Geraniol Ameliorates Doxorubicin-Mediated Kidney Injury through Alteration of Antioxidant Status, Inflammation, and Apoptosis: Potential Roles of NF-κB and Nrf2/Ho-1
Abstract
:1. Introduction
2. Material and Methods
2.1. Animals
2.2. Experimental Design
2.3. Determination of Kidney Function Markers
2.4. Evaluation of Lipid Peroxidation
2.5. Quantification of Reduced Glutathione
2.6. Quantification of Activity of Catalase
2.7. Gene Expression Analysis (RT-qPCR)
2.8. Immunoblot Analysis
2.9. Histopathology Studies
2.10. Data Analysis
3. Results
3.1. Geraniol Protects Kidneys against Doxorubicin-Mediated Injury
3.2. Geraniol Protects against Doxorubicin-Mediated Oxidative Stress
3.3. Geraniol Protects against Doxorubicin-Mediated Kidney Inflammation
3.4. Geraniol Protects against Doxorubicin-Mediated Apoptosis
3.5. Geraniol Protects against Doxorubicin-Mediated Alteration in Kidney Architecture
4. Discussion
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Shi, Y.; Li, F.; Shen, M.; Sun, C.; Hao, W.; Wu, C.; Xie, Y.; Zhang, S.; Gao, H.; Yang, J.; et al. Luteolin Prevents Cardiac Dysfunction and Improves the Chemotherapeutic Efficacy of Doxorubicin in Breast Cancer. Front. Cardiovasc. Med. 2021, 8, 750186. [Google Scholar] [CrossRef] [PubMed]
- Li, L.; Li, J.; Wang, Q.; Zhao, X.; Yang, D.; Niu, L.; Yang, Y.; Zheng, X.; Hu, L.; Li, Y. Shenmai Injection Protects Against Doxorubicin-Induced Cardiotoxicity via Maintaining Mitochondrial Homeostasis. Front. Pharmacol. 2020, 11, 815. [Google Scholar] [CrossRef] [PubMed]
- Tung, N.; Arun, B.; Hacker, M.R.; Hofstatter, E.; Toppmeyer, D.L.; Isakoff, S.J.; Borges, V.; Legare, R.D.; Isaacs, C.; Wolff, A.C.; et al. TBCRC 031: Randomized Phase II Study of Neoadjuvant Cisplatin Versus Doxorubicin-Cyclophosphamide in Germline BRCA Carriers With HER2-Negative Breast Cancer (the INFORM trial). J. Clin. Oncol. 2020, 38, 1539–1548. [Google Scholar] [CrossRef] [PubMed]
- Pfisterer, J.; Shannon, C.M.; Baumann, K.; Rau, J.; Harter, P.; Joly, F.; Sehouli, J.; Canzler, U.; Schmalfeldt, B.; Dean, A.P.; et al. Bevacizumab and platinum-based combinations for recurrent ovarian cancer: A randomised, open-label, phase 3 trial. Lancet Oncol. 2020, 21, 699–709. [Google Scholar] [CrossRef]
- Ibrahim Fouad, G.; Ahmed, K.A. The protective impact of berberine against doxorubicin-induced nephrotoxicity in rats. Tissue Cell 2021, 73, 101612. [Google Scholar] [CrossRef] [PubMed]
- Fukasawa, H.; Furuya, R.; Yasuda, H.; Yamamoto, T.; Hishida, A.; Kitagawa, M. Anti-cancer agent-induced nephrotoxicity. Anti-Cancer Agents Med. Chem. 2014, 14, 921–927. [Google Scholar] [CrossRef]
