Comparison of Selenium-Enriched Lactobacillusparacasei, Selenium-Enriched Yeast, and Selenite for the Alleviation of DSS-Induced Colitis in Mice
Abstract
1. Introduction
2. Materials and Methods
2.1. Preparation of Se-Enriched Probiotic
2.2. Determination of Se Concentration and Analysis of Se Form
2.3. Animal Experiment Design
2.4. Assessment of the Severity of Colitis
2.5. Examination of Oxidative Activity and Level of Cytokines in Colon Tissue via Assays
2.6. Extraction of Total RNA of Colon and Quantitative Polymerase Chain Reaction (qPCR)
2.7. Determination of Serum Biochemical Indices
2.8. Measurement of Se Concentration in Liver and Ileum
2.9. Statistical Analysis
3. Results
3.1. Data of Se-Enriched Products
3.2. Se-Enriched Products Affect the Symptoms of Colitis in Mice
3.3. Se-Enriched Products Ameliorate Inflammatory Injury Caused by DSS in Mice
3.4. Se Concentration in Liver and Ileum
3.5. Se-Enriched Products Reduce Oxidative Stress in Mice
3.6. Se-Enriched Products Regulate Inflammatory Cytokines in Mice
3.7. Blood Biochemical Assay
3.8. Effect of Se-Enriched Products on Tight Junction Protein Expression
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Kang, E.A.; Choi, H.I.; Hong, S.W.; Kang, S.; Jegal, H.Y.; Choi, E.W.; Park, B.S.; Kim, J.S. Extracellular Vesicles Derived from Kefir Grain Lactobacillus Ameliorate Intestinal Inflammation via Regulation of Proinflammatory Pathway and Tight Junction Integrity. Biomedicines 2020, 8, 522. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Burisch, J.; Jess, T.; Martinato, M.; Lakatos, P.L.; EpiCom, E. The burden of inflammatory bowel disease in Europe. J. Crohns Colitis 2013, 7, 322–337. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Geerling, B.J.; Badart-smook, A.; Stockbrugger, R.W.; Brummer, R.J.M. Comprehensive nutritional status in recently diagnosed patients with inflammatory bowel disease compared with population controls. Eur. J. Clin. Nutr. 2000, 54, 514–521. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Fukuda, S.; Toh, H.; Hase, K.; Oshima, K.; Nakanishi, Y.; Yoshimura, K.; Tobe, T.; Clarke, J.M.; Topping, D.L.; Suzuki, T.; et al. Bifidobacteria can protect from enteropathogenic infection through production of acetate. Nature 2011, 469, 543–547. [Google Scholar] [CrossRef] [Scilit]
- Ramos, L.R.; Dimaio, C.J.; Sachar, D.B.; Atreja, A.; Colombel, J.-F.; Torres, J. Autoimmune pancreatitis and inflammatory bowel disease: Case series and review of the literature. Dig. Liver Dis. 2016, 48, 893–898. [Google Scholar] [CrossRef] [Scilit]
- Melo, F.J.; Magina, S. Clinical management of Anti-TNF-alpha-induced psoriasis or psoriasiform lesions in inflammatory bowel disease patients: A systematic review. Int. J. Dermatol. 2018, 57, 1521–1532. [Google Scholar] [CrossRef] [Scilit]
- Ghadirian, P.; Maisonneuve, P.; Perret, C.; Kennedy, G.; Boyle, P.; Krewski, D.; Lacroix, A. A case-control study of toenail selenium and cancer of the breast, colon, and prostate. Cancer Detect. Prev. 2000, 24, 305–313. [Google Scholar]
- Ishida, T.; Himeno, K.; Torigoe, Y.; Inoue, M.; Wakisaka, O.; Tabuki, T.; Ono, H.; Honda, K.; Mori, T.; Seike, M.; et al. Selenium deficiency in a patient with Crohn’s disease receiving long-term total parenteral nutrition. Intern. Med. 2003, 42, 154–157. [Google Scholar] [CrossRef] [Scilit]
- Shi, C.; Yue, F.; Shi, F.; Qin, Q.; Wang, L.; Wang, G.; Mu, L.; Liu, D.; Li, Y.; Yu, T.; et al. Selenium-Containing Amino Acids Protect Dextran Sulfate Sodium-Induced Colitis via Ameliorating Oxidative Stress and Intestinal Inflammation. J. Inflamm. Res. 2021, 14, 85–95. [Google Scholar] [CrossRef] [Scilit]
