Basolateral Secretion from Caco-2 Cells Pretreated with Fecal Waters from Breast Cancer Patients Affects MCF7 Cell Viability
Abstract
1. Introduction
2. Materials and Methods
2.1. Patients and Controls
2.2. Materials
2.3. Quantification of Bacteria
2.4. Preparation of Fecal Water (FW) Samples
2.5. Assay of Short Chain Fatty Acids in FW Samples
2.6. Cell Culture
2.7. Preparation of the Differentiated Caco-2 Monolayer
2.8. Incubation of the Caco-2 Monolayer with FW Samples
2.9. MCF-7 Cell Viability Assay
2.10. Gene Expression Analysis by RT-PCR
3. Results
3.1. Characteristics of the Studied Population and MCF-7 Cell Viability
3.2. MCF-7 Viability and Bacteria Relative Abundance
3.3. Caco-2 Cells Lipid Metabolism Gene Expression and Stool Composition
3.4. Relationship between Stool Microbiota and Short Chain Fatty Acids in Fecal Water
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
Abbreviations
| Apo | Apolipoprotein |
| BRCA1 | Breast cancer 1 |
| BRCA2 | Breats cancer 2 |
| BSA | Bovine serum albumin |
| CT | Cycle threshold |
| DMEM | Dulbecco’s Modified Eagle’s Medium |
| DMSO | Dimethyl sulfoxide |
| FBS | Fetal bovine serum |
| FW | Fecal water |
| HEPES | [4-(2-Hydroxyethyl)-1-piperazinyl]-ethanesulfonic acid |
| HER2 | Human Epidermal Growth Factor Receptor-2 |
| LXR | Liver X Receptor |
| MTT | 3-(4,5-Dimethyl-2-thiazolyl)-2,5-diphenyltetrazolium bromide |
| NEAA | Non essential amino acid |
| PBS | Phosphate buffered saline |
| qPCR | Quantitative polymerase chain reaction |
| RT | Reverse transcriptase |
| RT qPCR | Real time quantitative polymerase chain reaction |
| RT-qPCR | Reverse transcription quantitative polymerase chain reaction |
| SCFA | Short chain fatty acid |
| TEER | Transepithelial electrical resistance |
References
- Alawin, O.A.; Ahmed, R.A.; Ibrahim, B.A.; Briski, K.P.; Sylvester, P.W. Antiproliferative effects of γ-tocotrienol are associated with lipid raft disruption in HER2-positive human breast cancer cells. J. Nutr. Biochem. 2016, 27, 266–277. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Badana, A.; Chintala, M.; Varikuti, G.; Pudi, N.; Kumari, S.; Kappala, V.R.; Malla, R.R. Lipid Raft Integrity Is Required for Survival of Triple Negative Breast Cancer Cells. J. Breast Cancer 2016, 19, 372. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Badana, A.K.; Chintala, M.; Gavara, M.M.; Naik, S.; Kumari, S.; Kappala, V.R.; Iska, B.R.; Malla, R.R. Lipid rafts disruption induces apoptosis by attenuating expression of LRP6 and survivin in triple negative breast cancer. Biomed. Pharmacother. 2018, 97, 359–368. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Donatello, S.; Babina, I.S.; Hazelwood, L.D.; Hill, A.D.K.; Nabi, I.R.; Hopkins, A.M. Lipid Raft Association Restricts CD44-Ezrin Interaction and Promotion of Breast Cancer Cell Migration. Am. J. Pathol. 