- Khames, A.; Khalaf, M.M.; Gad, A.M.; Abd El-Raouf, O.M.; Kandeil, M.A. Nicorandil combats doxorubicin-induced nephrotoxicity via amendment of TLR4/P38 MAPK/NFκ-B signaling pathway. Chem. Biol. Interact. 2019, 311, 108777. [Google Scholar] [CrossRef]
- Zhu, M.M.; Wang, L.; Yang, D.; Li, C.; Pang, S.T.; Li, X.H.; Li, R.; Yang, B.; Lian, Y.P.; Ma, L.; et al. Wedelolactone alleviates doxorubicin-induced inflammation and oxidative stress damage of podocytes by IκK/IκB/NF-κB pathway. Biomed. Pharmacother. 2019, 117, 109088. [Google Scholar] [CrossRef]
- Owumi, S.E.; Lewu, D.O.; Arunsi, U.O.; Oyelere, A.K. Luteolin attenuates doxorubicin-induced derangements of liver and kidney by reducing oxidative and inflammatory stress to suppress apoptosis. Hum. Exp. Toxicol. 2021, 40, 1656–1672. [Google Scholar] [CrossRef]
- Entezari Heravi, N.; Hosseinian, S.; Naji Ebrahimi Yazd, Z.; Shafei, M.N.; Ebrahimzadeh Bideskan, A.; Shahraki, S.; Samadi Noshahr, Z.; Motejadded, F.; Beheshti, F.; Mohebbati, R.; et al. Doxorubicin-induced renal inflammation in rats: Protective role of Plantago major. Avicenna J. Phytomed. 2018, 8, 179–187. [Google Scholar]
- Ali, N.; AlAsmari, A.F.; Imam, F.; Ahmed, M.Z.; Alqahtani, F.; Alharbi, M.; AlSwayyed, M.; AlAsmari, F.; Alasmari, M.; Alshammari, A.; et al. Protective effect of diosmin against doxorubicin-induced nephrotoxicity. Saudi J. Biol. Sci. 2021, 28, 4375–4383. [Google Scholar] [CrossRef] [PubMed]
- Yazd, Z.N.E.; Noshahr, Z.S.; Hosseinian, S.; Shafei, M.N.; Bideskan, A.E.; Mohebbati, R.; Heravi, N.E.; Shahraki, S.; Mahzari, S.; Rad, A.K. Renoprotective Effect of Plantago major Against Proteinuria and Apoptosis Induced by Adriamycin in Rat. J. Pharmacopunct. 2019, 22, 35–40. [Google Scholar] [CrossRef] [PubMed]
- Wu, Q.; Li, W.; Zhao, J.; Sun, W.; Yang, Q.; Chen, C.; Xia, P.; Zhu, J.; Zhou, Y.; Huang, G.; et al. Apigenin ameliorates doxorubicin-induced renal injury via inhibition of oxidative stress and inflammation. Biomed. Pharmacother. 2021, 137, 111308. [Google Scholar] [CrossRef] [PubMed]
- El-Emam, S.Z.; Soubh, A.A.; Al-Mokaddem, A.K.; Abo El-Ella, D.M. Geraniol activates Nrf-2/HO-1 signaling pathway mediating protection against oxidative stress-induced apoptosis in hepatic ischemia-reperfusion injury. Naunyn-Schmiedebergs Arch. Pharmacol. 2020, 393, 1849–1858. [Google Scholar] [CrossRef] [PubMed]
- Kensler, T.W.; Wakabayashi, N.; Biswal, S. Cell survival responses to environmental stresses via the Keap1-Nrf2-ARE pathway. Annu. Rev. Pharmacol. Toxicol. 2007, 47, 89–116. [Google Scholar] [CrossRef]
- Vomund, S.; Schäfer, A.; Parnham, M.J.; Brüne, B.; von Knethen, A. Nrf2, the Master Regulator of Anti-Oxidative Responses. Int. J. Mol. Sci. 2017, 18, 2772. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Hennig, P.; Garstkiewicz, M.; Grossi, S.; Di Filippo, M.; French, L.E.; Beer, H.D. The Crosstalk between Nrf2 and Inflammasomes. Int. J. Mol. Sci. 2018, 19, 562. [Google Scholar] [CrossRef] [Green Version]
