Filbertone Ameliorates Adiposity in Mice Fed a High-Fat Diet via Activation of cAMP Signaling
Abstract
:1. Introduction
2. Materials and Methods
2.1. Reagents
2.2. Animal Experiments
2.3. Oral Glucose Tolerance Test
2.4. Histopathological Examinations
2.5. Biochemical Analysis
2.6. cAMP Assay
2.7. Western Blot Assay
2.8. Quantitative Real-Time PCR
2.9. Cell Culture and Treatment
2.10. MTT Assay
2.11. Oil Red O Staining
2.12. Cellular Metabolic Rates
2.13. Statistical Analyses
3. Results
3.1. Filbertone Reduced Both HFD-Induced Weight Gain and Adiposity
3.2. Filbertone Improved Obesity-Related Biochemical Parameters
3.3. Filbertone Activated the cAMP-PKA Signaling Pathway in Adipose Tissue
3.4. Filbertone Inhibited 3T3-L1 Adipocyte Differentiation by Upregulating cAMP
4. Discussion
5. Conclusions
Author Contributions
Funding
Conflicts of Interest
References
- Crowley, V.E.; Yeo, G.S.; O’Rahilly, S. Obesity therapy: Altering the energy intake-and-expenditure balance sheet. Nat. Rev. Drug. Discov. 2002, 1, 276–286. [Google Scholar] [CrossRef] [PubMed]
- Castro, A.V.; Kolka, C.M.; Kim, S.P.; Bergman, R.N. Obesity, insulin resistance and comorbidities? Mechanisms of association. Arq. Bras. Endocrinol. Metabol. 2014, 58, 600–609. [Google Scholar] [CrossRef] [PubMed]
- Fabbrini, E.; Sullivan, S.; Klein, S. Obesity and nonalcoholic fatty liver disease: biochemical, metabolic, and clinical implications. Hepatology 2010, 51, 679–689. [Google Scholar] [CrossRef] [PubMed]
- Guebre-Egziabher, F.; Alix, P.M.; Koppe, L.; Pelletier, C.C.; Kalbacher, E.; Fouque, D.; Soulage, C.O. Ectopic lipid accumulation: A potential cause for metabolic disturbances and a contributor to the alteration of kidney function. Biochimie 2013, 95, 1971–1979. [Google Scholar] [CrossRef] [PubMed]
- Tong, T.; Shen, Y.; Lee, H.W.; Yu, R.; Park, T. Adenylyl cyclase 3 haploinsufficiency confers susceptibility to diet-induced obesity and insulin resistance in mice. Sci. Rep. 2016, 6, 34179. [Google Scholar] [CrossRef] [PubMed]
- Tong, T.; Yu, R.; Park, T. alpha-Cedrene protects rodents from high-fat diet-induced adiposity via adenylyl cyclase 3. Int. J. Obes. Lond 2019, 43, 202–216. [Google Scholar] [CrossRef] [PubMed]
- Rogne, M.; Tasken, K. Compartmentalization of cAMP signaling in adipogenesis, lipogenesis, and lipolysis. Horm. Metab. Res. 2014, 46, 833–840. [Google Scholar] [CrossRef] [PubMed]
- Pitman, J.L.; Wheeler, M.C.; Lloyd, D.J.; Walker, J.R.; Glynne, R.J.; Gekakis, N. A Gain-of-Function Mutation in Adenylate Cyclase 3 Protects Mice from Diet-Induced Obesity. PLoS ONE 2014, 9, e110226. [Google Scholar] [CrossRef]
- Bachman, E.S.; Dhillon, H.; Zhang, C.Y.; Cinti, S.; Bianco, A.C.; Kobilka, B.K.; Lowell, B.B. betaAR signaling required for diet-induced thermogenesis and obesity resistance. Science 2002, 297, 843–845. [Google Scholar] [CrossRef]
- Chen, M.; Gavrilova, O.; Liu, J.; Xie, T.; Deng, C.X.; Nguyen, A.T.; Nackers, L.M.; Lorenzo, J.; Shen, L.; Weinstein, L.S. Alternative Gnas gene products have opposite effects on glucose and lipid metabolism. Proc. Natl. Acad. Sci. USA 2005, 102, 7386–7391. [Google Scholar] [CrossRef]
- Li, F.Q.; Wang, D.M.; Zhou, Y.R.; Zhou, B.; Yang, Y.A.; Chen, H.H.; Song, J.G. Protein kinase A suppresses the differentiation of 3T3-L1 preadipocytes. Cell Res. 2008, 18, 311–323. [Google Scholar] [CrossRef] [Green Version]
- Puchl’ova, E.; Szolcsanyi, P. Filbertone: A Review. J. Agric. Food Chem. 2018, 66, 11221–11226. [Google Scholar] [CrossRef] [PubMed]