2012, 181, 2172–2187. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Carbonnelle, D.; Luu, T.H.; Chaillou, C.; Huvelin, J.-M.; Bard, J.-M.; Nazih, H. LXR Activation Down-regulates Lipid Raft Markers FLOT2 and DHHC5 in MCF-7 Breast Cancer Cells. Anticancer Res. 2017, 37, 4067–4073. [Google Scholar] [CrossRef] [Scilit]
- El Roz, A.; Bard, J.-M.; Huvelin, J.-M.; Nazih, H. LXR agonists and ABCG1-dependent cholesterol efflux in MCF-7 breast cancer cells: Relation to proliferation and apoptosis. Anticancer Res. 2012, 32, 3007–3013. [Google Scholar]
- El Roz, A.; Bard, J.-M.; Valin, S.; Huvelin, J.-M.; Nazih, H. Macrophage apolipoprotein E and proliferation of MCF-7 breast cancer cells: Role of LXR. Anticancer Res. 2013, 33, 3783–3789. [Google Scholar]
- Steinmetz, A.; Barbaras, R.; Ghalim, N.; Clavey, V.; Fruchart, J.C.; Ailhaud, G. Human apolipoprotein A-IV binds to apolipoprotein A-I/A-II receptor sites and promotes cholesterol efflux from adipose cells. J. Biol. Chem. 1990, 265, 7859–7863. [Google Scholar]
- Nazih, H.; Nazih-Sanderson, F.; Krempf, M.; Michel Huvelin, J.; Mercier, S.; Marie Bard, J. Butyrate stimulates ApoA-IV-containing lipoprotein secretion in differentiated Caco-2 cells: Role in cholesterol efflux. J. Cell. Biochem. 2001, 83, 230–238. [Google Scholar] [CrossRef] [Scilit]
- Plaza-Díaz, J.; Álvarez-Mercado, A.I.; Ruiz-Marín, C.M.; Reina-Pérez, I.; Pérez-Alonso, A.J.; Sánchez-Andujar, M.B.; Torné, P.; Gallart-Aragón, T.; Sánchez-Barrón, M.T.; Reyes Lartategui, S.; et al. Association of breast and gut microbiota dysbiosis and the risk of breast cancer: A case-control clinical study. BMC Cancer 2019, 19, 495. [Google Scholar] [CrossRef] [Scilit]
- Zhu, J.; Liao, M.; Yao, Z.; Liang, W.; Li, Q.; Liu, J.; Yang, H.; Ji, Y.; Wei, W.; Tan, A.; et al. Breast cancer in postmenopausal women is associated with an altered gut metagenome. Microbiome 2018, 6, 136. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Goedert, J.J.; Jones, G.; Hua, X.; Xu, X.; Yu, G.; Flores, R.; Falk, R.T.; Gail, M.H.; Shi, J.; Ravel, J.; et al. Investigation of the Association Between the Fecal Microbiota and Breast Cancer in Postmenopausal Women: A Population-Based Case-Control Pilot Study. JNCI J. Natl. Cancer Inst. 2015, 107. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Luu, T.H.; Michel, C.; Bard, J.-M.; Dravet, F.; Nazih, H.; Bobin-Dubigeon, C. Intestinal Proportion of Blautia sp. is Associated with Clinical Stage and Histoprognostic Grade in Patients with Early-Stage Breast Cancer. Nutr. Cancer 2017, 69, 267–275. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Heymann, D.; Kerdraon, O.; Verriele, V.; Verhille, E.; Veron, V.; Vitre, M.; Delmas, F.; Henry, C.; Gouy, Y.; Amiand, M.; et al. Centre de Ressources Biologiques-Tumorothèque: Bioresources and Associated Clinical Data Dedicated to Translational Research in Oncology at the Institut de Cancérologie de l’Ouest, France. Open J. Bioresour. 2020, 7, 5. [Google Scholar] [CrossRef] [Scilit]
