Next-Generation Sequencing Identifies Polyunsaturated Fatty Acid Responsive Genes in the Juvenile Rat Cerebellum
Abstract
1. Introduction
2. Materials and Methods
2.1. Reagents
2.2. Animals
2.3. cDNA Library Preparation
2.4. NGS Mapping and Data Normalization
2.5. qPCR Analysis
2.6. FA Analyses
2.7. Statistical Analysis
3. Results
3.1. Energy Intake and Body Composition
3.2. Cerebellar Fatty Acid Analysis
3.3. Next-generation Sequencing of Rat Cerebellum
3.4. Upper Quartile (UQ) Scaling Normalization
3.5. Transcripts per Million (TPM) Normalization
3.6. Comparison of UQ Scaling and TPM Normalization
3.7. Quantitative Real-Time PCR
4. Discussion
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Acknowledgments
Conflicts of Interest
Appendix A
Group | Sample | RQN |
---|---|---|
SO | 23,552 | 8.1 |
23,553 | 8.2 | |
23,554 | 7.0 | |
23,555 | 8.2 | |
23,556 | * | |
23,557 | 8.1 | |
23,558 | 8.2 | |
23,559 | 8.2 | |
23,560 | 8.4 | |
23,561 | 8.3 | |
CO | 23,562 | 8.1 |
23,563 | 7.7 | |
23,564 | 8.1 | |
23,565 | 8.3 | |
23,566 | 7.9 | |
23,568 | 8.2 | |
23,569 | 7.9 | |
23,570 | 6.6 | |
23,571 | 8.2 | |
23,567 | 8.6 |
Gene | Forward | Reverse |
---|---|---|
Meis3 | GCTCCTCTGACTCCTTCAATG | ATCCTCGATCACCAGGTCTAT |
Tmem214 | GCTGCAAGAGCTGGATAAGA | CTTTGGTGAGGTTGGGATACA |
Ralbp1 | ACCAAGATTGCACAGGAGATAG | CTGGGCAAGGAGGATATTTATGA |
Tmem42 | CCCTGATGTGGACCTTCTTTAG | CTAAGATGGCCGAGCAAAGTA |
Noa1 | CGGGCTATGGAGTTGAAGAA | AGGAGTCGGGTTGCAAATAG |
Phactr3 | CCGTGGAAGAACTGGAAAGA | CTTGTCTGCTCTCCTGTCATAG |
Trap1 | GCTGACCAGCTTATCAGACTAC | CTCCACAGAGATCAGCTTCTTC |
Amz2 | CTGCGACTAAGTGCTCCTTTA | CTTCACGCTGCCTTCATATTTC |
Smim17 | CAGCTGTGACAGTGATGAGAA | TGGAGCATCATGGGCATC |
Scamp3 | CAGGCACTCGACAGAACAA | GACAAAGGAGCAGGGAGTAAA |
Cpe | GAGTGGTACTGCTCACGAATAC | GGTCACGGACAAACCCTTTA |
Atp6v0c | CTTATCGCTAACTCCCTGACTG | AAGCACCTCCGCAAAGAT |
Gstt3 | CAGCATTACACTGATGCCTTTG | GTCAGGTGCCTTGTACTTTCT |
Nxph4 | CACCAAGAGAAAGCCATCCA | CAGCGAGAACTTGAGGGTATG |
Ldoc1 | TGCGAATACTGGTGTGTGAG | ACAGGAGGCTGATCAAGAATG |
Nr4a3 | GCAGAGCCTGAACCTTGATA | CATAGCTCCTCCACTCTCTTTG |
LOC100911248 | TGTCTCAGCACCCAACTTATC | CAACGTAAGGGACAGGAATCA |
Rps16 | CAAGTTACTGGAGCCTGTTCTG | CCGATCGTACTGGATGAGGATA |
Qrich2 | GGCCTTGATGGACACATCTATAA | CTGGAGCTTAGCCTTGTTGT |
Vps45 | CCCTGGACCATCTCATCAAAG | CATAGGTGGCTCCTCCAATAAC |
Cdc34 | GACCTCTTCTACGACGACTACTA | GCCAGAGTCATCCTCTTCATC |
mrpl9 | GTACTGGTGTGATGTGACAGTAA | GGCTAACCAGTGCTTGTATCT |
Gadd45gip1 | GCCCGATTCCAGGAACTATTAC | GCAATTCGAGCCTCCTTCTT |
Fbxw4 | TGCTTACACACCATCCAGAC | TGAGAAGTGCCCACAACAA |
Gtf2f2 | CCTGTGGGATACCTGAAAGAAA | CCTCTGTTTGGTAATGCCTGTA |
Pithd1 | GGGCAATGTCAAGCTCAAAG | GTCTGGCTCCCTTTCTGTATC |
Ppcs | CAGACCCGGACATCATCATTAG | GTCCTCAGACAGCAGTAACTTT |
Sh2b2 | GTGGTGTCAGTGAGAGCAATAA | GCCGTGACCATTCAGAGAAA |
Tgfa | CCAGATTCCCACACTCAGTATT | GGATCAGCACACAGGTGATAA |
Anp32b | GTCACTAACCGGAGTGATTACC | CATCTTCTTCCTCCTCACCATC |
