Whether AICAR in Pregnancy or Lactation Prevents Hypertension Programmed by High Saturated Fat Diet: A Pilot Study
Abstract
1. Introduction
2. Materials and Methods
2.1. Animal Models
2.2. High-Performance Liquid Chromatography (HPLC)
2.3. Quantitative Real-Time Polymerase Chain Reaction (PCR)
2.4. Western Blot
2.5. Immunohistochemistry Staining
2.6. Statistical Analysis
3. Results
4. Discussion
5. Conclusions
Author Contributions
Funding
Acknowledgments
Conflicts of Interest
References
- Luyckx, V.A.; Bertram, J.F.; Brenner, B.M.; Fall, C.; Hoy, W.E.; Ozanne, S.E.; Vikse, B.E. Effect of fetal and child health on kidney development and long-term risk of hypertension and kidney disease. Lancet 2013, 382, 273–283. [Google Scholar] [CrossRef] [Scilit]
- Barker, D.J.; Bagby, S.P.; Hanson, M.A. Mechanisms of disease: In utero programming in the pathogenesis of hypertension. Nat. Clin. Pract. Nephrol. 2006, 2, 700–707. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Kett, M.M.; Denton, K.M. Renal programming: Cause for concern? Am. J. Physiol. Regul. Integr. Comp. Physiol. 2011, 300, R791–R803. [Google Scholar] [CrossRef] [Scilit]
- Tain, Y.L.; Joles, J.A. Reprogramming: A preventive strategy in hypertension focusing on the kidney. Int. J. Mol. Sci. 2015, 17, 23. [Google Scholar] [CrossRef] [Scilit]
- Buettner, R.; Schölmerich, J.; Bollheimer, L.C. High-fat diets: Modeling the metabolic disorders of human obesity in rodents. Obesity 2007, 15, 798–808. [Google Scholar] [CrossRef] [Scilit]
- Torrens, C.; Ethirajan, P.; Bruce, K.D.; Cagampang, F.R.; Siow, R.C.; Hanson, M.A.; Byrne, C.D.; Mann, G.E.; Clough, G.F. Interaction between maternal and offspring diet to impair vascular function and oxidative balance in high fat fed male mice. PLoS ONE 2012, 7. [Google Scholar] [CrossRef] [Scilit]
- Tain, Y.L.; Lin, Y.J.; Sheen, J.M.; Yu, H.R.; Tiao, M.M.; Chen, C.C.; Tsai, C.C.; Huang, L.T.; Hsu, C.N. High fat diets sex-specifically affect the renal transcriptome and program obesity, kidney injury, and hypertension in the offspring. Nutrients 2017, 9, 357. [Google Scholar] [CrossRef] [Scilit]
- Williams, L.; Seki, Y.; Vuguin, P.M.; Charron, M.J. Animal models of in utero exposure to a high fat diet: A review. Biochim. Biophys. Acta 2014, 1842, 507–519. [Google Scholar] [CrossRef] [Scilit]
- Khan, I.Y.; Taylor, P.D.; Dekou, V.; Seed, P.T.; Lakasing, L.; Graham, D.; Dominiczak, A.F.; Hanson, M.A.; Poston, L. Gender-linked hypertension in offspring of lard-fed pregnant rats. Hypertension 2003, 41, 168–175. [Google Scholar] [CrossRef] [Scilit]
- Buettner, R.; Parhofer, K.G.; Woenckhaus, M.; Wrede, C.E.; Kunz-Schughart, L.A.; Schölmerich, J.; Bollheimer, L.C. Defining high-fat-diet rat models: Metabolic and molecular effects of different fat types. J. Mol. Endocrinol. 2006, 36, 485–501. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Tain, Y.L.; Hsu, C.N. Targeting on asymmetric dimethylarginine related nitric oxide-reactive oxygen species imbalance to reprogram the development of hypertension. Int. J. Mol. Sci. 2016, 17, 2020. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Tain, Y.L.; Hsu, C.N. Interplay between oxidative stress and nutrient sensing signaling in the developmental origins of cardiovascular disease. Int. J. Mol. Sci. 2017, 18, 841. [Google Scholar] [CrossRef] [Scilit]
