DNA Methylation Changes are Associated with the Programming of White Adipose Tissue Browning Features by Resveratrol and Nicotinamide Riboside Neonatal Supplementations in Mice
Abstract
1. Introduction
2. Materials and Methods
2.1. Animal Experiments
2.2. Tissue RNA Isolation and Gene Expression
2.3. Tissue DNA Extraction and Bisulfite-Sequencing PCR
2.4. Cell Experiments
2.4.1. Cellular RNA Extraction and Gene Expression
2.4.2. Cellular Mitochondrial DNA Content
2.5. Statistical Analysis
3. Results
3.1. Early Life Supplementation with RSV or NR Affected the Methylation Profile of Slc27a1 in iWAT of Adult Mice
3.2. Early Life Supplementation with RSV or NR Affected the Methylation Profile of Prdm16 in iWAT of Adult Mice
3.3. Early Life Supplementation with RSV or NR Affected the DNA Methylation Machinery in iWAT of Young Mice
3.4. RSV and NR Promoted Browning Features and Affected the DNA Methylation Machinery in 3T3-L1 Adipocytes
4. Discussion
5. Conclusions
Author Contributions
Funding
Conflicts of Interest
Abbreviations
References
- Block, T.; El-Osta, A. Epigenetic programming, early life nutrition and the risk of metabolic disease. Atherosclerosis 2017, 266, 31–40. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Cottrell, E.C.; Ozanne, S.E. Early life programming of obesity and metabolic disease. Physiol. Behav. 2008, 94, 17–28. [Google Scholar] [CrossRef] [Scilit]
- Anderson, O.S.; Sant, K.E.; Dolinoy, D.C. Nutrition and epigenetics: An interplay of dietary methyl donors, one-carbon metabolism and DNA methylation. J. Nutr. Biochem. 2012, 23, 853–859. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Palou, A.; Pico, C.; Bonet, M.L. Nutritional potential of metabolic remodelling of white adipose tissue. Curr. Opin. Clin. Nutr. Metab. Care 2013, 16, 650–656. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Chabowska-Kita, A.; Kozak, L.P. The critical period for brown adipocyte development: Genetic and environmental influences. Obesity (Silver Spring) 2016, 24, 283–290. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Serrano, A.; Asnani-Kishnani, M.; Rodriguez, A.M.; Palou, A.; Ribot, J.; Bonet, M.L. Programming of the Beige Phenotype in White Adipose Tissue of Adult Mice by Mild Resveratrol and Nicotinamide Riboside Supplementations in Early Postnatal Life. Mol. Nutr. Food Res. 2018, 62, e1800463. [Google Scholar] [CrossRef] [Scilit]
- Zou, T.; Chen, D.; Yang, Q.; Wang, B.; Zhu, M.J.; Nathanielsz, P.W.; Du, M. Resveratrol supplementation of high-fat diet-fed pregnant mice promotes brown and beige adipocyte development and prevents obesity in male offspring. J. Physiol. 2017, 595, 1547–1562. [Google Scholar] [CrossRef] [Scilit]
- Asnani-Kishnani, M.; Rodriguez, A.M.; Serrano, A.; Palou, A.; Bonet, M.L.; Ribot, J. Neonatal Resveratrol and Nicotinamide Riboside Supplementations Sex-Dependently Affect Beige Transcriptional Programming of Preadipocytes in Mouse Adipose Tissue. Front. Physiol. 2019, 10, 83. [Google Scholar] [CrossRef] [Scilit]
- Holloway, G.P.; Chou, C.J.; Lally, J.; Stellingwerff, T.; Maher, A.C.; Gavrilova, O.; Haluzik, M.; Alkhateeb, H.; Reitman, M.L.; Bonen, A. Increasing skeletal muscle fatty acid transport protein 1 (FATP1) targets fatty acids to oxidation and does not predispose mice to diet-induced insulin resistance. Diabetologia 2011, 54, 1457–1467. [Google Scholar] [CrossRef] [Scilit]
