Glucoraphanin Increases Intracellular Hydrogen Sulfide (H2S) Levels and Stimulates Osteogenic Differentiation in Human Mesenchymal Stromal Cell
Abstract
1. Introduction
2. Materials and Methods
2.1. Extraction, Isolation and Characterization of GRA from Seeds
2.2. Determination of H2S Release in Buffer by Amperometric Assay
2.3. Patients
2.4. Cell Isolation and Culture
2.5. Measurement of H2S in hMSCs Cell Culture
2.6. Osteogenic Differentiation and Alizarin Red Staining
2.7. Quantification of Gene Expression by Real-Time PCR
2.8. Statistical Analyses
3. Results
3.1. GRA Increases Intracellular H2S Levels in hMSCs
3.2. GRA Increases Mineralization in Osteogenic Cultures of hMSCs
3.3. GRA Stimulates Expression of Osteogenic Markers in hMSCs
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Movassagh, E.Z.; Vatanparast, H. Current Evidence on the Association of Dietary Patterns and Bone Health: A Scoping Review. Adv. Nutr. 2017, 8, 1–16. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Benetou, V.; Orfanos, P.; Feskanich, D.; Michaelsson, K.; Pettersson-Kymmer, U.; Byberg, L.; Eriksson, S.; Grodstein, F.; Wolk, A.; Jankovic, N.; et al. Mediterranean diet and hip fracture incidence among older adults: The CHANCES project. Osteoporos. Int. 2018, 29, 1591–1599. [Google Scholar] [CrossRef] [Scilit]
- Benetou, V.; Orfanos, P.; Pettersson-Kymmer, U.; Bergstrom, U.; Svensson, O.; Johansson, I.; Berrino, F.; Tumino, R.; Borch, K.B.; Lund, E.; et al. Mediterranean diet and incidence of hip fractures in a European cohort. Osteoporos. Int. 2013, 24, 1587–1598. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Blekkenhorst, L.C.; Hodgson, J.M.; Lewis, J.R.; Devine, A.; Woodman, R.J.; Lim, W.H.; Wong, G.; Zhu, K.; Bondonno, C.P.; Ward, N.C.; et al. Vegetable and Fruit Intake and Fracture-Related Hospitalisations: A Prospective Study of Older Women. Nutrients 2017, 9, 511. [Google Scholar] [CrossRef] [Scilit]
- Byberg, L.; Bellavia, A.; Orsini, N.; Wolk, A.; Michaelsson, K. Fruit and vegetable intake and risk of hip fracture: A cohort study of Swedish men and women. J. Bone Miner. Res. 2015, 30, 976–984. [Google Scholar] [CrossRef] [Scilit]
- Tucker, K.L.; Chen, H.; Hannan, M.T.; Cupples, L.A.; Wilson, P.W.; Felson, D.; Kiel, D.P. Bone mineral density and dietary patterns in older adults: The Framingham Osteoporosis Study. Am. J. Clin. Nutr. 2002, 76, 245–252. [Google Scholar] [CrossRef] [Scilit]
- Prieto, M.A.; Lopez, C.J.; Simal-Gandara, J. Glucosinolates: Molecular structure, breakdown, genetic, bioavailability, properties and healthy and adverse effects. Adv. Food Nutr. Res. 2019, 90, 305–350. [Google Scholar] [CrossRef] [Scilit]
- Angelino, D.; Dosz, E.B.; Sun, J.; Hoeflinger, J.L.; Van Tassell, M.L.; Chen, P.; Harnly, J.M.; Miller, M.J.; Jeffery, E.H. Myrosinase-dependent and -independent formation and control of isothiocyanate products of glucosinolate hydrolysis. Front. Plant. Sci. 2015, 6, 831. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Luang-In, V.; Narbad, A.; Nueno-Palop, C.; Mithen, R.; Bennett, M.; Rossiter, J.T. The metabolism of methylsulfinylalkyl- and methylthioalkyl-glucosinolates by a selection of human gut bacteria. Mol. Nutr. Food Res. 2014, 58, 875–883. [Google Scholar] [CrossRef] [Scilit]
