Stadler, R.; Korge, B.; Mischke, D. Normal psoriatic epidermis expression of hyperproliferation-associated keratins. Arch. Dermatol. Res. 1991, 283, 465–471. [Google Scholar] [CrossRef] [Scilit]
- Szöllősi, A.G.; Gueniche, A.; Jammayrac, O.; Szabo-Papp, J.; Blanchard, C.; Vasas, N.; Andrasi, M.; Juhasz, I.; Breton, L.; Biro, T. Bifidobacterium longum extract exerts pro-differentiating effects on human epidermal keratinocytes, in vitro. Exp. Dermatol. 2017, 26, 92–94. [Google Scholar] [CrossRef] [Scilit]
- Engebretsen, K.A.; Thyssen, J.P. Skin Barrier Function and Allergens. Curr. Probl. Dermatol. 2016, 49, 90–102. [Google Scholar]
- Proksch, E.; Brandner, J.M.; Jensen, J.M. The skin: An indispensable barrier. Exp. Dermatol. 2008, 17, 273–277. [Google Scholar] [CrossRef] [Scilit]
- Kim, S.Y.; Lee, J.O.; Kim, Y.J.; Jang, Y.A.; Lee, J.M.; Park, A.Y.; Yoo, K.H.; Kim, B.J. Effects of oral administration of Lactiplantibacillus plantarum APsulloc 331261 (GTB1TM) isolated from green tea on atopic dermatitis (AD)-like skin lesion mouse models. Evid. Based Complement. Alternat. Med. 2022, 2022, 4520433. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Kim, B.E.; Howell, M.D.; Guttman, E.; Gilleaudeau, P.M.; Cardinale, I.R.; Boguniewicz, M.; Krueger, J.G.; Leung, D.Y.M. TNF-α downregulates filaggrin and loricrin through c-Jun N-terminal kinase: Role for tnf-α antagonists to improve skin barrier. J. Investig. Dermatol. 2011, 131, 1272–1279. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Eckert, R.L.; Yaffe, M.B.; Crish, J.F.; Murthy, S.; Rorke, E.A.; Welter, J.F. Involucrin—Structure and role in envelope assembly. J. Investig. Dermatol. 1993, 100, 613–617. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Shi, Z.; Wu, X.; Wu, C.; Singh, S.P.; Law, T.; Yamada, D.; Huynh, M.; Liakos, W.; Yang, G.Y.; Farber, J.M.; et al. Bile acids improve psoriasiform dermatitis through inhibition of IL-17A expression and CCL20-CCR6 mediated trafficking of T cells. J. Investig. Dermatol. 2021, 142, 1381. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Hansen, M.K.; Connolly, T.M. Nuclear receptors as drug targets in obesity, dyslipidemia and atherosclerosis. Curr. Opin. Investig. Drugs. 2008, 9, 247–255. [Google Scholar]
- Yamamoto, Y.; Gaynor, R.B. Therapeutic potential of inhibition of the NF-kappa B pathway in the treatment of inflammation and cancer. J. Clin. Investig. 2001, 107, 135–142. [Google Scholar] [CrossRef] [Scilit]
- Wang, Y.D.; Chen, W.D.; Wang, M.H.; Yu, D.N.; Forman, B.M.; Huang, W.D. Farnesoid X receptor antagonizes nuclear factor kappaB in hepatic inflammatory response. Hepatology 2008, 48, 1632–1643. [Google Scholar] [CrossRef] [Scilit]
- Yu, J.H.; Zheng, J.B.; Qi, J.; Yang, K.; Wu, Y.H.; Wang, K.; Wang, C.B.; Sun, X.J. Bile acids promote gastric intestinal metaplasia by upregulating CDX2 and MUC2 expression via the FXR/NF-B signalling pathway. Int. J. Oncol. 2019, 54, 879–892. [Google Scholar] [CrossRef] [Scilit]