Dusp1 | CTAACCACTTTGAGGGTCACTAC | GATAATACTCCGCCTCTGCTTC |
Nrn1 | GGGCGAAAGATATGTGGGATAA | CTGCCGCAGAGTTCGAATAA |
Asrgl1 | CAAGAAGCACCTGGAGAAAGA | GGCCAGATTCACCTTCAGAATA |
Opalin | GCTGGTAGCCTTGCTGTTTA | CCACCAAAGACCTCTTCTTCTC |
Ndufa9 | TCCGCTTTCAGGTTGTTAGAG | GCATCCCACTCCAGAAAGATAA |
Ndufa3 | AAAGAACCACAACTCCCAGAG | ACAGGTTCTTGAGCCATTCC |
Atp5g3 | GGAGAGGGCTCTACGGTATTTA | GAGACCCATAGCTTCAGACAAG |
Mpzl1 | GGCTCCATGTGGTGGAAATA | GTGGTCTAACTGTGCGTATATGA |
Atp6v1h | CCAAGAGTATGCTCTGGCTATG | CCACCGAGCTGCTCAATAA |
β-actin | GTGTGGATTGGTGGCTCTATC | CAGTCCGCCTAGAAGCATTT |
Appendix B
References
- Janssen, C.I.F.; Kiliaan, A.J. Long-chain polyunsaturated fatty acids (LCPUFA) from genesis to senescence: The influence of LCPUFA on neural development, aging, and neurodegeneration. Prog. Lipid Res. 2014, 53, 1–17. [Google Scholar] [CrossRef] [PubMed]
- Maekawa, M.; Takashima, N.; Matsumata, M.; Ikegami, S.; Kontani, M.; Hara, Y.; Kawashima, H.; Owada, Y.; Kiso, Y.; Yoshikawa, T.; et al. Arachidonic Acid Drives Postnatal Neurogenesis and Elicits a Beneficial Effect on Prepulse Inhibition, a Biological Trait of Psychiatric Illnesses. PLoS ONE 2009, 4, e5085. [Google Scholar] [CrossRef] [PubMed]
- Belkind-Gerson, J.; Carreon-Rodriguez, A.; Contreras-Ochoa, C.O.; Estrada-Mondaca, S.; Parra-Cabrera, M.S. Fatty acids and neurodevelopment. J. Pediatr. Gastroenterol. Nutr. 2008, 47, S7–S9. [Google Scholar] [CrossRef]
- Calderon, F.; Kim, H.Y. Docosahexaenoic acid promotes neurite growth in hippocampal neurons. J. Neurochem. 2004, 90, 979–988. [Google Scholar] [CrossRef] [PubMed]
- Cao, D.; Xue, R.; Xu, J.; Liu, Z. Effects of docosahexaenoic acid on the survival and neurite outgrowth of rat cortical neurons in primary cultures. J. Nutr. Biochem. 2005, 16, 538–546. [Google Scholar] [CrossRef]
- Bourre, J.M.; Pascal, G.; Durand, G.; Masson, M.; Dumont, O.; Piciotti, M. Alterations in the fatty acid composition of rat brain cells (neurons, astrocytes, and oligodendrocytes) and of subcellular fractions (myelin and synaptosomes) induced by a diet devoid of n-3 fatty acids. J. Neurochem. 1984, 43, 342–348. [Google Scholar] [CrossRef] [PubMed]
- Liu, J.W.; Almaguel, F.G.; Bu, L.; De Leon, D.D.; De Leon, M. Expression of E-FABP in PC12 cells increases neurite extension during differentiation: Involvement of n-3 and n-6 fatty acids. J. Neurochem. 2008, 106, 2015–2029. [Google Scholar] [CrossRef] [PubMed]
- Altman, J. Autoradiographic and histological studies of postnatal neurogenesis. 3. Dating the time of production and onset of differentiation of cerebellar microneurons in rats. J. Comp. Neurol. 1969, 136, 269–293. [Google Scholar] [CrossRef] [PubMed]
- Bandeira, F.; Lent, R.; Herculano-Houzel, S. Changing numbers of neuronal and non-neuronal cells underlie postnatal brain growth in the rat. Proc. Natl. Acad. Sci. USA 2009, 106, 14108–14113. [Google Scholar] [CrossRef] [PubMed]