- Wu, Q.; Kazantzis, M.; Doege, H.; Ortegon, A.M.; Tsang, B.; Falcon, A.; Stahl, A. Fatty acid transport protein 1 is required for nonshivering thermogenesis in brown adipose tissue. Diabetes 2006, 55, 3229–3237. [Google Scholar] [CrossRef] [Scilit]
- Wu, J.; Bostrom, P.; Sparks, L.M.; Ye, L.; Choi, J.H.; Giang, A.H.; Khandekar, M.; Virtanen, K.A.; Nuutila, P.; Schaart, G.; et al. Beige adipocytes are a distinct type of thermogenic fat cell in mouse and human. Cell 2012, 150, 366–376. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Wiczer, B.M.; Bernlohr, D.A. A novel role for fatty acid transport protein 1 in the regulation of tricarboxylic acid cycle and mitochondrial function in 3T3-L1 adipocytes. J. Lipid. Res. 2009, 50, 2502–2513. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Wang, H.; Lee, J.H.; Tian, Y. Critical Genes in White Adipose Tissue Based on Gene Expression Profile Following Exercise. Int. J. Sports Med. 2019, 40, 57–61. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Seale, P.; Bjork, B.; Yang, W.; Kajimura, S.; Chin, S.; Kuang, S.; Scime, A.; Devarakonda, S.; Conroe, H.M.; Erdjument-Bromage, H.; et al. PRDM16 controls a brown fat/skeletal muscle switch. Nature 2008, 454, 961–967. [Google Scholar] [CrossRef] [Scilit]
- Seale, P.; Conroe, H.M.; Estall, J.; Kajimura, S.; Frontini, A.; Ishibashi, J.; Cohen, P.; Cinti, S.; Spiegelman, B.M. Prdm16 determines the thermogenic program of subcutaneous white adipose tissue in mice. J. Clin. Investig. 2011, 121, 96–105. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Cohen, P.; Levy, J.D.; Zhang, Y.; Frontini, A.; Kolodin, D.P.; Svensson, K.J.; Lo, J.C.; Zeng, X.; Ye, L.; Khandekar, M.J.; et al. Ablation of PRDM16 and beige adipose causes metabolic dysfunction and a subcutaneous to visceral fat switch. Cell 2014, 156, 304–316. [Google Scholar] [CrossRef] [Scilit]
- Yang, Q.; Liang, X.; Sun, X.; Zhang, L.; Fu, X.; Rogers, C.J.; Berim, A.; Zhang, S.; Wang, S.; Wang, B.; et al. AMPK/alpha-Ketoglutarate Axis Dynamically Mediates DNA Demethylation in the Prdm16 Promoter and Brown Adipogenesis. Cell Metab. 2016, 24, 542–554. [Google Scholar] [CrossRef] [Scilit]
- Petrov, P.D.; Ribot, J.; Palou, A.; Bonet, M.L. Improved metabolic regulation is associated with retinoblastoma protein gene haploinsufficiency in mice. Am. J. Physiol. Endocrinol. Metab. 2015, 308, 172–183. [Google Scholar] [CrossRef] [Scilit]
- Chaplin, A.; Palou, A.; Serra, F. Methylation analysis in fatty-acid-related genes reveals their plasticity associated with conjugated linoleic acid and calcium supplementation in adult mice. Eur. J. Nutr. 2017, 56, 879–891. [Google Scholar] [CrossRef] [Scilit]
- Arreguin, A.; Ribot, J.; Musinovic, H.; von Lintig, J.; Palou, A.; Bonet, M.L. Dietary vitamin A impacts DNA methylation patterns of adipogenesis-related genes in suckling rats. Arch. Biochem. Biophys. 2018, 650, 75–84. [Google Scholar] [CrossRef] [Scilit]
- Jiang, M.; Zhang, Y.; Fei, J.; Chang, X.; Fan, W.; Qian, X.; Zhang, T.; Lu, D. Rapid quantification of DNA methylation by measuring relative peak heights in direct bisulfite-PCR sequencing traces. Lab. Investig. J. Tech. Methods Pathol. 2010, 90, 282–290. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Karkeni, E.; Marcotorchino, J.; Tourniaire, F.; Astier, J.; Peiretti, F.; Darmon, P.; Landrier, J.F. Vitamin D limits chemokine expression in adipocytes and macrophage migration in vitro and in male mice. Endocrinology 2015, 156, 1782–1793. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Landrier, J.F.; Malezet-Desmoulins, C.; Reboul, E.; Marie Lorec, A.; Josephe Amiot, M.; Borel, P. Comparison of different vehicles to study the effect of tocopherols on gene expression in intestinal cells. Free Radic. Res. 2008, 42, 523–530. [Google Scholar] [CrossRef] [Scilit]