- Orlik, C.; Deibel, D.; Kublbeck, J.; Balta, E.; Ganskih, S.; Habicht, J.; Niesler, B.; Schröder-Braunstein, J.; Schäkel, K.; Wabnitz, G.; et al. Keratinocytes costimulate naive human T cells via CD2: A potential target to prevent the development of proinflammatory Th1 cells in the skin. Cell. Mol. Immunol. 2019, 17, 380–394. [Google Scholar] [CrossRef] [Scilit]
- Di Cesare, A.; Di Meglio, P.; Nestle, F.O. The IL-23/Th17 Axis in the immunopathogenesis of psoriasis. J. Investig. Dermatol. 2009, 129, 1339–1350. [Google Scholar] [CrossRef] [Scilit]
- Mahmud, M.R.; Akter, S.; Tamanna, S.K.; Mazumder, L.; Esti, I.Z.; Banerjee, S.; Akter, S.; Hasan, M.R.; Acharjee, M.; Hossain, M.S. Impact of gut microbiome on skin health: Gut-skin axis observed through the lenses of therapeutics and skin diseases. Gut Microbes. 2022, 14, 2096995. [Google Scholar] [CrossRef] [Scilit]
- Hidalgo-Cantabrana, C.; Gómez, J.; Delgado, S.; Requena-Lopez, S.; Queiro-Silva, R.; Margolles, A.; Coto, E.; Sanchez, B.; Coto-Segura, P. Gut microbiota dysbiosis in a cohort of patients with psoriasis. Br. J. Dermatol. 2019, 181, 1287–1295. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Singh, T.P.; Lee, C.H.; Farber, J.M. Chemokine receptors in psoriasis. Expert Opin. Ther. Targets 2013, 17, 1405–1422. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Ridlon, J.M.; Kang, D.J.; Hylemon, P.B. Bile salt biotransformations by human intestinal bacteria. J. Lipid Res. 2006, 47, 241–259. [Google Scholar] [CrossRef] [Scilit]
- Li, Z.P.; Gurung, M.; Rodrigues, R.R.; Padiadpu, J.; Newman, N.K.; Manes, N.P.; Pederson, J.W.; Greer, R.L.; Vasquez-Perez, S.; You, H.; et al. Microbiota and adipocyte mitochondrial damage in type 2 diabetes are linked by Mmp12(+) macrophages. J. Exp. Med. 2022, 219, e20220017. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Ricketts, J.R.; Rothe, M.J.; Grant-Kels, J.M. Nutrition and psoriasis. Clin. Dermatol. 2010, 28, 615–626. [Google Scholar] [CrossRef] [Scilit]
- Li, C.; Cui, L.H.; Wang, X.H.; Yan, Z.H.; Wang, S.X.; Zheng, Y. Using intestinal flora to distinguish non-alcoholic steatohepatitis from non-alcoholic fatty liver. Int. J. Appl. Basic. Med. Res. 2020, 48, 300060520978122. [Google Scholar] [CrossRef] [Scilit]
- Zhou, Y.M.; Wang, T.S.; Zhao, X.S.; Wang, J.; Wang, Q. Plasma metabolites and gut microbiota are associated with T cell imbalance in BALB/c model of eosinophilic asthma. Front. Pharmacol. 2022, 13, 819747. [Google Scholar] [CrossRef] [Scilit]
- Gryaznova, M.V.; Solodskikh, S.A.; Panevina, A.V.; Syromyatnikov, M.Y.; Dvoretskaya, Y.D.; Sviridova, T.N.; Popov, E.S.; Popov, V.N. Study of microbiome changes in patients with ulcerative colitis in the Central European part of Russia. Heliyon 2021, 7, e06432. [Google Scholar] [CrossRef] [Scilit]