- Blekkenhorst, L.C.; Bondonno, C.P.; Lewis, J.R.; Devine, A.; Zhu, K.; Lim, W.H.; Woodman, R.J.; Beilin, L.J.; Prince, R.L.; Hodgson, J.M. Cruciferous and Allium Vegetable Intakes are Inversely Associated With 15-Year Atherosclerotic Vascular Disease Deaths in Older Adult Women. J. Am. Heart Assoc. 2017, 6, e006558. [Google Scholar] [CrossRef] [Scilit]
- Zhang, Z.; Garzotto, M.; Davis, E.W.; Mori, M.; Stoller, W.A.; Farris, P.E.; Wong, C.P.; Beaver, L.M.; Thomas, G.V.; Williams, D.E.; et al. Sulforaphane Bioavailability and Chemopreventive Activity in Men Presenting for Biopsy of the Prostate Gland: A Randomized Controlled Trial. Nutr. Cancer 2020, 72, 74–87. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Connolly, E.L.; Sim, M.; Travica, N.; Marx, W.; Beasy, G.; Lynch, G.S.; Bondonno, C.P.; Lewis, J.R.; Hodgson, J.M.; Blekkenhorst, L.C. Glucosinolates From Cruciferous Vegetables and Their Potential Role in Chronic Disease: Investigating the Preclinical and Clinical Evidence. Front. Pharmacol. 2021, 12, 767975. [Google Scholar] [CrossRef] [Scilit]
- Marino, M.; Martini, D.; Venturi, S.; Tucci, M.; Porrini, M.; Riso, P.; Del Bo, C. An Overview of Registered Clinical Trials on Glucosinolates and Human Health: The Current Situation. Front. Nutr. 2021, 8, 730906. [Google Scholar] [CrossRef] [Scilit]
- West, L.G.; Meyer, K.A.; Balch, B.A.; Rossi, F.J.; Schultz, M.R.; Haas, G.W. Glucoraphanin and 4-hydroxyglucobrassicin contents in seeds of 59 cultivars of broccoli, raab, kohlrabi, radish, cauliflower, brussels sprouts, kale, and cabbage. J. Agric. Food Chem. 2004, 52, 916–926. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- De Nicola, G.R.; Rollin, P.; Mazzon, E.; Iori, R. Novel gram-scale production of enantiopure R-sulforaphane from Tuscan black kale seeds. Molecules 2014, 19, 6975–6986. [Google Scholar] [CrossRef] [Scilit]
- Zhang, Y.; Talalay, P.; Cho, C.G.; Posner, G.H. A major inducer of anticarcinogenic protective enzymes from broccoli: Isolation and elucidation of structure. Proc. Natl. Acad. Sci. USA 1992, 89, 2399–2403. [Google Scholar] [CrossRef] [Scilit]
- Li, D.; Shao, R.; Wang, N.; Zhou, N.; Du, K.; Shi, J.; Wang, Y.; Zhao, Z.; Ye, X.; Zhang, X.; et al. Sulforaphane Activates a lysosome-dependent transcriptional program to mitigate oxidative stress. Autophagy 2021, 17, 872–887. [Google Scholar] [CrossRef] [Scilit]
- Gasparello, J.; D’Aversa, E.; Papi, C.; Gambari, L.; Grigolo, B.; Borgatti, M.; Finotti, A.; Gambari, R. Sulforaphane inhibits the expression of interleukin-6 and interleukin-8 induced in bronchial epithelial IB3-1 cells by exposure to the SARS-CoV-2 Spike protein. Phytomedicine 2021, 87, 153583. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Ruhee, R.T.; Suzuki, K. The Integrative Role of Sulforaphane in Preventing Inflammation, Oxidative Stress and Fatigue: A Review of a Potential Protective Phytochemical. Antioxidants 2020, 9, 521. [Google Scholar] [CrossRef] [Scilit]
- Gasparello, J.; Gambari, L.; Papi, C.; Rozzi, A.; Manicardi, A.; Corradini, R.; Gambari, R.; Finotti, A. High Levels of Apoptosis Are Induced in the Human Colon Cancer HT-29 Cell Line by Co-Administration of Sulforaphane and a Peptide Nucleic Acid Targeting miR-15b-5p. Nucleic Acid Ther. 2020, 30, 164–174. [Google Scholar] [CrossRef] [Scilit]