- Bailey, R.T. Review: Selenium contamination, fate, and reactive transport in groundwater in relation to human health. Hydrogeol. J. 2017, 25, 1191–1217. [Google Scholar] [CrossRef] [Scilit]
- Chaudhary, M.; Garg, A.K.; Mittal, G.K.; Mudgal, V. Effect of Organic Selenium Supplementation on Growth, Se Uptake, and Nutrient Utilization in Guinea Pigs. Biol. Trace Elem. Res. 2010, 133, 217–226. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Mahn, D.C.; Cline, T.R.; Richert, B. Effects of dietary levels of selenium-enriched yeast and sodium selenite as selenium sources fed to growing-finishing pigs on performance, tissue selenium, serum glutathione peroxidase activity, carcass characteristics, and loin quality. J. Anim. Sci. 1999, 77, 2172–2179. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Utterback, P.L.; Parsons, C.M.; Yoon, I.; Butler, J. Effect of supplementing selenium yeast in diets of laying hens on egg selenium content. Poult. Sci. 2005, 84, 1900–1901. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Wu, Z.Y.; Pan, D.; Jiang, M.; Sang, L.; Chang, B. Selenium-Enriched Lactobacillus acidophilus Ameliorates Dextran Sulfate Sodium-Induced Chronic Colitis in Mice by Regulating Inflammatory Cytokines and Intestinal Microbiota. Front. Med. 2021, 8, 1–12. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Amoako, P.O.; Uden, P.C.; Tyson, J.F. Speciation of selenium dietary supplements; formation of S-(methylseleno)cysteine and other selenium compounds. Anal. Chim. Acta 2009, 652, 315–323. [Google Scholar] [CrossRef] [Scilit]
- Labunskyy, V.M.; Hatfield, D.L.; Gladyshev, V.N. Selenoproteins: Molecular Pathways and Physiological Roles. Physiol. Rev. 2014, 94, 739–777. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Kryukov, G.V.; Castellano, S.; Novoselov, S.V.; Lobanov, A.V.; Zehtab, O.; Guigó, R.; Gladyshev, V.N. Characterization of mammalian selenoproteomes. Science 2003, 300, 1439–1443. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Varlamova, E.G. The Role of Selenium and Selenocysteine-Containing Proteins in Mammalian Male Reproductive System. Biophysics 2016, 61, 686–691. [Google Scholar] [CrossRef] [Scilit]
- Fomenko, D.E.; Xing, W.B.; Aadir, B.M.; Thomas, D.J.; Gladyshev, V.N. High-throughput identification of catalytic redox-active cysteine residues. Science 2007, 315, 387–389. [Google Scholar] [CrossRef] [Scilit]
- Livio, S.; Strockbine, N.A.; Panchalingam, S.; Tennant, S.M.; Barry, E.M.; Marohn, M.E.; Antonio, M.; Hossain, A.; Mandomando, I.; Ochieng, J.B.; et al. Shigella Isolates from the Global Enteric Multicenter Study Inform Vaccine Development. Clin. Infect. Dis. 2014, 59, 933–941. [Google Scholar] [CrossRef] [Scilit]
- Li, J.H.; Yang, W.P.; Guo, A.N.; Qi, Z.W.; Chen, J.; Huang, T.M.; Yang, Z.P.; Gao, Z.Q.; Sun, M.; Wang, J.W. Combined foliar and soil selenium fertilizer increased the grain yield, quality, total se, and organic Se content in naked oats. J. Cereal Sci. 2021, 100, 1–8. [Google Scholar] [CrossRef] [Scilit]
- Pescuma, M.; Gomez-Ggomez, B.; Perez-Corona, T.; Font, G.; Madrid, Y.; Mozzi, F. Food prospects of selenium enriched-Lactobacillus acidophilus CRL 636 and Lactobacillus reuteri CRL 1101. J. Funct. Foods 2017, 35, 466–473. [Google Scholar] [CrossRef] [Scilit]