- Bellezza, I.; Giambanco, I.; Minelli, A.; Donato, R. Nrf2-Keap1 signaling in oxidative and reductive stress. Biochim. Biophys. Acta Mol. Cell Res. 2018, 1865, 721–733. [Google Scholar] [CrossRef]
- Rojo de la Vega, M.; Chapman, E.; Zhang, D.D. NRF2 and the Hallmarks of Cancer. Cancer Cell 2018, 34, 21–43. [Google Scholar] [CrossRef]
- Zhang, Y.; Xu, Y.; Qi, Y.; Xu, L.; Song, S.; Yin, L.; Tao, X.; Zhen, Y.; Han, X.; Ma, X.; et al. Protective effects of dioscin against doxorubicin-induced nephrotoxicity via adjusting FXR-mediated oxidative stress and inflammation. Toxicology 2017, 378, 53–64. [Google Scholar] [CrossRef]
- Kamble, S.M.; Patil, C.R. Asiatic Acid Ameliorates Doxorubicin-Induced Cardiac and Hepato-Renal Toxicities with Nrf2 Transcriptional Factor Activation in Rats. Cardiovasc. Toxicol. 2018, 18, 131–141. [Google Scholar] [CrossRef] [PubMed]
- Cortez, M.; Carmo, L.S.; Rogero, M.M.; Borelli, P.; Fock, R.A. A high-fat diet increases IL-1, IL-6, and TNF-α production by increasing NF-κB and attenuating PPAR-γ expression in bone marrow mesenchymal stem cells. Inflammation 2013, 36, 379–386. [Google Scholar] [CrossRef] [PubMed]
- Wang, D.; Wang, Y.P.; Cheng, M.; Cheng, W.; Hu, S.J.; Lv, Y.; We, L.; Jin, H.; Wang, L.Y.; Ren, K.J. Intervention of Qingshen Granule on NF-KB Signal Pathway of Chronic Renal Failure Patients with Damp-heat Syndrome. Zhongguo Zhong Xi Yi Jie He Za Zhi 2017, 37, 23–27. [Google Scholar] [PubMed]
- Kalyanaraman, B.; Joseph, J.; Kalivendi, S.; Wang, S.; Konorev, E.; Kotamraju, S. Doxorubicin-induced apoptosis: Implications in cardiotoxicity. Mol. Cell Biochem. 2002, 234–235, 119–124. [Google Scholar] [CrossRef]
- Sabbah, H.N. Apoptotic cell death in heart failure. Cardiovasc. Res. 2000, 45, 704–712. [Google Scholar] [CrossRef]
- Kunisada, K.; Tone, E.; Negoro, S.; Nakaoka, Y.; Oshima, Y.; Osugi, T.; Funamoto, M.; Izumi, M.; Fujio, Y.; Hirota, H.; et al. Bcl-xl reduces doxorubicin-induced myocardial damage but fails to control cardiac gene downregulation. Cardiovasc. Res. 2002, 53, 936–943. [Google Scholar] [CrossRef] [Green Version]
- Li, Y.; Cohen, R. Caspase inhibitors and myocardial apoptosis. Int. Anesthesiol. Clin. 2005, 43, 77–89. [Google Scholar] [CrossRef]
- Crompton, M. Bax, Bid and the permeabilization of the mitochondrial outer membrane in apoptosis. Curr. Opin. Cell Biol. 2000, 12, 414–419. [Google Scholar] [CrossRef]
- Ibrahim, K.M.; Mantawy, E.M.; Elanany, M.M.; Abdelgawad, H.S.; Khalifa, N.M.; Hussien, R.H.; El-Agroudy, N.N.; El-Demerdash, E. Protection from doxorubicin-induced nephrotoxicity by clindamycin: Novel antioxidant, anti-inflammatory and anti-apoptotic roles. Naunyn-Schmiedebergs Arch. Pharmacol. 2020, 393, 739–748. [Google Scholar] [CrossRef]