- Yagishita, Y.; Fahey, J.W.; Dinkova-Kostova, A.T.; Kensler, T.W. Broccoli or Sulforaphane: Is It the Source or Dose That Matters? Molecules 2019, 24, 3593. [Google Scholar] [CrossRef] [Scilit]
- Parfenova, H.; Liu, J.; Hoover, D.T.; Fedinec, A.L. Vasodilator effects of sulforaphane in cerebral circulation: A critical role of endogenously produced hydrogen sulfide and arteriolar smooth muscle KATP and BK channels in the brain. J. Cereb. Blood Flow Metab. 2020, 40, 1987–1996. [Google Scholar] [CrossRef] [Scilit]
- Pei, Y.; Wu, B.; Cao, Q.; Wu, L.; Yang, G. Hydrogen sulfide mediates the anti-survival effect of sulforaphane on human prostate cancer cells. Toxicol. Appl. Pharmacol. 2011, 257, 420–428. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Lucarini, E.; Micheli, L.; Trallori, E.; Citi, V.; Martelli, A.; Testai, L.; De Nicola, G.R.; Iori, R.; Calderone, V.; Ghelardini, C.; et al. Effect of glucoraphanin and sulforaphane against chemotherapy-induced neuropathic pain: Kv7 potassium channels modulation by H2 S release in vivo. Phytother. Res. 2018, 32, 2226–2234. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Abe, K.; Kimura, H. The possible role of hydrogen sulfide as an endogenous neuromodulator. J. Neurosci. 1996, 16, 1066–1071. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Olson, K.R. H2S and polysulfide metabolism: Conventional and unconventional pathways. Biochem. Pharmacol. 2018, 149, 77–90. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Martelli, A.; Piragine, E.; Citi, V.; Testai, L.; Pagnotta, E.; Ugolini, L.; Lazzeri, L.; Di Cesare Mannelli, L.; Manzo, O.L.; Bucci, M.; et al. Erucin exhibits vasorelaxing effects and antihypertensive activity by H2S-releasing properties. Br. J. Pharmacol. 2020, 177, 824–835. [Google Scholar] [CrossRef] [Scilit]
- Yang, G.; Wu, L.; Jiang, B.; Yang, W.; Qi, J.; Cao, K.; Meng, Q.; Mustafa, A.K.; Mu, W.; Zhang, S.; et al. H2S as a physiologic vasorelaxant: Hypertension in mice with deletion of cystathionine gamma-lyase. Science 2008, 322, 587–590. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Di Cesare Mannelli, L.; Lucarini, E.; Micheli, L.; Mosca, I.; Ambrosino, P.; Soldovieri, M.V.; Martelli, A.; Testai, L.; Taglialatela, M.; Calderone, V.; et al. Effects of natural and synthetic isothiocyanate-based H2S-releasers against chemotherapy-induced neuropathic pain: Role of Kv7 potassium channels. Neuropharmacology 2017, 121, 49–59. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Kida, K.; Marutani, E.; Nguyen, R.K.; Ichinose, F. Inhaled hydrogen sulfide prevents neuropathic pain after peripheral nerve injury in mice. Nitric Oxide 2015, 46, 87–92. [Google Scholar] [CrossRef] [Scilit]
- Elrod, J.W.; Calvert, J.W.; Morrison, J.; Doeller, J.E.; Kraus, D.W.; Tao, L.; Jiao, X.; Scalia, R.; Kiss, L.; Szabo, C.; et al. Hydrogen sulfide attenuates myocardial ischemia-reperfusion injury by preservation of mitochondrial function. Proc. Natl. Acad. Sci. USA 2007, 104, 15560–15565. [Google Scholar] [CrossRef] [Scilit]
- Xue, R.; Hao, D.D.; Sun, J.P.; Li, W.W.; Zhao, M.M.; Li, X.H.; Chen, Y.; Zhu, J.H.; Ding, Y.J.; Liu, J.; et al. Hydrogen sulfide treatment promotes glucose uptake by increasing insulin receptor sensitivity and ameliorates kidney lesions in type 2 diabetes. Antioxid. Redox Signal. 2013, 19, 5–23. [Google Scholar] [CrossRef] [Scilit]