- Efeyan, A.; Comb, W.C.; Sabatini, D.M. Nutrient-sensing mechanisms and pathways. Nature 2015, 517, 302–310. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Hardie, D.G.; Ross, F.A.; Hawley, S.A. AMPK: A nutrient and energy sensor that maintains energy homeostasis. Nat. Rev. Mol. Cell Biol. 2012, 13, 251–262. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Rajani, R.; Pastor-Soler, N.M.; Hallows, K.R. Role of AMP-activated protein kinase in kidney tubular transport, metabolism, and disease. Curr. Opin. Nephrol. Hypertens. 2017, 26, 375–383. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Cho, K.J.; Casteel, D.E.; Prakash, P.; Tan, L.; van der Hoeven, D.; Salim, A.A.; Kim, C.; Capon, R.J.; Lacey, E.; Cunha, S.R.; et al. AMPK and Endothelial Nitric Oxide Synthase Signaling Regulates K-Ras Plasma Membrane Interactions via Cyclic GMP-Dependent Protein Kinase 2. Mol. Cell Biol. 2016, 36, 3086–3099. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Lindholm, C.R.; Ertel, R.L.; Bauwens, J.D.; Schmuck, E.G.; Mulligan, J.D.; Saupe, K.W. A high-fat diet decreases AMPK activity in multiple tissues in the absence of hyperglycemia or systemic inflammation in rats. J. Physiol. Biochem. 2013, 69, 165–175. [Google Scholar] [CrossRef] [Scilit]
- Tain, Y.L.; Wu, K.L.H.; Lee, W.C.; Leu, S.; Chan, J.Y.H. Prenatal Metformin Therapy Attenuates Hypertension of Developmental Origin in Male Adult Offspring Exposed to Maternal High-Fructose and Post-Weaning High-Fat Diets. Int. J. Mol. Sci. 2018, 19, 1066. [Google Scholar] [CrossRef] [Scilit]
- Ford, R.J.; Teschke, S.R.; Reid, E.B.; Durham, K.K.; Kroetsch, J.T.; Rush, J.W. AMP-activated protein kinase activator AICAR acutely lowers blood pressure and relaxes isolated resistance arteries of hypertensive rats. J. Hypertens. 2012, 30, 725–733. [Google Scholar] [CrossRef] [Scilit]
- Grigore, D.; Ojeda, N.B.; Alexander, B.T. Sex differences in the fetal programming of hypertension. Gend. Med. 2008, 5, S121–S132. [Google Scholar] [CrossRef] [Scilit]
- Banek, C.T.; Bauer, A.J.; Needham, K.M.; Dreyer, H.C.; Gilbert, J.S. AICAR administration ameliorates hypertension and angiogenic imbalance in a model of preeclampsia in the rat. Am. J. Physiol. Heart Circ. Physiol. 2013, 304, H1159–H1165. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Bode-Böger, S.M.; Scalera, F.; Ignarro, L.J. The L-arginine paradox: Importance of the L-arginine/asymmetrical dimethylarginine ratio. Pharmacol. Ther. 2007, 114, 295–306. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Steinberg, G.R.; Carling, D. AMP-activated protein kinase: The current landscape for drug development. Nat. Rev. Drug Discov. 2019. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Care, A.S.; Sung, M.M.; Panahi, S.; Gragasin, F.S.; Dyck, J.R.; Davidge, S.T.; Bourque, S.L. Perinatal Resveratrol Supplementation to Spontaneously Hypertensive Rat Dams Mitigates the Development of Hypertension in Adult Offspring. Hypertension 2016, 67, 1038–1044. [Google Scholar] [CrossRef] [Scilit]