- Tourniaire, F.; Musinovic, H.; Gouranton, E.; Astier, J.; Marcotorchino, J.; Arreguin, A.; Bernot, D.; Palou, A.; Bonet, M.L.; Ribot, J.; et al. All-trans retinoic acid induces oxidative phosphorylation and mitochondria biogenesis in adipocytes. J. Lipid Res. 2015, 56, 1100–1109. [Google Scholar] [CrossRef] [Scilit]
- Hui, T.Y.; Frohnert, B.I.; Smith, A.J.; Schaffer, J.E.; Bernlohr, D.A. Characterization of the murine fatty acid transport protein gene and its insulin response sequence. J. Biol. Chem. 1998, 273, 27420–27429. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Frohnert, B.I.; Hui, T.Y.; Bernlohr, D.A. Identification of a functional peroxisome proliferator-responsive element in the murine fatty acid transport protein gene. J. Biol. Chem. 1999, 274, 3970–3977. [Google Scholar] [CrossRef] [Scilit]
- Choi, H.; Kim, S.J.; Park, S.S.; Chang, C.; Kim, E. TR4 activates FATP1 gene expression to promote lipid accumulation in 3T3-L1 adipocytes. FEBS Lett. 2011, 585, 2763–2767. [Google Scholar] [CrossRef] [Scilit]
- Meissner, A.; Mikkelsen, T.S.; Gu, H.; Wernig, M.; Hanna, J.; Sivachenko, A.; Zhang, X.; Bernstein, B.E.; Nusbaum, C.; Jaffe, D.B.; et al. Genome-scale DNA methylation maps of pluripotent and differentiated cells. Nature 2008, 454, 766–770. [Google Scholar] [CrossRef] [Scilit]
- Subramaniam, D.; Thombre, R.; Dhar, A.; Anant, S. DNA methyltransferases: A novel target for prevention and therapy. Front. Oncol. 2014, 4, 80. [Google Scholar] [CrossRef] [Scilit]
- Rasmussen, K.D.; Helin, K. Role of TET enzymes in DNA methylation, development, and cancer. Genes Dev. 2016, 30, 733–750. [Google Scholar] [CrossRef] [Scilit]
- Montanari, T.; Boschi, F.; Colitti, M. Comparison of the Effects of Browning-Inducing Capsaicin on Two Murine Adipocyte Models. Front. Physiol. 2019, 10, 1380. [Google Scholar] [CrossRef] [Scilit]
- Park, W.Y.; Choe, S.K.; Park, J.; Um, J.Y. Black Raspberry (Rubus coreanus Miquel) Promotes Browning of Preadipocytes and Inguinal White Adipose Tissue in Cold-Induced Mice. Nutrients 2019, 11, 2164. [Google Scholar] [CrossRef] [Scilit]
- Chen, Z.X.; Mann, J.R.; Hsieh, C.L.; Riggs, A.D.; Chedin, F. Physical and functional interactions between the human DNMT3L protein and members of the de novo methyltransferase family. J. Cell. Biochem. 2005, 95, 902–917. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Jurkowska, R.Z.; Rajavelu, A.; Anspach, N.; Urbanke, C.; Jankevicius, G.; Ragozin, S.; Nellen, W.; Jeltsch, A. Oligomerization and binding of the Dnmt3a DNA methyltransferase to parallel DNA molecules: Heterochromatic localization and role of Dnmt3L. J. Biol. Chem. 2011, 286, 24200–24207. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Neri, F.; Krepelova, A.; Incarnato, D.; Maldotti, M.; Parlato, C.; Galvagni, F.; Matarese, F.; Stunnenberg, H.G.; Oliviero, S. Dnmt3L antagonizes DNA methylation at bivalent promoters and favors DNA methylation at gene bodies in ESCs. Cell 2013, 155, 121–134. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Fernandes, G.F.S.; Silva, G.D.B.; Pavan, A.R.; Chiba, D.E.; Chin, C.M.; Dos Santos, J.L. Epigenetic Regulatory Mechanisms Induced by Resveratrol. Nutrients 2017, 9, 1201. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Lou, X.D.; Wang, H.D.; Xia, S.J.; Skog, S.; Sun, J. Effects of resveratrol on the expression and DNA methylation of cytokine genes in diabetic rat aortas. Arch. Immunol. Ther. Exp. 2014, 62, 329–340. [Google Scholar] [CrossRef] [Scilit]