- Hine, C.; Harputlugil, E.; Zhang, Y.; Ruckenstuhl, C.; Lee, B.C.; Brace, L.; Longchamp, A.; Trevino-Villarreal, J.H.; Mejia, P.; Ozaki, C.K.; et al. Endogenous hydrogen sulfide production is essential for dietary restriction benefits. Cell 2015, 160, 132–144. [Google Scholar] [CrossRef] [Scilit]
- Hine, C.; Mitchell, J.R. Calorie restriction and methionine restriction in control of endogenous hydrogen sulfide production by the transsulfuration pathway. Exp. Gerontol. 2015, 68, 26–32. [Google Scholar] [CrossRef] [Scilit]
- Grassi, F.; Tyagi, A.M.; Calvert, J.W.; Gambari, L.; Walker, L.D.; Yu, M.; Robinson, J.; Li, J.Y.; Lisignoli, G.; Vaccaro, C.; et al. Hydrogen Sulfide Is a Novel Regulator of Bone Formation Implicated in the Bone Loss Induced by Estrogen Deficiency. J. Bone Miner. Res. 2016, 31, 949–963. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Liu, Y.; Yang, R.; Liu, X.; Zhou, Y.; Qu, C.; Kikuiri, T.; Wang, S.; Zandi, E.; Du, J.; Ambudkar, I.S.; et al. Hydrogen sulfide maintains mesenchymal stem cell function and bone homeostasis via regulation of Ca2+ channel sulfhydration. Cell Stem Cell 2014, 15, 66–78. [Google Scholar] [CrossRef] [Scilit]
- Gambari, L.; Lisignoli, G.; Cattini, L.; Manferdini, C.; Facchini, A.; Grassi, F. Sodium hydrosulfide inhibits the differentiation of osteoclast progenitor cells via NRF2-dependent mechanism. Pharmacol. Res. 2014, 87, 99–112. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Lee, S.K.; Chung, J.H.; Choi, S.C.; Auh, Q.S.; Lee, Y.M.; Lee, S.I.; Kim, E.C. Sodium hydrogen sulfide inhibits nicotine and lipopolysaccharide-induced osteoclastic differentiation and reversed osteoblastic differentiation in human periodontal ligament cells. J. Cell Biochem. 2013, 114, 1183–1193. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Ma, J.; Shi, C.; Liu, Z.; Han, B.; Guo, L.; Zhu, L.; Ye, T. Hydrogen sulfide is a novel regulator implicated in glucocorticoids-inhibited bone formation. Aging 2019, 11, 7537–7552. [Google Scholar] [CrossRef] [Scilit]
- Citi, V.; Martelli, A.; Testai, L.; Marino, A.; Breschi, M.C.; Calderone, V. Hydrogen sulfide releasing capacity of natural isothiocyanates: Is it a reliable explanation for the multiple biological effects of Brassicaceae? Planta Med. 2014, 80, 610–613. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Martelli, A.; Citi, V.; Testai, L.; Brogi, S.; Calderone, V. Organic Isothiocyanates as Hydrogen Sulfide Donors. Antioxid. Redox Signal. 2020, 32, 110–144. [Google Scholar] [CrossRef] [Scilit]
- Barillari, J.; Gueyrard, D.; Rollin, P.; Iori, R. Barbarea verna as a source of 2-phenylethyl glucosinolate, precursor of cancer chemopreventive phenylethyl isothiocyanate. Fitoterapia 2001, 72, 760–764. [Google Scholar] [CrossRef] [Scilit]
- Rapposelli, S.; Gambari, L.; Digiacomo, M.; Citi, V.; Lisignoli, G.; Manferdini, C.; Calderone, V.; Grassi, F. A Novel H2S-releasing Amino-Bisphosphonate which combines bone anti-catabolic and anabolic functions. Sci. Rep. 2017, 7, 11940. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Gambari, L.; Lisignoli, G.; Gabusi, E.; Manferdini, C.; Paolella, F.; Piacentini, A.; Grassi, F. Distinctive expression pattern of cystathionine-beta-synthase and cystathionine-gamma-lyase identifies mesenchymal stromal cells transition to mineralizing osteoblasts. J. Cell Physiol. 