- Burdock, G.A.; Wagner, B.M.; Smith, R.L.; Munro, I.C.; Newberne, P.M. Recent Progress in the Consideration of Flavoring Ingredients under the Food-Additives Amendment. 15. Gras Substances. Food Technol. Chicago 1990, 44, 78–86. [Google Scholar]
- Hemati, N.; Ross, S.E.; Erickson, R.L.; Groblewski, G.E.; MacDougald, O.A. Signaling pathways through which insulin regulates CCAAT/enhancer binding protein α (C/EBPα) phosphorylation and gene expression in 3T3-L1 adipocytes correlation with GLUT4 gene Expression. J. Biol. Chem. 1997, 272, 25913–25919. [Google Scholar] [CrossRef] [PubMed]
- Reagan-Shaw, S.; Nihal, M.; Ahmad, N. Dose translation from animal to human studies revisited. Faseb J. 2008, 22, 659–661. [Google Scholar] [CrossRef] [PubMed]
- Madsen, L.; Kristiansen, K. The importance of dietary modulation of cAMP and insulin signaling in adipose tissue and the development of obesity. Ann. NY Acad. Sci. 2010, 1190, 1–14. [Google Scholar] [CrossRef]
- Carmen, G.Y.; Victor, S.M. Signalling mechanisms regulating lipolysis. Cell. Signal. 2006, 18, 401–408. [Google Scholar] [CrossRef] [PubMed]
- Yin, W.; Mu, J.; Birnbaum, M.J. Role of AMP-activated protein kinase in cyclic AMP-dependent lipolysis in 3T3-L1 adipocytes. J. Biol. Chem. 2003, 278, 43074–43080. [Google Scholar] [CrossRef]
- Habinowski, S.A.; Witters, L.A. The effects of AICAR on adipocyte differentiation of 3T3-L1 cells. Biochem. Biophys. Res. Commun. 2001, 286, 852–856. [Google Scholar] [CrossRef]
- Catania, C.; Binder, E.; Cota, D. mTORC1 signaling in energy balance and metabolic disease. Int. J. Obes. Lond 2011, 35, 751–761. [Google Scholar] [CrossRef]
- Alberini, C.M. Transcription Factors in Long-Term Memory and Synaptic Plasticity. Physiol. Rev. 2009, 89, 121–145. [Google Scholar] [CrossRef] [PubMed]
- Cao, W.H.; Daniel, K.W.; Robidoux, J.; Puigserver, P.; Medvedev, A.V.; Bai, X.; Floering, L.M.; Spiegelman, B.M.; Collins, S. p38 mitogen-activated protein kinase is the central regulator of cyclic AMP-dependent transcription of the brown fat uncoupling protein 1 gene. Mol. Cell. Biol. 2004, 24, 3057–3067. [Google Scholar] [CrossRef] [PubMed]
- Buck, L.; Axel, R. A Novel Multigene Family May Encode Odorant Receptors a Molecular-Basis for Odor Recognition. Cell 1991, 65, 175–187. [Google Scholar] [CrossRef]
- Tong, T.; Kim, M.; Park, T. alpha-Cedrene, a Newly Identified Ligand of MOR23, Increases Skeletal Muscle Mass and Strength. Mol. Nutr. Food Res. 2018, 62, e1800173. [Google Scholar] [CrossRef] [PubMed]
- Tong, T.; Ryu, S.E.; Min, Y.; de March, C.A.; Bushdid, C.; Golebiowski, J.; Moon, C.; Park, T. Olfactory receptor 10J5 responding to alpha-cedrene regulates hepatic steatosis via the cAMP-PKA pathway. Sci. Rep. UK 2017, 7. [Google Scholar] [CrossRef]
- Braun, T.; Voland, P.; Kunz, L.; Prinz, C.; Gratzl, M. Enterochromaffin cells of the human gut: Sensors for spices and odorants. Gastroenterology 2007, 132, 1890–1901. [Google Scholar] [CrossRef]
- Fukuda, N.; Yomogida, K.; Okabe, M.; Touhara, K. Functional characterization of a mouse testicular olfactory receptor and its role in chemosensing and in regulation of sperm motility. J. Cell. Sci. 2004, 117, 5835–5845. [Google Scholar] [CrossRef] [Green Version]
- Tong, T.; Park, J.; Moon, C.; Park, T. Regulation of Adipogenesis and Thermogenesis through Mouse Olfactory Receptor 23 Stimulated by alpha-Cedrene in 3T3-L1 Cells. Nutrients 2018, 10, 1781. [Google Scholar] [CrossRef]