- Asaad, G.F.; Hassan, A.; Mostafa, R.E. Anti-oxidant impact of Lisinopril and Enalapril against acute kidney injury induced by doxorubicin in male Wistar rats: Involvement of kidney injury molecule-1. Heliyon 2021, 7, e05985. [Google Scholar] [CrossRef]
- Rajasekaran, M. Nephroprotective effect of Costus pictus extract against doxorubicin-induced toxicity on Wistar rat. Bangladesh J. Pharmacol. 2019, 14, 93–100. [Google Scholar] [CrossRef]
- Younis, N.S.; Abduldaium, M.S.; Mohamed, M.E. Protective Effect of Geraniol on Oxidative, Inflammatory and Apoptotic Alterations in Isoproterenol-Induced Cardiotoxicity: Role of the Keap1/Nrf2/HO-1 and PI3K/Akt/mTOR Pathways. Antioxidants 2020, 9, 977. [Google Scholar] [CrossRef] [PubMed]
- Xue, Z.; Zhang, X.G.; Wu, J.; Xu, W.C.; Li, L.Q.; Liu, F.; Yu, J.E. Effect of treatment with geraniol on ovalbumin-induced allergic asthma in mice. Ann. Allergy Asthma Immunol. 2016, 116, 506–513. [Google Scholar] [CrossRef] [PubMed]
- De Carvalho, K.I.; Bonamin, F.; Dos Santos, R.C.; Périco, L.L.; Beserra, F.P.; de Sousa, D.P.; Filho, J.M.; da Rocha, L.R.; Hiruma-Lima, C.A. Geraniol-a flavoring agent with multifunctional effects in protecting the gastric and duodenal mucosa. Naunyn-Schmiedebergs Arch. Pharmacol. 2014, 387, 355–365. [Google Scholar] [CrossRef]
- Cho, M.; So, I.; Chun, J.N.; Jeon, J.H. The antitumor effects of geraniol: Modulation of cancer hallmark pathways (Review). Int. J. Oncol. 2016, 48, 1772–1782. [Google Scholar] [CrossRef] [Green Version]
- Deng, X.Y.; Xue, J.S.; Li, H.Y.; Ma, Z.Q.; Fu, Q.; Qu, R.; Ma, S.P. Geraniol produces antidepressant-like effects in a chronic unpredictable mild stress mice model. Physiol. Behav. 2015, 152, 264–271. [Google Scholar] [CrossRef]
- El-Said, Y.A.M.; Sallam, N.A.A.; Ain-Shoka, A.A.; Abdel-Latif, H.A. Geraniol ameliorates diabetic nephropathy via interference with miRNA-21/PTEN/Akt/mTORC1 pathway in rats. Naunyn-Schmiedebergs Arch. Pharmacol. 2020, 393, 2325–2337. [Google Scholar] [CrossRef]
- Ohkawa, H.; Ohishi, N.; Yagi, K. Assay for lipid peroxides in animal tissues by thiobarbituric acid reaction. Anal. Biochem. 1979, 95, 351–358. [Google Scholar] [CrossRef]
- Sedlak, J.; Lindsay, R.H. Estimation of total, protein-bound, and nonprotein sulfhydryl groups in tissue with Ellman’s reagent. Anal. Biochem. 1968, 25, 192–205. [Google Scholar] [CrossRef]
- Claiborne, A. Catalase Activity; CRC Press: Boca Raton, FL, USA, 1985; Volume 2. [Google Scholar]