2017, 232, 3574–3585. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Peng, B.; Chen, W.; Liu, C.; Rosser, E.W.; Pacheco, A.; Zhao, Y.; Aguilar, H.C.; Xian, M. Fluorescent probes based on nucleophilic substitution-cyclization for hydrogen sulfide detection and bioimaging. Chemistry 2014, 20, 1010–1016. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Gambari, L.; Grigolo, B.; Filardo, G.; Grassi, F. Sulfurous thermal waters stimulate the osteogenic differentiation of human mesenchymal stromal cells—An in vitro study. Biomed. Pharmacother. 2020, 129, 110344. [Google Scholar] [CrossRef] [Scilit]
- Liu, R.H. Health-promoting components of fruits and vegetables in the diet. Adv. Nutr. 2013, 4, 384S–392S. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Agerbirk, N.; Olsen, C.E. Glucosinolate structures in evolution. Phytochemistry 2012, 77, 16–45. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Sim, M.; Blekkenhorst, L.C.; Lewis, J.R.; Bondonno, C.P.; Devine, A.; Zhu, K.; Woodman, R.J.; Prince, R.L.; Hodgson, J.M. Vegetable and fruit intake and injurious falls risk in older women: A prospective cohort study. Br. J. Nutr. 2018, 120, 925–934. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Benavides, G.A.; Squadrito, G.L.; Mills, R.W.; Patel, H.D.; Isbell, T.S.; Patel, R.P.; Darley-Usmar, V.M.; Doeller, J.E.; Kraus, D.W. Hydrogen sulfide mediates the vasoactivity of garlic. Proc. Natl. Acad. Sci. USA 2007, 104, 17977–17982. [Google Scholar] [CrossRef] [Scilit]
- Martelli, A.; Testai, L.; Citi, V.; Marino, A.; Bellagambi, F.G.; Ghimenti, S.; Breschi, M.C.; Calderone, V. Pharmacological characterization of the vascular effects of aryl isothiocyanates: Is hydrogen sulfide the real player? Vascul. Pharmacol. 2014, 60, 32–41. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Angelino, D.; Jeffery, E. Glucosinolate hydrolysis and bioavailability of resulting isothiocyanates: Focus on glucoraphanin. J. Funct. Foods 2014, 7, 67–76. [Google Scholar] [CrossRef] [Scilit]
- Sivapalan, T.; Melchini, A.; Saha, S.; Needs, P.W.; Traka, M.H.; Tapp, H.; Dainty, J.R.; Mithen, R.F. Bioavailability of Glucoraphanin and Sulforaphane from High-Glucoraphanin Broccoli. Mol. Nutr. Food Res. 2018, 62, e1700911. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Thaler, R.; Maurizi, A.; Roschger, P.; Sturmlechner, I.; Khani, F.; Spitzer, S.; Rumpler, M.; Zwerina, J.; Karlic, H.; Dudakovic, A.; et al. Anabolic and Antiresorptive Modulation of Bone Homeostasis by the Epigenetic Modulator Sulforaphane, a Naturally Occurring Isothiocyanate. J. Biol. Chem. 2016, 291, 6754–6771. [Google Scholar] [CrossRef] [Scilit]
- Luo, T.; Fu, X.; Liu, Y.; Ji, Y.; Shang, Z. Sulforaphane Inhibits Osteoclastogenesis via Suppression of the Autophagic Pathway. Molecules 2021, 26, 347. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Cramer, J.M.; Teran-Garcia, M.; Jeffery, E.H. Enhancing sulforaphane absorption and excretion in healthy men through the combined consumption of fresh broccoli sprouts and a glucoraphanin-rich powder. Br. J. Nutr. 2012, 107, 1333–1338. [Google Scholar] [CrossRef] [Scilit]