- Ten Donkelaar, H.J.; Lammens, M.; Wesseling, P.; Thijssen, H.O.; Renier, W.O. Development and developmentaldisorders of the human cerebellum. J. Neurol. 2003, 250, 1025–1036. [Google Scholar] [CrossRef] [PubMed]
- Benjamini, Y.; Hochberg, Y. Controlling the False Discovery Rate: A Practical and Powerful Approach to Multiple Testing. J. R. Stat. Soc. Ser. B Stat. Methodol. 1995, 57, 289–300. [Google Scholar] [CrossRef]
- Ponnio, T.; Conneely, O.M. Nor-1 regulates hippocampal axon guidance, pyramidal cell survival, and seizure susceptibility. Mol. Cell. Biol. 2004, 24, 9070–9078. [Google Scholar] [CrossRef] [PubMed]
- Bridi, M.S.; Hawk, J.D.; Chatterjee, S.; Safe, S.; Abel, T. Pharmacological Activators of the NR4A Nuclear Receptors Enhance LTP in a CREB/CBP-Dependent Manner. Neuropsychopharmacology 2017, 42, 1243–1253. [Google Scholar] [CrossRef] [PubMed]
- Pearen, M.A.; Ryall, J.G.; Maxwell, M.A.; Ohkura, N.; Lynch, G.S.; Muscat, G.E.O. The Orphan Nuclear Receptor, NOR-1, Is a Target of β-Adrenergic Signaling in Skeletal Muscle. Endocrinology 2006, 147, 5217–5227. [Google Scholar] [CrossRef]
- Gao, W.; Fu, Y.; Yu, C.; Wang, S.; Zhang, Y.; Zong, C.; Xu, T.; Liu, Y.; Li, X.; Wang, X. Elevation of NR4A3 expression and its possible role in modulating insulin expression in the pancreatic beta cell. PLoS ONE 2014, 9, e91462. [Google Scholar] [CrossRef]
- Delion, S.; Chalon, S.; Guilloteau, D.; Besnard, J.C.; Durand, G. α-Linolenic Acid Dietary Deficiency Alters Age-Related Changes of Dopaminergic and Serotoninergic Neurotransmission in the Rat Frontal Cortex. J. Neurochem. 1996, 66, 1582–1591. [Google Scholar] [CrossRef]
- Butts, T.; Green, M.J.; Wingate, R.J. Development of the cerebellum: Simple steps to make a “little brain”. Development 2014, 141, 4031–4041. [Google Scholar] [CrossRef]
- Buckner Randy, L. The Cerebellum and Cognitive Function: 25 Years of Insight from Anatomy and Neuroimaging. Neuron 2013, 80, 807–815. [Google Scholar] [CrossRef]
- Neville, H.E.; Chase, H.P. Undernutrition and cerebellar development. Exp. Neurol. 1971, 33, 485–497. [Google Scholar] [CrossRef]
- Warren, M.A.; Bedi, K.S. The effects of a lengthy period of undernutrition from birth and subsequent nutritional rehabilitation on the granule-to-Purkinje cell ratio in the rat cerebellum. J. Anat. 1988, 159, 147–153. [Google Scholar]
- Weisinger, H.S.; Vingrys, A.J.; Sinclair, A.J. Dietary manipulation of long-chain polyunsaturated fatty acids in the retina and brain of guinea pigs. Lipids 1995, 30, 471–473. [Google Scholar] [CrossRef] [PubMed]
- Igarashi, M.; Kim, H.-W.; Gao, F.; Chang, L.; Ma, K.; Rapoport, S.I. Fifteen weeks of dietary n-3 polyunsaturated fatty acid deprivation increases turnover of n-6 docosapentaenoic acid in rat-brain phospholipids. Biochim. Biophys. Acta 2012, 1821, 1235–1243. [Google Scholar] [CrossRef] [PubMed]