- Yu, H.R.; Sheen, J.M.; Tiao, M.M.; Tain, Y.L.; Chen, C.C.; Lin, I.C.; Lai, Y.J.; Tsai, C.C.; Lin, Y.J.; Tsai, C.C.; et al. Resveratrol Treatment Ameliorates Leptin Resistance and Adiposity Programed by the Combined Effect of Maternal and Post-Weaning High-Fat Diet. Mol. Nutr. Food Res. 2019, 63, e1801385. [Google Scholar] [CrossRef] [Scilit]
- Jones, P.A. Functions of DNA methylation: Islands, start sites, gene bodies and beyond. Nat. Rev. Genet. 2012, 13, 484–492. [Google Scholar] [CrossRef] [Scilit]
- Appanah, R.; Dickerson, D.R.; Goyal, P.; Groudine, M.; Lorincz, M.C. An unmethylated 3’ promoter-proximal region is required for efficient transcription initiation. PLoS Genet. 2007, 3, e27. [Google Scholar] [CrossRef] [Scilit]
- Kulis, M.; Queiros, A.C.; Beekman, R.; Martin-Subero, J.I. Intragenic DNA methylation in transcriptional regulation, normal differentiation and cancer. Biochim. Biophys. Acta 2013, 1829, 1161–1174. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Mehran, A.E.; Templeman, N.M.; Brigidi, G.S.; Lim, G.E.; Chu, K.Y.; Hu, X.; Botezelli, J.D.; Asadi, A.; Hoffman, B.G.; Kieffer, T.J.; et al. Hyperinsulinemia drives diet-induced obesity independently of brain insulin production. Cell Metab. 2012, 16, 723–737. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Chen, P.; Piaggi, P.; Traurig, M.; Bogardus, C.; Knowler, W.C.; Baier, L.J.; Hanson, R.L. Differential methylation of genes in individuals exposed to maternal diabetes in utero. Diabetologia 2017, 60, 645–655. [Google Scholar] [CrossRef] [Scilit]
- Cote, S.; Gagne-Ouellet, V.; Guay, S.P.; Allard, C.; Houde, A.A.; Perron, P.; Baillargeon, J.P.; Gaudet, D.; Guerin, R.; Brisson, D.; et al. PPARGC1alpha gene DNA methylation variations in human placenta mediate the link between maternal hyperglycemia and leptin levels in newborns. Clin. Epigenetics 2016, 8, 72. [Google Scholar] [CrossRef] [Scilit]
- Tan, S.X.; Hu, R.C.; Xia, Q.; Tan, Y.L.; Liu, J.J.; Gan, G.X.; Wang, L.L. The methylation profiles of PRDM promoters in non-small cell lung cancer. OncoTargets Ther. 2018, 11, 2991–3002. [Google Scholar] [CrossRef] [Scilit]
- Rishi, V.; Bhattacharya, P.; Chatterjee, R.; Rozenberg, J.; Zhao, J.; Glass, K.; Fitzgerald, P.; Vinson, C. CpG methylation of half-CRE sequences creates C/EBPalpha binding sites that activate some tissue-specific genes. Proc. Natl. Acad. Sci. USA 2010, 107, 20311–20316. [Google Scholar] [CrossRef] [Scilit]
- Medvedeva, Y.A.; Khamis, A.M.; Kulakovskiy, I.V.; Ba-Alawi, W.; Bhuyan, M.S.; Kawaji, H.; Lassmann, T.; Harbers, M.; Forrest, A.R.; Bajic, V.B.; et al. Effects of cytosine methylation on transcription factor binding sites. BMC Genom. 2014, 15, 119. [Google Scholar] [CrossRef] [Scilit]
- Jornayvaz, F.R.; Shulman, G.I. Regulation of mitochondrial biogenesis. Essays Biochem. 2010, 47, 69–84. [Google Scholar] [CrossRef] [Scilit]
- Rouillard, A.D.; Gundersen, G.W.; Fernandez, N.F.; Wang, Z.; Monteiro, C.D.; McDermott, M.G.; Ma’ayan, A. The harmonizome: A collection of processed datasets gathered to serve and mine knowledge about genes and proteins. Database J. Biol. Databases Curation 2016, 2016. [Google Scholar] [CrossRef] [Scilit]
- Harmonizone. Available online: https://amp.pharm.mssm.edu/Harmonizome/gene_set/NRF1/ENCODE+Transcription+Factor+Targets (accessed on 5 February 2020).