- Jeong, J.; Park, H.; Hyun, H.; Kim, J.; Kim, H.; Oh, H.I.; Hwang, H.S.; Kim, D.K.; Kim, H.H. Effects of Glucosinolates from Turnip (Brassica rapa L.) Root on Bone Formation by Human Osteoblast-Like MG-63 Cells and in Normal Young Rats. Phytother. Res. 2015, 29, 902–909. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Wei, L.; Liu, C.; Zheng, H.; Zheng, L. Melatonin treatment affects the glucoraphanin-sulforaphane system in postharvest fresh-cut broccoli (Brassica oleracea L.). Food Chem. 2020, 307, 125562. [Google Scholar] [CrossRef] [Scilit]
- Augustine, R.; Bisht, N.C. Biofortification of oilseed Brassica juncea with the anti-cancer compound glucoraphanin by suppressing GSL-ALK gene family. Sci. Rep. 2015, 5, 18005. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Mirza, N.; Crocoll, C.; Erik Olsen, C.; Ann Halkier, B. Engineering of methionine chain elongation part of glucoraphanin pathway in E. coli. Metab. Eng. 2016, 35, 31–37. [Google Scholar] [CrossRef] [Scilit]





| Gene | Protein | 5′-Sequence-3′ | Product Size (bp) | Accession Number | |
|---|---|---|---|---|---|
| GAPDH | Glyceraldehyde-3 phosphate dehydrogenase | FW | CGGAGTCAACGGATTTGG | 218 | NM_002046 |
| REV | CCTGGAAGATGGTGATGG | ||||
| CBS | Cystathionine-β-synthase | FW | AATGGTGACGCTTGGGAA | 107 | NM_000071 |
| REV | TGAGGCGGATCTGTTTGA | ||||
| CTH | Cystathionine-γ-lyase | FW | AAGACGCCTCCTCACAAGGT | 170 | NM_001902 |
| REV | ATATTCAAAACCCGAGTGCTGG | ||||
| ALP | Alkaline phosphatase | FW | GGAAGACACTCTGACCGT | 152 | NM_000478 |
| REV | GCC CAT TGC CAT ACA GGA | ||||
| BSP | Bone sialoprotein | FW | CAGTAGTGACTCATCCGAAG | 158 | NM_004967 |
| REV | CATAGCCCAGTGTTGTAGCA | ||||
| WNT16 | Wnt Family Member 16 | FW | GCCAGTTCAGACACGAGAGA | 140 | NM_057168 |
| REV | TGCAGCCATCACAGCATAAA | ||||
| SMAD1 | SMAD Family Member 1 | FW | CACCCGTTTCCTCACTCTCC | 257 | NM_005900 |
| REV | TCCTCATAAGCAACCGCCTG | ||||
| WISP1 | WNT1-inducible-signalling pathway protein 1 | FW | ACACGCTCCTATCAACCCAAG | 103 | NM_003882 |
| REV | CATCAGGACACTGGAAGGACA |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Gambari, L.; Barone, M.; Amore, E.; Grigolo, B.; Filardo, G.; Iori, R.; Citi, V.; Calderone, V.; Grassi, F. Glucoraphanin Increases Intracellular Hydrogen Sulfide (H2S) Levels and Stimulates Osteogenic Differentiation in Human Mesenchymal Stromal Cell. Nutrients 2022, 14, 435. https://doi.org/10.3390/nu14030435
Gambari L, Barone M, Amore E, Grigolo B, Filardo G, Iori R, Citi V, Calderone V, Grassi F. Glucoraphanin Increases Intracellular Hydrogen Sulfide (H2S) Levels and Stimulates Osteogenic Differentiation in Human Mesenchymal Stromal Cell. Nutrients. 2022; 14(3):435. https://doi.org/10.3390/nu14030435
Chicago/Turabian StyleGambari, Laura, Marli Barone, Emanuela Amore, Brunella Grigolo, Giuseppe Filardo, Renato Iori, Valentina Citi, Vincenzo Calderone, and Francesco Grassi. 2022. "Glucoraphanin Increases Intracellular Hydrogen Sulfide (H2S) Levels and Stimulates Osteogenic Differentiation in Human Mesenchymal Stromal Cell" Nutrients 14, no. 3: 435. https://doi.org/10.3390/nu14030435
APA StyleGambari, L., Barone, M., Amore, E., Grigolo, B., Filardo, G., Iori, R., Citi, V., Calderone, V., & Grassi, F. (2022). Glucoraphanin Increases Intracellular Hydrogen Sulfide (H2S) Levels and Stimulates Osteogenic Differentiation in Human Mesenchymal Stromal Cell. Nutrients, 14(3), 435. https://doi.org/10.3390/nu14030435