- Tain, Y.L.; Lin, Y.J.; Sheen, J.M.; Lin, I.C.; Yu, H.R.; Huang, L.T.; Hsu, C.N. Resveratrol prevents the combined maternal plus postweaning high-fat-diets-induced hypertension in male offspring. J. Nutr. Biochem. 2017, 48, 120–127. [Google Scholar] [CrossRef] [Scilit]
- Tain, Y.L.; Hsu, C.N. AMP-Activated Protein Kinase as a Reprogramming Strategy for Hypertension and Kidney Disease of Developmental Origin. Int. J. Mol. Sci. 2018, 19, 1744. [Google Scholar] [CrossRef] [Scilit]
- Van Den Neste, E.; Cazin, B.; Janssens, A.; González-Barca, E.; Terol, M.J.; Levy, V.; Pérez de Oteyza, J.; Zachee, P.; Saunders, A.; de Frias, M.; et al. Acadesine for patients with relapsed/refractory chronic lymphocytic leukemia (CLL): A multicenter phase I/II study. Cancer Chemother. Pharmacol. 2013, 71, 581–591. [Google Scholar] [CrossRef] [Scilit]
- Ceschin, J.; Hürlimann, H.C.; Saint-Marc, C.; Albrecht, D.; Violo, T.; Moenner, M.; Daignan-Fornier, B.; Pinson, B. Disruption of Nucleotide Homeostasis by the Antiproliferative Drug 5-Aminoimidazole-4-carboxamide-1-β-d-ribofuranoside Monophosphate (AICAR). J. Biol. Chem. 2015, 290, 23947–23959. [Google Scholar] [CrossRef] [Scilit]
- Tain, Y.L.; Hsu, C.N.; Chan, J.Y. PPARs Link Early Life Nutritional insults to later programmed hypertension and metabolic syndrome. Int. J. Mol. Sci. 2015, 17, 20. [Google Scholar] [CrossRef] [Scilit]
- Wang, S.; Liang, B.; Viollet, B.; Zou, M.H. Inhibition of the AMP-activated protein kinase-α2 accentuates agonist-induced vascular smooth muscle contraction and high blood pressure in mice. Hypertension 2011, 57, 1010–1017. [Google Scholar] [CrossRef] [Scilit]
- Chen, H.E.; Lin, Y.J.; Lin, I.C.; Yu, H.R.; Sheen, J.M.; Tsai, C.C.; Huang, L.T.; Tain, Y.L. Resveratrol prevents combined prenatal NG-Nitro-L-arginine-methyl ester (L-NAME) treatment plus postnatal high-fat diet induced programmed hypertension in adult rat offspring: Interplay between nutrient-sensing signals, oxidative stress and gut microbiota. J. Nutr. Biochem. 2019, 70, 28–37. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Tsai, C.M.; Kuo, H.C.; Hsu, C.N.; Huang, L.T.; Tain, Y.L. Metformin reduces asymmetric dimethylarginine and prevents hypertension in spontaneously hypertensive rats. Transl. Res. 2014, 164, 452–459. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Tain, Y.L.; Hsu, C.N. Toxic Dimethylarginines: Asymmetric Dimethylarginine (ADMA) and Symmetric Dimethylarginine (SDMA). Toxins (Basel) 2017, 9, 92. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Hu, L.; Su, L.; Dong, Z.; Wu, Y.; Lv, Y.; George, J.; Wang, J. AMPK agonist AICAR ameliorates portal hypertension and liver cirrhosis via NO pathway in the BDL rat model. J. Mol. Med. (Berl) 2019, 97, 423–434. [Google Scholar] [CrossRef] [Scilit]
- Trewin, A.J.; Berry, B.J.; Wojtovich, A.P. Exercise and Mitochondrial Dynamics: Keeping in Shape with ROS and AMPK. Antioxidants 2018, 7, 7. [Google Scholar] [CrossRef] [Scilit]