- Zhu, X.K.; Jiang, M.D.; Song, E.Q.; Jiang, X.J.; Song, Y. Selenium deficiency sensitizes the skin for UVB-induced oxidative damage and inflammation which involved the activation of p38 MAPK signaling. Food Chem. Toxicol. 2015, 75, 139–145. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Zheng, Z.Q.; Liu, L.J.; Zhou, K.W.; Ding, L.; Zeng, J.Y.; Zhang, W. Anti-Oxidant and Anti-Endothelial Dysfunctional Properties of Nano-Selenium in vitro and in vivo of Hyperhomocysteinemic Rats. Int. J. Nanomed. 2020, 15, 4501–4521. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Mallick, E.M.; Mcbee, M.E.; Vanguri, V.K.; Melton-Celsa, A.R.; Schlieper, K.; Karalius, B.J.; O’Brien, A.D.; Butterton, J.R.; Leong, J.M.; Schauer, D.B. A novel murine infection model for Shiga toxin-producing Escherichia coli. J. Clin. Investig. 2012, 122, 4012–4024. [Google Scholar] [CrossRef] [Scilit]
- Mennigen, R.; Nolte, K.; Rijcken, E.; Utech, M.; Loeffler, B.; Senninger, N.; Bruewer, M. Probiotic mixture VSL#3 protects the epithelial barrier by maintaining tight junction protein expression and preventing apoptosis in a murine model of colitis. Am. J. Physiol.-Gastroint. Liver Physiol. 2009, 296, G1140–G1149. [Google Scholar]
- Kaczmarek, A.; Brinkman, B.M.; Heyndrickx, L.; Vandenabeele, P.; Krysko, D.V. Severity of doxorubicin-induced small intestinal mucositis is regulated by the TLR-2 and TLR-9 pathways. J. Pathol. 2012, 226, 598–608. [Google Scholar] [CrossRef] [Scilit]
- Yang, B.; Chen, H.Q.; Gao, H.; Wang, J.T.; Stanton, C.; Ross, R.P.; Zhang, H.; Chen, W. Bifidobacterium breve CCFM683 could ameliorate DSS-induced colitis in mice primarily via conjugated linoleic acid production and gut microbiota modulation. J. Funct. Foods 2018, 49, 61–72. [Google Scholar] [CrossRef] [Scilit]
- Fischer, J.W.; Busa, V.F.; Shao, Y.; Leung, A.K.L. Structure-Mediated RNA Decay by UPF1 and G3BP1. Mol. Cell 2020, 78, 70. [Google Scholar] [CrossRef] [Scilit]
- Wang, G.; Xu, Q.; Jin, X.; Hang, F.; Liu, Z.M.; Zhao, J.X.; Zhang, H.; Chen, W. Effects of lactobacilli with different regulatory behaviours on tight junctions in mice with dextran sodium sulphate-induced colitis. J. Funct. Foods 2018, 47, 107–115. [Google Scholar] [CrossRef] [Scilit]
- Sang, L.X.; Chang, B.; Zhu, J.F.; Yang, F.L.; Li, Y.; Jiang, X.F.; Sun, X.; Lu, C.L.; Wang, D.N. Dextran sulfate sodium-induced acute experimental colitis in C57BL/6 mice is mitigated by selenium. Int. Immunopharmacol. 2016, 39, 359–368. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Krehl, S.; Loewinger, M.; Florian, S.; Kipp, A.P.; Banning, A.; Wessjohann, L.A.; Brauer, M.N.; Iori, R.; Esworthy, R.S.; Chu, F.F.; et al. Glutathione peroxidase-2 and selenium decreased inflammation and tumors in a mouse model of inflammation-associated carcinogenesis whereas sulforaphane effects differed with selenium supply. Carcinogenesis 2012, 33, 620–628. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Duntas, L.H.; Benvenga, S. Selenium: An element for life. Endocrine 2015, 48, 756–775. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Weekley, C.M.; Harris, H.H. Which form is that? The importance of selenium speciation and metabolism in the prevention and treatment of disease. Chem. Soc. Rev. 2013, 42, 8870–8894. [Google Scholar] [CrossRef] [Scilit]
- Erdman, J.W.; MacDonald, I.A.; Zeisel, S.H. Present Knowledge in Nutrition, 10th ed.; Wiley-Blackwell: Hoboken, NJ, USA, 2012. [Google Scholar]
- Li, K.X.; Wang, J.S.; Yuan, D.; Zhao, R.X.; Wang, Y.X.; Zhan, X.A. Effects of different selenium sources and levels on antioxidant status in broiler breeders. Asian-Australas. J. Anim. Sci. 2018, 31, 1939–1945. [Google Scholar] [CrossRef] [Scilit]