- Wang, H.Q.; Huang, J.; Ding, Y.A.; Zhou, J.W.; Gao, G.Z.; Han, H.; Zhou, J.R.; Ke, L.J.; Rao, P.F.; Chen, T.B.; et al. Nanoparticles isolated from porcine bone soup ameliorated dextran sulfate sodium-induced colitis and regulated gut microbiota in mice. Front. Nutr. 2022, 9, 821404. [Google Scholar] [CrossRef] [Scilit]
- Qu, Y.C.; Su, C.J.; Zhao, Q.H.; Shi, A.M.; Zhao, F.L.; Tang, L.X.; Xu, D.L.; Xiang, Z.; Wang, Y.; Wang, Y.Y.; et al. Gut microbiota-mediated elevated production of secondary bile acids in chronic unpredictable mild stress. Front. Pharmacol. 2022, 13, 837543. [Google Scholar] [CrossRef] [Scilit] [PubMed]



















| Group | Daily Gavage Treatment (0.2 mL) | 15–20 Days |
|---|---|---|
| Control | Saline (0.85%) | Treated with vaseline |
| IMQ | Saline (0.85%) | Treated with IMQ |
| MTX | 2 mg/mL methotrexate | Treated with IMQ |
| 106 CFU/day CCFM683 | 5 × 106 CFU/mL CCFM683 | Treated with IMQ |
| 107 CFU/day CCFM683 | 5 × 107 CFU/mL CCFM683 | Treated with IMQ |
| 108 CFU/day CCFM683 | 5 × 108 CFU/mL CCFM683 | Treated with IMQ |
| 109 CFU/day CCFM683 | 5 × 109 CFU/mL CCFM683 | Treated with IMQ |
| 1010 CFU/day CCFM683 | 5 × 1010 CFU/mL CCFM683 | Treated with IMQ |
| Gene | Forward Primer (5′–3′) | Reverse Primer (5′–3′) |
|---|---|---|
| k1 | TGGGAGATTTTCAGGAGGAGG | GCCACACTCTTGGAGATGCTC |
| k10 | CTGGCGATGTGAACGTGGAA | GTCCCTGAACAGTGCGTCTC |
| k16 | GGTGGCCTCTAACAGTGATCT | TGCATACAGTATCTGCCTTTGG |
| k17 | ACCATCCGCCAGTTTACCTC | CTACCCAGGCCACTAGCTGA |
| Lor | GCGGATCGTCCCAACAGTATC | TGAGAGGAGTAATAGCCCCCT |
| Ivl | ATGTCCCATCAACACACACTG | TGGAGTTGGTTGCTTTGCTTG |
| Flg | ATGTCCGCTCTCCTGGAAAG | TGGATTCTTCAAGACTGCCTGTA |
| G-CSF | ATGGCTCAACTTTCTGCCCAG | CTGACAGTGACCAGGGGAAC |
| CCL3 | TTCTCTGTACCATGACACTCTGC | CGTGGAATCTTCCGGCTGTAG |
| CCL5 | GCTGCTTTGCCTACCTCTCC | TCGAGTGACAAACACGACTGC |
| CCL8 | TCTACGCAGTGCTTCTTTGCC | AAGGGGGATCTTCAGCTTTAGTA |
| β-actin | GGCTGTATTCCCCTCCATCG | CCAGTTGGTAACAATGCCATGT |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Chen, X.; Chen, Y.; Stanton, C.; Ross, R.P.; Zhao, J.; Chen, W.; Yang, B. Dose–Response Efficacy and Mechanisms of Orally Administered Bifidobacterium breve CCFM683 on IMQ-Induced Psoriasis in Mice. Nutrients 2023, 15, 1952. https://doi.org/10.3390/nu15081952
Chen X, Chen Y, Stanton C, Ross RP, Zhao J, Chen W, Yang B. Dose–Response Efficacy and Mechanisms of Orally Administered Bifidobacterium breve CCFM683 on IMQ-Induced Psoriasis in Mice. Nutrients. 2023; 15(8):1952. https://doi.org/10.3390/nu15081952
Chicago/Turabian StyleChen, Xinqi, Yang Chen, Catherine Stanton, Reynolds Paul Ross, Jianxin Zhao, Wei Chen, and Bo Yang. 2023. "Dose–Response Efficacy and Mechanisms of Orally Administered Bifidobacterium breve CCFM683 on IMQ-Induced Psoriasis in Mice" Nutrients 15, no. 8: 1952. https://doi.org/10.3390/nu15081952
APA StyleChen, X., Chen, Y., Stanton, C., Ross, R. P., Zhao, J., Chen, W., & Yang, B. (2023). Dose–Response Efficacy and Mechanisms of Orally Administered Bifidobacterium breve CCFM683 on IMQ-Induced Psoriasis in Mice. Nutrients, 15(8), 1952. https://doi.org/10.3390/nu15081952