- Ntambi, J.M.; Bené, H. Polyunsaturated fatty acid regulation of gene expression. J. Mol. Neurosci. 2001, 16, 273–278. [Google Scholar] [CrossRef]
- Kitajka, K.; Sinclair, A.J.; Weisinger, R.S.; Weisinger, H.S.; Mathai, M.; Jayasooriya, A.P.; Halver, J.E.; Puskás, L.G. Effects of dietary omega-3 polyunsaturated fatty acids on brain gene expression. Proc. Natl. Acad. Sci. USA 2004, 101, 10931–10936. [Google Scholar] [CrossRef] [PubMed]
- Varga, T.; Czimmerer, Z.; Nagy, L. PPARs are a unique set of fatty acid regulated transcription factors controlling both lipid metabolism and inflammation. Biochim. Biophys. Acta 2011, 1812, 1007–1022. [Google Scholar] [CrossRef]
- Kuperstein, F.; Yakubov, E.; Dinerman, P.; Gil, S.; Eylam, R.; Salem, N., Jr. Overexpression of dopamine receptor genes and their products in the postnatal rat brain following maternal n-3 fatty acid dietary deficiency. Overexpression of dopamine receptor genes and their products in the postnatal rat brain following maternal n-3 fatty acid dietary deficiency. J. Neurochem. 2005, 95, 1550–1562. [Google Scholar]
- Zimmer, L.; Delion-Vancassel, S.; Durand, G.; Guilloteau, D.; Bodard, S.; Besnard, J.C.; Chalon, S. Modification of dopamine neurotransmission in the nucleus accumbens of rats deficient in n-3 polyunsaturated fatty acids. J. Lipid Res. 2000, 41, 32–40. [Google Scholar]
- Kitajka, K.; Puskás, L.G.; Zvara, Á.; Hackler, L.; Barceló-Coblijn, G.; Yeo, Y.K.; Farkas, T. The role of n-3 polyunsaturated fatty acids in brain: Modulation of rat brain gene expression by dietary n-3 fatty acids. Proc. Natl. Acad. Sci. USA 2002, 99, 2619–2624. [Google Scholar] [CrossRef]
- Barceló-Coblijn, G.; Hőgyes, E.; Kitajka, K.; Puskás, L.G.; Zvara, Á.; Hackler, L.; Nyakas, C.; Penke, Z.; Farkas, T. Modification by docosahexaenoic acid of age-induced alterations in gene expression and molecular composition of rat brain phospholipids. Proc. Natl. Acad. Sci. USA 2003, 100, 11321. [Google Scholar] [CrossRef]
- Barceló-Coblijn, G.; Kitajka, K.; Puskás, L.G.; Hőgyes, E.; Zvara, A.; Hackler, L., Jr.; Farkas, T. Gene expression and molecular composition of phospholipids in rat brain in relation to dietary n-6 to n-3 fatty acid ratio. Biochim. Biophys. Acta 2003, 1632, 72–79. [Google Scholar]
- Puskás, L.G.; Kitajka, K.; Nyakas, C.; Barcelo-Coblijn, G.; Farkas, T. Short-term administration of omega 3 fatty acids from fish oil results in increased transthyretin transcription in old rat hippocampus. Proc. Natl. Acad. Sci. USA 2003, 100, 1580. [Google Scholar] [CrossRef] [PubMed]
- Hurd, P.J.; Nelson, C.J. Advantages of next-generation sequencing versus the microarray in epigenetic research. Brief. Funct. Genom. 2009, 8, 174–183. [Google Scholar] [CrossRef] [PubMed]
- Liu, H.; Bebu, I.; Li, X. Microarray probes and probe sets. Front. Biosci. (Elite Ed) 2010, 2, 325–338. [Google Scholar] [CrossRef] [PubMed]