- Den, H.G.; Chattopadhyay, R.; Ablack, A.; Hall, E.H.; Butcher, L.D.; Bhattacharyya, A.; Eckmann, L.; Harris, P.R.; Das, S.; Ernst, P.B.; et al. Regulation of Rac1 and Reactive Oxygen Species Production in Response to Infection of Gastrointestinal Epithelia. PLoS Pathog. 2016, 12, 1–20. [Google Scholar]
- Dudzinska, E.; Ggyzinska, M.; Ognik, K.; Gil-Kulik, P.; Kocki, J. Oxidative Stress and Effect of Treatment on the Oxidation Product Decomposition Processes in IBD. Oxidative Med. Cell. Longev. 2018, 11, 1–7. [Google Scholar] [CrossRef] [Scilit]
- Mrowicka, M.; Mrowicki, J.; Mik, M.; Dziki, A.; Majsterek, I. Assessment of DNA damage profile and oxidative/antioxidative biomarker level in patients with inflammatory bowel disease. Pol. J. Surg. 2020, 92, 8–14. [Google Scholar] [CrossRef] [Scilit]
- Pisoschi, A.M.; Pop, A. The role of antioxidants in the chemistry of oxidative stress: A review. Eur. J. Med. Chem. 2015, 97, 55–74. [Google Scholar] [CrossRef] [Scilit]
- Fernandez-Lazaro, D.; Fernandez-Lazaro, C.I.; Mielgo-Ayuso, J.; Navascues, L.J.; Martinez, A.C.; Seco-Calvo, J. The Role of Selenium Mineral Trace Element in Exercise: Antioxidant Defense System, Muscle Performance, Hormone Response, and Athletic Performance. A Systematic Review. Nutrients 2020, 12, 1790. [Google Scholar] [CrossRef] [Scilit]
- Beilstein, M.A.; Whanger, P.D. Glutathione peroxidase activity and chemical forms of selenium in tissues of rats given selenite or selenomethionine. J. Inorg. Biochem. 1988, 33, 31–46. [Google Scholar] [CrossRef] [Scilit]
- Zhang, Z.L.; Zhang, L.J.; Zhang, Q.P.; Liu, B.J.; Li, F.; Xin, Y.; Duan, Z.J. HO-1/CO Maintains Intestinal Barrier Integrity through NF-kappa B/MLCK Pathway in Intestinal HO-1(-/-) Mice. Oxidative Med. Cell. Longev. 2021, 14, 1–19. [Google Scholar]
- Damiani, C.R.; Beneteon, C.A.F.; Stoffel, C.; Bardini, K.C.; Cardoso, V.H.; Di Giunta, G.; Pinho, R.A.; Dal-Pizzol, F.; Streck, E.L. Oxidative stress and metabolism in animal model of colitis induced by dextran sulfate sodium. J. Gastroenterol. Hepatol. 2007, 22, 1846–1851. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Trivedi, P.P.; Jena, G.B. Ulcerative colitis-induced hepatic damage in mice: Studies on inflammation, fibrosis, oxidative DNA damage and GST-P expression. Chem.-Biol. Interact. 2013, 201, 19–30. [Google Scholar] [CrossRef] [Scilit]
- Horiuchi, T.; Mitoma, H.; Harashima, S.; Tsukamoto, H.; Shimoda, T. Transmembrane TNF-alpha: Structure, function and interaction with anti-TNF agents. Rheumatology 2010, 49, 1215–1228. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Lee, I.A.; Bae, E.A.; Lee, J.H.; Lee, H.; Ahn, Y.T.; Huh, C.S.; Kim, D.H. Bifidobacterium longum HY8004 attenuates TNBS-induced colitis by inhibiting lipid peroxidation in mice. Inflamm. Res. 2010, 59, 359–368. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Shao, X.; Sun, C.Z.; Tang, X.; Zhang, X.S.; Han, D.; Liang, S.; Qu, R.; Hui, X.D.; Shan, Y.W.; Hu, L.H.; et al. Anti-Inflammatory and Intestinal Microbiota Modulation Properties of Jinxiang Garlic (Allium sativum L.) Polysaccharides toward Dextran Sodium Sulfate-Induced Colitis. J. Agric. Food Chem. 2020, 68, 12295–12309. [Google Scholar] [CrossRef] [Scilit]
- Huang, K.Y.; Dong, W.; Liu, W.Y.; Yan, Y.M.; Wan, P.; Peng, Y.J.; Xu, Y.J.; Zeng, X.X.; Cao, Y.L. 2-O-beta-D-Glucopyranosyl-L-ascorbic Acid, an Ascorbic Acid Derivative Isolated from the Fruits of Lycium Barbarum L., Modulates Gut Microbiota and Palliates Colitis in Dextran Sodium Sulfate-Induced Colitis in Mice. J. Agric. Food Chem. 2019, 67, 11408–11419. [Google Scholar] [CrossRef] [Scilit]
- Perera, A.P.; Sajnani, K.; Dickinson, J.; Eri, R.; Korner, H. NLRP3 inflammasome in colitis and colitis-associated colorectal cancer. Mamm. Genome 2018, 29, 817–830. [Google Scholar] [CrossRef] [Scilit]