- Busse, D.; Kudella, P.; Gruning, N.M.; Gisselmann, G.; Stander, S.; Luger, T.; Jacobsen, F.; Steinstrasser, L.; Paus, R.; Gkogkolou, P.; et al. A Synthetic Sandalwood Odorant Induces Wound-Healing Processes in Human Keratinocytes via the Olfactory Receptor OR2AT4. J. Invest. Dermatol. 2014, 134, 2823–2832. [Google Scholar] [CrossRef] [Green Version]
- Jain, N.; Thatte, J.; Braciale, T.; Ley, K.; O’Connell, M.; Lee, J.K. Local-pooled-error test for identifying differentially expressed genes with a small number of replicated microarrays. Bioinformatics 2003, 19, 1945–1951. [Google Scholar] [CrossRef]
- Storey, J.D.; Tibshirani, R. Statistical methods for identifying differentially expressed genes in DNA microarrays. In Functional Genomics; Springer: Berlin, Germany, 2003; pp. 149–157. [Google Scholar]
- Hansen, P.A.; Han, D.H.; Nolte, L.A.; Chen, M.; Holloszy, J.O. DHEA protects against visceral obesity and muscle insulin resistance in rats fed a high-fat diet. Am. J. Physiol. Regul. Integr. Comp. Physiol. 1997, 273, R1704–R1708. [Google Scholar] [CrossRef] [PubMed]
- Nevzorova, J.; Bengtsson, T.; Evans, B.A.; Summers, R.J. Characterization of the β-adrenoceptor subtype involved in mediation of glucose transport in L6 cells. Br. J. Pharmacol. 2002, 137, 9–18. [Google Scholar] [CrossRef] [PubMed]
- Nevzorova, J.; Evans, B.A.; Bengtsson, T.; Summers, R.J. Multiple signalling pathways involved in β2-adrenoceptor-mediated glucose uptake in rat skeletal muscle cells. Br. J. Pharmacol. 2006, 147, 446–454. [Google Scholar] [CrossRef] [PubMed]
- Mukaida, S.; Evans, B.A.; Bengtsson, T.; Hutchinson, D.S.; Sato, M. Adrenoceptors promote glucose uptake into adipocytes and muscle by an insulin-independent signaling pathway involving mechanistic target of rapamycin complex 2. Pharmacol. Res. 2017, 116, 87–92. [Google Scholar] [CrossRef] [PubMed]
Type | Gene Description | Sequences (5′→3) |
---|---|---|
Mouse | CCAAT/enhancer binding-protein α (C/EBPα) | F: TCAGCTTACAACAGGCCAGG |
R: ACACAAGGCTAATGGTCCCC | ||
Adipocyte fatty acid binding protein (aP2) | F: CATGCGACAAAGGCAGAAAT | |
R: GTTACAAGGCAAGGAAGGGC | ||
Peroxisome proliferator-activated receptor γ2 (PPARγ2) | F: TTCGGAATCAGCTCTGTGGA | |
R: CCATTGGGTCAGCTCTTGTG | ||
Peroxisome proliferator-activated receptor gamma coactivator 1-alpha (PGC1α) | F: TAAATCTGCGGGATGATGGA | |
R: GTTTCGTTCGACCTGCGTAA | ||
PR domain containing 16 (PRDM16) | F: GGACCTTTTTGACAGCAGCA | |
R: GGGGGCAAAGCATTTAACTC | ||
Cell death activator CIDE-A (Cidea) | F: GGAATCTGCTGAGGTTTATG | |
R: ATCCCACAGCCTATAACAGA | ||
Uncoupling protein 1 (UCP1) | F: GGTTTGCACCACACTCCTG | |
R: ACATGGACATCGCACAGCTT | ||
Glyceraldehyde-3-phosphate dehydrogenase (GAPDH) | F: GTGATGGCATGGACTGTGGT | |
R: GGAGCCAAAAGGGTCATCAT |
© 2019 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Moon, Y.; Tong, T.; Kang, W.; Park, T. Filbertone Ameliorates Adiposity in Mice Fed a High-Fat Diet via Activation of cAMP Signaling. Nutrients 2019, 11, 1749. https://doi.org/10.3390/nu11081749
Moon Y, Tong T, Kang W, Park T. Filbertone Ameliorates Adiposity in Mice Fed a High-Fat Diet via Activation of cAMP Signaling. Nutrients. 2019; 11(8):1749. https://doi.org/10.3390/nu11081749
Chicago/Turabian StyleMoon, Youna, Tao Tong, Wesuk Kang, and Taesun Park. 2019. "Filbertone Ameliorates Adiposity in Mice Fed a High-Fat Diet via Activation of cAMP Signaling" Nutrients 11, no. 8: 1749. https://doi.org/10.3390/nu11081749