- Gourbeyre, P.; Desbuards, N.; Grémy, G.; Tranquet, O.; Champ, M.; Denery-Papini, S.; Bodinier, M. Perinatal and Postweaning Exposure to Galactooligosaccharides/Inulin Prebiotics Induced Biomarkers Linked to Tolerance Mechanism in a Mouse Model of Strong Allergic Sensitization. J. Agric. Food Chem. 2013, 61, 6311–6320. [Google Scholar] [CrossRef] [Scilit]
- Srinivasan, B.; Kolli, A.R.; Esch, M.B.; Abaci, H.E.; Shuler, M.L.; Hickman, J.J. TEER measurement techniques for in vitro barrier model systems. J. Lab. Autom. 2015, 20, 107–126. [Google Scholar] [CrossRef] [Scilit]
- Wang, Y.; Hu, P.-C.; Ma, Y.-B.; Fan, R.; Gao, F.-F.; Zhang, J.-W.; Wei, L. Sodium butyrate-induced apoptosis and ultrastructural changes in MCF-7 breast cancer cells. Ultrastruct. Pathol. 2016, 40, 200–204. [Google Scholar] [CrossRef] [Scilit]
- Semaan, J.; El-Hakim, S.; Ibrahim, J.-N.; Safi, R.; Elnar, A.A.; El Boustany, C. Comparative effect of sodium butyrate and sodium propionate on proliferation, cell cycle and apoptosis in human breast cancer cells MCF-7. Breast Cancer 2020, 27, 696–705. [Google Scholar] [CrossRef] [Scilit]
- Varga, K.; Pászty, K.; Padányi, R.; Hegedűs, L.; Brouland, J.-P.; Papp, B.; Enyedi, A. Histone deacetylase inhibitor- and PMA-induced upregulation of PMCA4b enhances Ca2+ clearance from MCF-7 breast cancer cells. Cell Calcium 2014, 55, 78–92. [Google Scholar] [CrossRef] [Scilit]
- Jiang, L.; Lee, S.C.; Ng, T.C. Pharmacometabonomics Analysis Reveals Serum Formate and Acetate Potentially Associated with Varying Response to Gemcitabine-Carboplatin Chemotherapy in Metastatic Breast Cancer Patients. J. Proteome Res. 2018, 17, 1248–1257. [Google Scholar] [CrossRef] [Scilit]
- Han, R.; Nusbaum, O.; Chen, X.; Zhu, Y. Valeric Acid Suppresses Liver Cancer Development by Acting as a Novel HDAC Inhibitor. Mol. Ther. Oncolytics 2020, 19, 8–18. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Ribiczey, P.; Tordai, A.; Andrikovics, H.; Filoteo, A.G.; Penniston, J.T.; Enouf, J.; Enyedi, A.; Papp, B.; Kovács, T. Isoform-specific up-regulation of plasma membrane Ca2+ATPase expression during colon and gastric cancer cell differentiation. Cell Calcium 2007, 42, 590–605. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Dobrowolska Iwanek, J.; Zagrodzki, P.; Woźniakiewicz, M.; Woźniakiewicz, A.; Zwolińska Wcisło, M.; Winnicka, D.; Paśko, P. Procedure optimization for extracting short-chain fatty acids from human faeces. J. Pharm. Biomed. Anal. 2016, 124, 337–340. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Bobin-Dubigeon, C.; Chauvin, A.; Brillaud-Meflah, V.; Boiffard, F.; Joalland, M.-P.; Bard, J.-M. Liver X Receptor (LXR)-regulated Genes of Cholesterol Trafficking and Breast Cancer Severity. Anticancer Res. 2017, 37, 5495–5498. [Google Scholar] [CrossRef] [Scilit]
| Gene Name | Sequences (5′-3′) | |
|---|---|---|
| 18S | F- GATGCGGCGGCGTTATTCC | R- CTCCTGGTGGTGCCCTTCC |
| LXR | F- GCTCCCACCGCTGCTCTC | R- TGCCCTTCTCAGTCTGTTCCAC |
| ApoE | F- CTGCGTTGCTGGTCACATTCC | R- CGCTCTGCCACTCGGTCTG |
| ApoA-IV | F- CAACTCAATGCCCTCTTC | R- CTCCTCCTTCAGTTTCTCC |
| Controls ** (n = 29) | Breast Cancer ** (n = 32) | Odds Ratio *** | |
|---|---|---|---|
| Age (years) | 53.0 (47.0–62.0) | 61.0 (50.5–69.0) | 1.05 (1.00–1.10) |
| p = 0.06 | |||
| BMI (Kg/m2) | 23.9 (22.5–25.6) | 23.4 (21.5–26.0) | 1.00 (0.87–1.16) |
| p = 0.95 | |||
| Menopausal status (yes/no/%yes) | 19/10/65.5% | 23/9/71.9% | |
| p = 0.59 * |
| Controls * (n = 29) | Breast Cancer * (n = 32) | Odds Ratio ** | |
|---|---|---|---|
| LXR | 1.29 (0.97–1.68) | 1.07 (0.82–1.42) | 0.68 (0.26–1.77) |
| p = 0.43 | |||
| Apo E | 1.18 (0.85–1.33) | 0.94 (0.71–1.27) | 0.88 (0.38–2.03) |
| p = 0.77 | |||
| Apo AIV | 3.03 (2.00–3.92) | 2.20 (1.67–3.31) | 0.63 (0.39–1.01) |
| p = 0.055 | |||
| MCF7 viability 24 h | 90.40 (87.31–95.46) | 97.54 (87.93–106.99) | 1.05 (1.01–1.10) |
| p = 0.04 |
| Univariate Model | Mutlivariate Model | |
|---|---|---|
| β ± s.d. | β ± s.d. | |
| Total bacteria | 0.112 ± 9.117 (p = 0.99) | |
| % Bacteroidetes | −0.306 ± 0.214 (p = 0.16) | |
| % Firmicutes Phyllum | 0.154 ± 0.089 (p = 0.09) | |
| % Bifidobacterium sp. | 21.18 ± 7.66 (p = 0.008) | 20.57 ± 7.27 (p = 0.006) |
| % Lactobacillales | −89.02 ± 73.41 (p = 0.23) | |
| % Escherischia/Shigella | 11.50 ± 30.51 (p = 0.71) | |
| % C. Leptum Cluster IV | 0.266 ± 0.148 (p = 0.077) | |
| % Clostridium Cluster XIVa | 0.075 ± 0.134 (p = 0.58) | |
| % F. prausnitzii | 0.193 ± 0.204 (p = 0.35) | |
| % Roseburia intestinalis | −0.237 ± 1.194 (p = 0.84) | |
| % Blautia sp. | 2.124 ± 1.850 (p = 0.26) | |
| % Eggerthella Lenta | 48.78 ± 45.28 (p = 0.29) | |
| % Coriobacteriacae | 2.33 ± 2.19 (p = 0.29) | |
| % Lactonifactor longoviformis | −255.23 ± 223.39 (p = 0.26) | |
| Acetate | 0.092 ± 0.062 (p = 0.15) | |
| Propionate | 0.295 ± 0.186 (p = 0.12) | |
| Butyrate | 0.278 ± 0.156 (p = 0.08) | |
| Valerate | −2.849 ± 1.048 (p = 0.009) | −2.765 ± 0.991 (p = 0.007) |
| LXR | −1.084 ± 3.135 (p = 0.73) | |
| Apo E | 0.624 ± 2.753 (p = 0.82) | |