- Song, P.; Zou, M.H. Regulation of NAD(P)H oxidases by AMPK in cardiovascular systems. Free Radic. Biol. Med. 2012, 52, 1607–1619. [Google Scholar] [CrossRef] [Scilit]
- Philippe, C.; Pinson, B.; Dompierre, J.; Pantesco, V.; Viollet, B.; Daignan-Fornier, B.; Moenner, M. AICAR Antiproliferative Properties Involve the AMPK-Independent Activation of the Tumor Suppressors LATS 1 and 2. Neoplasia 2018, 20, 555–562. [Google Scholar] [CrossRef] [Scilit]






| Gene | Reverse | |
|---|---|---|
| Sirt1 | 5 tggagcaggttgcaggaatcca 3 | 5 tggcttcatgatggcaagtggc 3 |
| Sirt4 | 5 ccctttggaccatgaaaaga 3 | 5 cggatgaaatcaatgtgctg 3 |
| Prkaa2 | 5 agctcgcagtggcttatcat 3 | 5 ggggctgtctgctatgagag 3 |
| Prkab2 | 5 cagggccttatggtcaagaa 3 | 5 cagcgcatagagatggttca 3 |
| Prkag2 | 5 gtgtgggagaagctctgagg 3 | 5 agaccacacccagaagatgc 3 |
| Ppara | 5 agaagttgcaggaggggatt 3 | 5 ttcttgatgacctgcacgag 3 |
| Pparrb | 5 gatcagcgtgcatgtgttct 3 | 5 cagcagtccgtctttgttga 3 |
| Pparg | 5 ctttatggagcctaagtttgagt 3 | 5 gttgtcttggatgtcctcg 3 |
| Ppargc1a | 5 cccattgagggctgtgatct 3 | 5 tcagtgaaatgccggagtca 3 |
| Rn18s | 5 gccgcggtaattccagctcca 3 | 5 cccgcccgctcccaagatc 3 |
| Groups | Control | HFD | AICAR/P | HFD + AICAR/L | HFD + AICAR/P |
|---|---|---|---|---|---|
| Number | 7 | 8 | 8 | 8 | 8 |
| BW (g) | 610 ± 12 | 793 ± 17 a | 606 ± 19 | 588 ± 26 b | 644 ± 22 |
| Left kidney weight (g) | 2.36 ± 0.06 | 1.7 ± 0.06 a | 2.02 ± 0.04 | 1.77 ± 0.07 a | 1.5 ± 0.08 a,c |
| Left kidney weight/100 g BW | 0.39 ± 0.01 | 0.31 ± 0.01 a | 0.36 ± 0.01 | 0.31 ± 0.02 a | 0.29 ± 0.01 a,c |
| Systolic blood pressure (mm Hg) | 139 ± 1 | 164 ± 1 a | 143 ± 1 | 146 ± 1 b | 144 ± 1 c |
| Groups | Control | HFD | AICAR/P | HFD + AICAR/L | HFD + AICAR/P |
|---|---|---|---|---|---|
| L-citrulline | 59.7 ± 4.5 | 53.7 ± 3.4 | 55.1 ± 4.6 | 57.1 ± 3.1 | 62.7 ± 3 |
| L-arginine | 141.4 ± 6.2 | 104.6 ± 4.4 a | 171.2 ± 10.6 a | 115.5 ± 3.3 a | 140.2 ± 7.2 c |
| ADMA | 1.35 ± 0.12 | 1.42 ± 0.09 | 1.73 ± 0.11 a | 1.53 ± 0.06 | 1.19 ± 0.07 |
| SDMA | 0.57 ± 0.11 | 0.7 ± 0.03 | 0.7 ± 0.06 | 0.52 ± 0.02 b | 0.49 ± 0.05 c |
| L-arginine-to-ADMA ratio | 110 ± 12 | 75 ± 3 a | 99 ± 3 | 76 ± 3 a | 118 ± 4 c |
© 2020 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Tsai, W.-L.; Hsu, C.-N.; Tain, Y.-L. Whether AICAR in Pregnancy or Lactation Prevents Hypertension Programmed by High Saturated Fat Diet: A Pilot Study. Nutrients 2020, 12, 448. https://doi.org/10.3390/nu12020448
Tsai W-L, Hsu C-N, Tain Y-L. Whether AICAR in Pregnancy or Lactation Prevents Hypertension Programmed by High Saturated Fat Diet: A Pilot Study. Nutrients. 2020; 12(2):448. https://doi.org/10.3390/nu12020448
Chicago/Turabian StyleTsai, Wan-Long, Chien-Ning Hsu, and You-Lin Tain. 2020. "Whether AICAR in Pregnancy or Lactation Prevents Hypertension Programmed by High Saturated Fat Diet: A Pilot Study" Nutrients 12, no. 2: 448. https://doi.org/10.3390/nu12020448
APA StyleTsai, W.-L., Hsu, C.-N., & Tain, Y.-L. (2020). Whether AICAR in Pregnancy or Lactation Prevents Hypertension Programmed by High Saturated Fat Diet: A Pilot Study. Nutrients, 12(2), 448. https://doi.org/10.3390/nu12020448