- Ouyang, W.J.; Rutz, S.; Crellin, N.K.; Valdez, P.A.; Hymowitz, S.G. Regulation and Functions of the IL-10 Family of Cytokines in Inflammation and Disease. Annu. Rev. Immunol. 2011, 29, 71–109. [Google Scholar] [CrossRef] [Scilit]
- Lee, S.H. Intestinal permeability regulation by tight junction: Implication on inflammatory bowel diseases. Intest. Res. 2015, 13, 11–18. [Google Scholar] [CrossRef] [Scilit]
- Mu, Y.D.; Zhang, K.Y.; Bai, S.P.; Wang, J.P.; Zeng, Q.F.; Ding, X.M. Effects of vitamin E supplementation on performance, serum biochemical parameters and fatty acid composition of egg yolk in laying hens fed a diet containing ageing corn. J. Anim. Physiol. Anim. Nutr. 2019, 103, 135–145. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Liu, H.; Yu, Q.F.; Fang, C.K.; Chen, S.J.; Tang, X.P.; Ajuwon, K.M.; Fang, R.J. Effect of Selenium Source and Level on Performance, Egg Quality, Egg Selenium Content, and Serum Biochemical Parameters in Laying Hens. Foods 2020, 9, 68. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Zhang, R.X.; Liu, Y.H.; Xing, L.; Zhao, N.; Zheng, Q.M.; Li, J.H.; Bao, J. The protective role of selenium against cadmium-induced hepatotoxicity in laying hens: Expression of Hsps and inflammation-related genes and modulation of elements homeostasis. Ecotoxicol. Environ. Saf. 2018, 159, 205–212. [Google Scholar] [CrossRef] [Scilit] [PubMed]









| Primer | Sense (5′-3′) | Anti-Sense (5′-3′) | Gene ID |
|---|---|---|---|
| β-actin | GTGCTATGTTGCTCTAGACTTCG | ATGCCACAGGATTCCATACC | 11461 |
| Claudin-1 | GCTGGGTTTCATCCTGGCTTCTC | CCTGAGCGGTCACGATGTTGTC | 12737 |
| Occludin | TTGAAAGTCCACCTCCTTACAGA | CCGGATAAAAAGAGTACGCTGG | 18260 |
| ZO-1 | GCTTTAGCGAACAGAAGGAGC | TTCATTTTTCCGAGACTTCACCA | 21872 |
| Strain | Number of Viable Bacteria (cfu/g) | Se Content (mg/L) |
|---|---|---|
| L. paracasei CCFM 1089 | 2.71 × 1011 | - |
| Se-enriched L. paracasei CCFM 1089 | 2.65 × 1010 | 334.91 |
| Product | Se Content (mg/L) | Organic Se Content (%) | SeCys Content (%) | SeMet Content (%) |
|---|---|---|---|---|
| Se-enriched L. paracasei CCFM 1089 | 334.9 | 81.0 | 79.0 | 6.0 |
| Se-enriched yeast | 2000.0 | 97.0 | 1.1 | 65.3 |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Zhong, Y.; Jin, Y.; Zhang, Q.; Mao, B.; Tang, X.; Huang, J.; Guo, R.; Zhao, J.; Cui, S.; Chen, W. Comparison of Selenium-Enriched Lactobacillusparacasei, Selenium-Enriched Yeast, and Selenite for the Alleviation of DSS-Induced Colitis in Mice. Nutrients 2022, 14, 2433. https://doi.org/10.3390/nu14122433
Zhong Y, Jin Y, Zhang Q, Mao B, Tang X, Huang J, Guo R, Zhao J, Cui S, Chen W. Comparison of Selenium-Enriched Lactobacillusparacasei, Selenium-Enriched Yeast, and Selenite for the Alleviation of DSS-Induced Colitis in Mice. Nutrients. 2022; 14(12):2433. https://doi.org/10.3390/nu14122433
Chicago/Turabian StyleZhong, Yuqing, Yan Jin, Qiuxiang Zhang, Bingyong Mao, Xin Tang, Jie Huang, Renmei Guo, Jianxin Zhao, Shumao Cui, and Wei Chen. 2022. "Comparison of Selenium-Enriched Lactobacillusparacasei, Selenium-Enriched Yeast, and Selenite for the Alleviation of DSS-Induced Colitis in Mice" Nutrients 14, no. 12: 2433. https://doi.org/10.3390/nu14122433
APA StyleZhong, Y., Jin, Y., Zhang, Q., Mao, B., Tang, X., Huang, J., Guo, R., Zhao, J., Cui, S., & Chen, W. (2022). Comparison of Selenium-Enriched Lactobacillusparacasei, Selenium-Enriched Yeast, and Selenite for the Alleviation of DSS-Induced Colitis in Mice. Nutrients, 14(12), 2433. https://doi.org/10.3390/nu14122433