| Apo AIV | −1.83 ± 1.324 (p = 0.17) |
| Univariate Model | Multivariate Model | |
|---|---|---|
| β ± s.d. | β ± s.d. | |
| Total bacteria | −0.93 ± 0.87 (p = 0.29) | |
| % Bacteroidetes | 0.06 ± 0.02 (p = 0.004) | 0.063 ± 0.017 (p = 0.0006) |
| % Firmicutes Phyllum | 0.005 ± 0.009 (p = 0.63) | |
| % Bifidobacterium sp. | −0.16 ± 0.79 (p = 0.84) | |
| % Lactobacillales | 5.57 ± 7.16 (p = 0.44) | |
| % Escherischia/Shigella | −0.92 ± 2.95 (p = 0.76) | |
| % C. Leptum Cluster IV | −0.003 ± 0.01 (p = 0.81) | |
| % Clostridium Cluster XIVa | 0.017 ± 0.013 (p = 0.19) | |
| % F. prausnitzii | 0.008 ± 0.020 (p = 0.70) | |
| % Roseburia intestinalis | 0.069 ± 0.115 (p = 0.55) | |
| % Blautia sp. | 0.025 ± 0.18 (p = 0.89) | |
| % Eggerthella Lenta | 2.44 ± 4.41 (p = 0.58) | |
| % Coriobacteriacae | −0.188 ± 0.21 (p = 0.38) | |
| % Lactonifactor longoviformis | −10.78 ± 21.82 (p = 0.62) | |
| Acetate | 0.015 ± 0.0059 (p = 0.01) | −0.003 ± 0.009 (p = 0.74) |
| Propionate | 0.063 ± 0.016 (p = 0.0003) | 0.057 ± 0.03 (p = 0.056) |
| Butyrate | 0.050 ± 0.014 (p = 0.0007) | 0.027 ± 0.025 (p = 0.29) |
| Valerate | 0.121 ± 0.106 (p = 0.26) | −0.092 ± 0.107 (p = 0.40) |
| Univariate Model | Multivariate Model | |
|---|---|---|
| β ± s.d. | β ± s.d. | |
| Total bacteria | −0.117 ± 0.378 (p = 0.76) | |
| % Bacteroidetes | 0.002 ± 0.009 (p = 0.82) | |
| % Firmicutes Phyllum | −0.007 ± 0.004 (p = 0.06) | |
| % Bifidobacterium sp. | −0.566 ± 0.329 (p = 0.09) | |
| % Lactobacillales | 3.027 ± 3.058 (p = 0.33) | |
| % Escherischia/Shigella | −0.778 ± 1.263 (p = 0.54) | |
| % C. Leptum Cluster IV | −0.006 ± 0.006 (p = 0.35) | |
| % Clostridium Cluster XIVa | 0.006 ± 0.006 (p = 0.29) | |
| % F. prausnitzii | −0.013 ± 0.008 (p = 0.13) | |
| % Roseburia intestinalis | −0.022 ± 0.049 (p = 0.66) | |
| % Blautia sp. | −0.172 ± 0.074 (p = 0.02) | −0.184 ± 0.072 (p = 0.01) |
| % Eggerthella Lenta | −1.235 ± 1.889 (p = 0.52) | |
| % Coriobacteriacae | −0.015 ± 0.092 (p = 0.87) | |
| % Lactonifactor longoviformis | −8.738 ± 9.299 (p = 0.35) | |
| Acetate | −0.0056 ± 0.0025 (p = 0.03) | 0.0005 ± 0.0045 (p = 0.91) |
| Propionate | −0.016 ± 0.007 (p = 0.04) | 0.0019 ± 0.014 (p = 0.89) |
| Butyrate | −0.017 ± 0.006 (p = 0.009) | −0.0178 ± 0.012 (p = 0.14) |
| Valerate | −0.089 ± 0.045 (p = 0.05) | −0.0359 ± 0.052 (p = 0.49) |
| Actetate | Propionate | Butyrate | Valerate | |
|---|---|---|---|---|
| β ± s.d. | β ± s.d. | β ± s.d. | β ± s.d. | |
| Total bacteria | 19.39 ± 18.36 (p = 0.30) | 6.36 ± 6.19 (p = 0.31) | 11.76 ± 7.23 (p = 0.11) | −0.20 ± 1.07 (p = 0.85) |
| % Bacteroidetes | −0.40 ± 0.44 (p = 0.36) | −0.08 ± 0.15 (p = 0.61) | −0.09 ± 0.18 (p = 0.60) | −0.02 ± 0.03 (p = 0.47) |