- Lagouge, M.; Argmann, C.; Gerhart-Hines, Z.; Meziane, H.; Lerin, C.; Daussin, F.; Messadeq, N.; Milne, J.; Lambert, P.; Elliott, P.; et al. Resveratrol improves mitochondrial function and protects against metabolic disease by activating SIRT1 and PGC-1alpha. Cell 2006, 127, 1109–1122. [Google Scholar] [CrossRef] [Scilit]
- Chuang, Y.C.; Chen, S.D.; Hsu, C.Y.; Chen, S.F.; Chen, N.C.; Jou, S.B. Resveratrol Promotes Mitochondrial Biogenesis and Protects against Seizure-Induced Neuronal Cell Damage in the Hippocampus Following Status Epilepticus by Activation of the PGC-1alpha Signaling Pathway. Int. J. Mol. Sci. 2019, 20, 998. [Google Scholar] [CrossRef] [Scilit]
- Biala, A.; Tauriainen, E.; Siltanen, A.; Shi, J.; Merasto, S.; Louhelainen, M.; Martonen, E.; Finckenberg, P.; Muller, D.N.; Mervaala, E. Resveratrol induces mitochondrial biogenesis and ameliorates Ang II-induced cardiac remodeling in transgenic rats harboring human renin and angiotensinogen genes. Blood Press. 2010, 19, 196–205. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Wang, S.; Wan, T.; Ye, M.; Qiu, Y.; Pei, L.; Jiang, R.; Pang, N.; Huang, Y.; Liang, B.; Ling, W.; et al. Nicotinamide riboside attenuates alcohol induced liver injuries via activation of SirT1/PGC-1alpha/mitochondrial biosynthesis pathway. Redox Biol. 2018, 17, 89–98. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Chi, J.; Cohen, P. The Multifaceted Roles of PRDM16: Adipose Biology and Beyond. Trends Endocrinol. Metab. 2016, 27, 11–23. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Price, N.L.; Gomes, A.P.; Ling, A.J.; Duarte, F.V.; Martin-Montalvo, A.; North, B.J.; Agarwal, B.; Ye, L.; Ramadori, G.; Teodoro, J.S.; et al. SIRT1 is required for AMPK activation and the beneficial effects of resveratrol on mitochondrial function. Cell Metab. 2012, 15, 675–690. [Google Scholar] [CrossRef] [Scilit]
- Canto, C.; Houtkooper, R.H.; Pirinen, E.; Youn, D.Y.; Oosterveer, M.H.; Cen, Y.; Fernandez-Marcos, P.J.; Yamamoto, H.; Andreux, P.A.; Cettour-Rose, P.; et al. The NAD(+) precursor nicotinamide riboside enhances oxidative metabolism and protects against high-fat diet-induced obesity. Cell Metab. 2012, 15, 838–847. [Google Scholar] [CrossRef] [Scilit]
- Ions, L.J.; Wakeling, L.A.; Bosomworth, H.J.; Hardyman, J.E.; Escolme, S.M.; Swan, D.C.; Valentine, R.A.; Mathers, J.C.; Ford, D. Effects of Sirt1 on DNA methylation and expression of genes affected by dietary restriction. Age (Dordr) 2013, 35, 1835–1849. [Google Scholar] [CrossRef] [Scilit]
- Wakeling, L.A.; Ions, L.J.; Escolme, S.M.; Cockell, S.J.; Su, T.; Dey, M.; Hampton, E.V.; Jenkins, G.; Wainwright, L.J.; McKay, J.A.; et al. SIRT1 affects DNA methylation of polycomb group protein target genes, a hotspot of the epigenetic shift observed in ageing. Hum. Genom. 2015, 9, 14. [Google Scholar] [CrossRef] [Scilit]