- Workman, A.D.; Charvet, C.J.; Clancy, B.; Darlington, R.B.; Finlay, B.L. Modeling Transformations of Neurodevelopmental Sequences across Mammalian Species. J. Neurosci. 2013, 33, 7368. [Google Scholar] [CrossRef]
- Picklo, M.J., Sr.; Johnson, L.; Idso, J. PPAR mRNA Levels Are Modified by Dietary n-3 Fatty Acid Restriction and Energy Restriction in the Brain and Liver of Growing Rats. J. Nutr. 2017, 147, 161–169. [Google Scholar] [CrossRef] [PubMed]
- Reeves, P.G. Components of the AIN-93 diets as improvements in the AIN-76A diet. J. Nutr. 1997, 127, 838s–841s. [Google Scholar] [CrossRef] [PubMed]
- Picklo, M.J.; Thyfault, J.P. Vitamin E and vitamin C do not reduce insulin sensitivity but inhibit mitochondrial protein expression in exercising obese rats. Appl. Physiol. Nutr. Metab. 2015, 40, 343–352. [Google Scholar] [CrossRef]
- Mehus, A.A.; Picklo, S.M.J. Brain and Hepatic Mt mRNA Is Reduced in Response to Mild Energy Restriction and n-3 Polyunsaturated Fatty Acid Deficiency in Juvenile Rats. Nutrients 2017, 9, 1145. [Google Scholar] [CrossRef]
- Dobin, A.; Davis, C.A.; Schlesinger, F.; Drenkow, J.; Zaleski, C.; Jha, S.; Batut, P.; Chaisson, M.; Gingeras, T.R. STAR: Ultrafast universal RNA-seq aligner. Bioinformatics 2013, 29, 15–21. [Google Scholar] [CrossRef]
- Trapnell, C.; Williams, B.A.; Pertea, G.; Mortazavi, A.; Kwan, G.; van Baren, M.J.; Salzberg, S.L.; Wold, B.J.; Pachter, L. Transcript assembly and quantification by RNA-Seq reveals unannotated transcripts and isoform switching during cell differentiation. Nat. Biotechnol. 2010, 28, 511–515. [Google Scholar] [CrossRef]
- Lawrence, M.; Huber, W.; Pages, H.; Aboyoun, P.; Carlson, M.; Gentleman, R.; Morgan, M.T.; Carey, V.J. Software for computing and annotating genomic ranges. PLoS Comput. Biol. 2013, 9, e1003118. [Google Scholar] [CrossRef] [PubMed]
- Bullard, J.H.; Purdom, E.; Hansen, K.D.; Dudoit, S. Evaluation of statistical methods for normalization and differential expression in mRNA-Seq experiments. BMC Bioinform. 2010, 11, 94. [Google Scholar] [CrossRef] [PubMed]
- Wagner, G.P.; Kin, K.; Lynch, V.J. Measurement of mRNA abundance using RNA-seq data: RPKM measure is inconsistent among samples. Theory Biosci. 2012, 131, 281–285. [Google Scholar] [CrossRef] [PubMed]
- Picklo, M.J.; Murphy, E.J. A High-Fat, High-Oleic Diet, But Not a High-Fat, Saturated Diet, Reduces Hepatic α-Linolenic Acid and Eicosapentaenoic Acid Content in Mice. Lipids 2016, 51, 537–547. [Google Scholar] [CrossRef] [PubMed]
- Hara, A.; Radin, N.S. Lipid extraction of tissues with a low-toxicity solvent. Anal. Biochem. 1978, 90, 420–426. [Google Scholar] [CrossRef]
- Prado, E.L.; Dewey, K.G. Nutrition and brain development in early life. Nutr. Rev. 2014, 72, 267–284. [Google Scholar] [CrossRef] [PubMed]
- Kothapalli, K.S.D.; Anthony, J.C.; Pan, B.S.; Hsieh, A.T.; Nathanielsz, P.W.; Brenna, J.T. Differential Cerebral Cortex Transcriptomes of Baboon Neonates Consuming Moderate and High Docosahexaenoic Acid Formulas. PLoS ONE 2007, 2, e370. [Google Scholar] [CrossRef]