| % Firmicutes Phyllum | 0.06 ± 0.19 (p = 0.74) | −0.03 ± 0.06 (p = 0.59) | −0.02 ± 0.07 (p = 0.78) | 0.01 ± 0.01 (p = 0.46) |
| % Bifidobacterium sp. | 8.04 ± 16.52 (p = 0.63) | −4.00 ± 5.55 (p = 0.47) | 4.10 ± 6.58 (p = 0.54) | −0.22 ± 0.95 (p = 0.82) |
| % Lactobacillales | −67.68 ± 150.81 (p = 0.65) | −49.78 ± 50.48 (p = 0.33) | −1.89 ± 60.27 (p = 0.97) | −2.20 ± 8.70 (p = 0.80) |
| % Escherischia/Shigella | 39.77 ± 61.87 (p = 0.52) | 9.58 ± 20.88 (p = 0.65) | −7.96 ± 24.75 (p = 0.75) | 1.47 ± 3.57 (p = 0.68) |
| % C. Leptum Cluster IV | 0.32 ± 0.31 (p = 0.30) | 0.05 ± 0.10 (p = 0.63) | 0.02 ± 0.12 (p = 0.85) | 0.02 ± 0.02 (p = 0.25) |
| % Clostridium cluster XIVa | 0.34 ± 0.27 (p = 0.22) | 0.06 ± 0.09 (p = 0.53) | 0.03 ± 0.11 (p = 0.78) | 0.01 ± 0.02 (p = 0.55) |
| % F. prausnitzii | 0.28 ± 0.42 (p = 0.50) | 0.09 ± 0.14 (p = 0.52) | 0.08 ± 0.17 (p = 0.63) | 0.02 ± 0.02 (p = 0.35) |
| % Roseburia intestinalis | 2.50 ± 2.40 (p = 0.30) | −0.11 ± 0.82 (p = 0.89) | 0.09 ± 0.97 (p = 0.93) | −0.01 ± 0.14 (p = 0.97) |
| % Blautia sp. | −0.88 ± 3.80 (p = 0.82) | −0.82 ± 1.28 (p = 0.47) | −0.85 ± 1.51 (p = 0.58) | 0.05 ± 0.22 (p = 0.83) |
| % Eggerthella Lenta | −104.39 ± 91.94 (p = 0.26) | −18.75 ± 31.22 (p = 0.55) | −25.28 ± 36.93 (p = 0.50) | 1.95 ± 5.35 (p = 0.72) |
| % Coriobacteriacae | −9.27 ± 4.32 (p = 0.04) | −3.98 ± 1.42 (p = 0.007) | −2.98 ± 1.75 (p = 0.09) | −0.06 ± 0.26 (p = 0.80) |
| % Lactonifactor Longoviformis | −869.45 ± 444.87 (p = 0.06) | −104.17 ± 154.07 (p = 0.50) | −232.65 ± 180.61 (p = 0.20) | −26.05 ± 26.23 (p = 0.32) |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2020 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Bobin-Dubigeon, C.; Bard, J.-M.; Luu, T.-H.; Le Vacon, F.; Nazih, H. Basolateral Secretion from Caco-2 Cells Pretreated with Fecal Waters from Breast Cancer Patients Affects MCF7 Cell Viability. Nutrients 2021, 13, 31. https://doi.org/10.3390/nu13010031
Bobin-Dubigeon C, Bard J-M, Luu T-H, Le Vacon F, Nazih H. Basolateral Secretion from Caco-2 Cells Pretreated with Fecal Waters from Breast Cancer Patients Affects MCF7 Cell Viability. Nutrients. 2021; 13(1):31. https://doi.org/10.3390/nu13010031
Chicago/Turabian StyleBobin-Dubigeon, Christine, Jean-Marie Bard, Trang-Huyen Luu, Françoise Le Vacon, and Hassan Nazih. 2021. "Basolateral Secretion from Caco-2 Cells Pretreated with Fecal Waters from Breast Cancer Patients Affects MCF7 Cell Viability" Nutrients 13, no. 1: 31. https://doi.org/10.3390/nu13010031
APA StyleBobin-Dubigeon, C., Bard, J.-M., Luu, T.-H., Le Vacon, F., & Nazih, H. (2021). Basolateral Secretion from Caco-2 Cells Pretreated with Fecal Waters from Breast Cancer Patients Affects MCF7 Cell Viability. Nutrients, 13(1), 31. https://doi.org/10.3390/nu13010031