- AlAsmari, A.F.; Alharbi, M.; Alqahtani, F.; Alasmari, F.; AlSwayyed, M.; Alzarea, S.I.; Al-Alallah, I.A.; Alghamdi, A.; Hakami, H.M.; Alyousef, M.K.; et al. Diosmin Alleviates Doxorubicin-Induced Liver Injury via Modulation of Oxidative Stress-Mediated Hepatic Inflammation and Apoptosis via NfkB and MAPK Pathway: A Preclinical Study. Antioxidants 2021, 10, 1998. [Google Scholar] [CrossRef]
- Ali, N.; Rashid, S.; Nafees, S.; Hasan, S.K.; Shahid, A.; Majed, F.; Sultana, S. Protective effect of Chlorogenic acid against methotrexate induced oxidative stress, inflammation and apoptosis in rat liver: An experimental approach. Chem. Biol. Interact. 2017, 272, 80–91. [Google Scholar] [CrossRef] [PubMed]
- Rashid, S.; Ali, N.; Nafees, S.; Ahmad, S.T.; Arjumand, W.; Hasan, S.K.; Sultana, S. Alleviation of doxorubicin-induced nephrotoxicity and hepatotoxicity by chrysin in Wistar rats. Toxicol. Mech. Methods 2013, 23, 337–345. [Google Scholar] [CrossRef] [PubMed]
- Younis, N.S.; Elsewedy, H.S.; Shehata, T.M.; Mohamed, M.E. Geraniol Averts Methotrexate-Induced Acute Kidney Injury via Keap1/Nrf2/HO-1 and MAPK/NF-κB Pathways. Curr. Issues Mol. Biol. 2021, 43, 123. [Google Scholar] [CrossRef] [PubMed]
- Arafah, A.; Rehman, M.U.; Ahmad, A.; AlKharfy, K.M.; Alqahtani, S.; Jan, B.L.; Almatroudi, N.M. Myricetin (3,3′,4′,5,5′,7-Hexahydroxyflavone) Prevents 5-Fluorouracil-Induced Cardiotoxicity. ACS Omega 2022, 7, 4514–4524. [Google Scholar] [CrossRef] [PubMed]
- Fu, Y.S.; Duan, X.Q.; Cheng, K.R.; Yan Yan, F.; Liu, L.; Duan, H.D.; Hu, Q.; Xia, S.L.; Wang, X.R.; Cheng, Z.F. Geraniol relieves mycoplasma pneumonia infection-induced lung injury in mice through the regulation of ERK/JNK and NF-κB signaling pathways. J. Biochem. Mol. Toxicol. 2022, e22984. [Google Scholar] [CrossRef]
- Ozkaya, A.; Sahin, Z.; Gorgulu, A.O.; Yuce, A.; Celik, S. Geraniol attenuates hydrogen peroxide-induced liver fatty acid alterations in male rats. J. Intercult. Ethnopharmacol. 2017, 6, 29–35. [Google Scholar] [CrossRef]
- Nezu, M.; Suzuki, N. Roles of Nrf2 in Protecting the Kidney from Oxidative Damage. Int. J. Mol. Sci. 2020, 21, 2951. [Google Scholar] [CrossRef]
- Wu, J.; Xu, L.; Sun, C.; Zhang, B.; Li, J.; Sun, J.; Zhang, Y.; Sun, D. Paeonol alleviates epirubicin-induced renal injury in mice by regulating Nrf2 and NF-κB pathways. Eur. J. Pharmacol. 2017, 795, 84–93. [Google Scholar] [CrossRef]
- Sutariya, B.; Saraf, M. α-asarone reduce proteinuria by restoring antioxidant enzymes activities and regulating necrosis factor κB signaling pathway in doxorubicin-induced nephrotic syndrome. Biomed. Pharmacother. 2018, 98, 318–324. [Google Scholar] [CrossRef]
- Soltani Hekmat, A.; Chenari, A.; Alipanah, H.; Javanmardi, K. Protective effect of alamandine on doxorubicin-induced nephrotoxicity in rats. BMC Pharmacol. Toxicol. 2021, 22, 31. [Google Scholar] [CrossRef]