- Heo, J.; Lim, J.; Lee, S.; Jeong, J.; Kang, H.; Kim, Y.; Kang, J.W.; Yu, H.Y.; Jeong, E.M.; Kim, K.; et al. Sirt1 Regulates DNA Methylation and Differentiation Potential of Embryonic Stem Cells by Antagonizing Dnmt3l. Cell Rep. 2017, 18, 1930–1945. [Google Scholar] [CrossRef] [Scilit]
- Peng, L.; Yuan, Z.; Ling, H.; Fukasawa, K.; Robertson, K.; Olashaw, N.; Koomen, J.; Chen, J.; Lane, W.S.; Seto, E. SIRT1 deacetylates the DNA methyltransferase 1 (DNMT1) protein and alters its activities. Mol. Cell. Biol. 2011, 31, 4720–4734. [Google Scholar] [CrossRef] [Scilit]
- Jing, H.; Lin, H. Sirtuins in epigenetic regulation. Chem. Rev. 2015, 115, 2350–2375. [Google Scholar] [CrossRef] [Scilit]






| Gene | Region | Gene Forward (f) and Reverse (r) Primers (5′→3′) | Amplicon Size (bp) | Total Number of CpGs | Number of CpGs Analyzed |
|---|---|---|---|---|---|
| Slc27a1 | BS1 | f: TGTTTTTATGGTGAGGAGAGGAAAATATGT | 392 | 5 | 5 |
| r: TTACCCAAAAAACAAAAAATCCTAAAATCC | |||||
| BS2 | f: GTGGGGTAAAGGGTATAGGAGATGTTTTAG | 356 | 7 | 4 | |
| r: CCTTCCCACAACTCTCCTTAAAAAAAA | |||||
| BS3 | f: TTTTGATAGTAAGGGTGGGGGTATTTTAGTA | 39 | 9 | 7 | |
| r: ACCTAATCCAACTTATCCTAAATCCAAACC | |||||
| BS4 | f: GATTTAGGATAAGTTGGATTAGGTAAGTTT | 401 | 25 | 20 | |
| r: ACAATCACTATTCACAAAAAAACCC | |||||
| Prdm16 | BS | f: ATTTAAGGAAGTTGTGTAGAAATTT | 508 | 37 | 18 |
| r: CCTTAAATCACATAATATCAACTCA |
© 2020 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Serrano, A.; Asnani-Kishnani, M.; Couturier, C.; Astier, J.; Palou, A.; Landrier, J.-F.; Ribot, J.; Bonet, M.L. DNA Methylation Changes are Associated with the Programming of White Adipose Tissue Browning Features by Resveratrol and Nicotinamide Riboside Neonatal Supplementations in Mice. Nutrients 2020, 12, 461. https://doi.org/10.3390/nu12020461
Serrano A, Asnani-Kishnani M, Couturier C, Astier J, Palou A, Landrier J-F, Ribot J, Bonet ML. DNA Methylation Changes are Associated with the Programming of White Adipose Tissue Browning Features by Resveratrol and Nicotinamide Riboside Neonatal Supplementations in Mice. Nutrients. 2020; 12(2):461. https://doi.org/10.3390/nu12020461
Chicago/Turabian StyleSerrano, Alba, Madhu Asnani-Kishnani, Charlene Couturier, Julien Astier, Andreu Palou, Jean-François Landrier, Joan Ribot, and M. Luisa Bonet. 2020. "DNA Methylation Changes are Associated with the Programming of White Adipose Tissue Browning Features by Resveratrol and Nicotinamide Riboside Neonatal Supplementations in Mice" Nutrients 12, no. 2: 461. https://doi.org/10.3390/nu12020461
APA StyleSerrano, A., Asnani-Kishnani, M., Couturier, C., Astier, J., Palou, A., Landrier, J.-F., Ribot, J., & Bonet, M. L. (2020). DNA Methylation Changes are Associated with the Programming of White Adipose Tissue Browning Features by Resveratrol and Nicotinamide Riboside Neonatal Supplementations in Mice. Nutrients, 12(2), 461. https://doi.org/10.3390/nu12020461