- Vyas, D.; Laput, G.; Vyas, A.K. Chemotherapy-enhanced inflammation may lead to the failure of therapy and metastasis. OncoTargets Ther. 2014, 7, 1015–1023. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Somade, O.T.; Ajayi, B.O.; Safiriyu, O.A.; Oyabunmi, O.S.; Akamo, A.J. Renal and testicular up-regulation of pro-inflammatory chemokines (RANTES and CCL2) and cytokines (TNF-α, IL-1β, IL-6) following acute edible camphor administration is through activation of NF-kB in rats. Toxicol. Rep. 2019, 6, 759–767. [Google Scholar] [CrossRef]
- Guo, N.F.; Cao, Y.J.; Chen, X.; Zhang, Y.; Fan, Y.P.; Liu, J.; Chen, X.L. Lixisenatide protects doxorubicin-induced renal fibrosis by activating wNF-κB/TNF-α and TGF-β/Smad pathways. Eur. Rev. Med. Pharmacol. Sci. 2019, 23, 4017–4026. [Google Scholar] [CrossRef] [PubMed]
- Liu, X.; Chua, C.C.; Gao, J.; Chen, Z.; Landy, C.L.; Hamdy, R.; Chua, B.H. Pifithrin-alpha protects against doxorubicin-induced apoptosis and acute cardiotoxicity in mice. Am. J. Physiol. Heart Circ. Physiol. 2004, 286, H933–H939. [Google Scholar] [CrossRef] [PubMed] [Green Version]
Gene | Primer Sequences (5′→3′) Forward | Primer Sequences (5′→3′) Reverse | Reference |
---|---|---|---|
NRF2 | CACATCCAGACAGACACCAGT | CTACAAATGGGAATGTCTCTGC | Manually designed |
HO-1 | ACAGGGTGACAGAAGAGGCTAA | CTGTGAGGGACTCTGGTCTTTG | Manually designed |
SOD-2 | TTCGTTTCCTGCGGCGGCTT | TTCAGCACGCACACGGCCTT | Manually designed |
GPx-1 | AGTTCGGACATCAGGAGAATGGCA | TCACCATTCACCTCGCACTTCTCA | Manually designed |
GAPDH | TCTGCTCCTCCCTGTTCTAGAGACA | TTGTGAGGGAGATGCTCAGTGTTGG | Manually designed |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
AlAsmari, A.F.; Ali, N.; Alharbi, M.; Alqahtani, F.; Alasmari, F.; Almoqbel, D.; AlSwayyed, M.; Alshammari, A.; Alanazi, M.M.; Alhoshani, A.; et al. Geraniol Ameliorates Doxorubicin-Mediated Kidney Injury through Alteration of Antioxidant Status, Inflammation, and Apoptosis: Potential Roles of NF-κB and Nrf2/Ho-1. Nutrients 2022, 14, 1620. https://doi.org/10.3390/nu14081620
AlAsmari AF, Ali N, Alharbi M, Alqahtani F, Alasmari F, Almoqbel D, AlSwayyed M, Alshammari A, Alanazi MM, Alhoshani A, et al. Geraniol Ameliorates Doxorubicin-Mediated Kidney Injury through Alteration of Antioxidant Status, Inflammation, and Apoptosis: Potential Roles of NF-κB and Nrf2/Ho-1. Nutrients. 2022; 14(8):1620. https://doi.org/10.3390/nu14081620
Chicago/Turabian StyleAlAsmari, Abdullah F., Nemat Ali, Metab Alharbi, Faleh Alqahtani, Fawaz Alasmari, Daad Almoqbel, Mohammed AlSwayyed, Abdulrahman Alshammari, Mohammed M. Alanazi, Ali Alhoshani, and et al. 2022. "Geraniol Ameliorates Doxorubicin-Mediated Kidney Injury through Alteration of Antioxidant Status, Inflammation, and Apoptosis: Potential Roles of NF-κB and Nrf2/Ho-1" Nutrients 14, no. 8: 1620. https://doi.org/10.3390/nu14081620