- Hammamieh, R.; Chakraborty, N.; Gautam, A.; Miller, S.-A.; Muhie, S.; Meyerhoff, J.; Jett, M. Transcriptomic Analysis of the Effects of a Fish Oil Enriched Diet on Murine Brains. PLoS ONE 2014, 9, e90425. [Google Scholar] [CrossRef]
- Szostak, A.; Ogłuszka, M.; te Pas, M.F.W.; Poławska, E.; Urbański, P.; Juszczuk-Kubiak, E.; Blicharski, T.; Pareek, C.S.; Dunkelberger, J.R.; Horbańczuk, J.O.; et al. Effect of a diet enriched with omega-6 and omega-3 fatty acids on the pig liver transcriptome. Genes Nutr. 2016, 11, 9. [Google Scholar] [CrossRef]
- Paulsen, R.F.; Granas, K.; Johnsen, H.; Rolseth, V.; Sterri, S. Three related brain nuclear receptors, NGFI-B, Nurr1, and NOR-1, as transcriptional activators. J. Mol. Neurosci. 1995, 6, 249–255. [Google Scholar] [CrossRef]
- Ohkura, N.; Hijikuro, M.; Yamamoto, A.; Miki, K. Molecular cloning of a novel thyroid/steroid receptor superfamily gene from cultured rat neuronal cells. Biochem. Biophys. Res. Commun. 1994, 205, 1959–1965. [Google Scholar] [CrossRef] [PubMed]
- Fu, Y.; Luo, L.; Luo, N.; Zhu, X.; Garvey, W.T. NR4A orphan nuclear receptors modulate insulin action and the glucose transport system: Potential role in insulin resistance. J. Biol. Chem. 2007, 282, 31525–31533. [Google Scholar] [CrossRef] [PubMed]
- Volakakis, N.; Kadkhodaei, B.; Joodmardi, E.; Wallis, K.; Panman, L.; Silvaggi, J.; Spiegelman, B.M.; Perlmann, T. NR4A orphan nuclear receptors as mediators of CREB-dependent neuroprotection. Proc. Natl. Acad. Sci. USA 2010, 107, 12317. [Google Scholar] [CrossRef] [PubMed]
- Hawk, J.D.; Bookout, A.L.; Poplawski, S.G.; Bridi, M.; Rao, A.J.; Sulewski, M.E.; Kroener, B.T.; Manglesdorf, D.J.; Abel, T. NR4A nuclear receptors support memory enhancement by histone deacetylase inhibitors. J. Clin. Investig. 2012, 122, 3593–3602. [Google Scholar] [CrossRef] [PubMed]
- Pearen, M.A.; Myers, S.A.; Raichur, S.; Ryall, J.G.; Lynch, G.S.; Muscat, G.E.O. The Orphan Nuclear Receptor, NOR-1, a Target of β-Adrenergic Signaling, Regulates Gene Expression that Controls Oxidative Metabolism in Skeletal Muscle. Endocrinology 2008, 149, 2853–2865. [Google Scholar] [CrossRef] [PubMed]
- Chalon, S.; Delion-Vancassel, S.; Belzung, C.; Guilloteau, D.; Leguisquet, A.-M.; Besnard, J.-C.; Durand, G. Dietary Fish Oil Affects Monoaminergic Neurotransmission and Behavior in Rats. J. Nutr. 1998, 128, 2512–2519. [Google Scholar] [CrossRef] [PubMed]
- DeMar, J.C., Jr.; Ma, K.; Bell, J.M.; Rapoport, S.I. Half-lives of docosahexaenoic acid in rat brain phospholipids are prolonged by 15 weeks of nutritional deprivation of n-3 polyunsaturated fatty acids. J. Neurochem. 2004, 91, 1125–1137. [Google Scholar] [CrossRef]
- Kim, H.-W.; Rao, J.S.; Rapoport, S.I.; Igarashi, M. Regulation of rat brain polyunsaturated fatty acid (PUFA) metabolism during graded dietary n-3 PUFA deprivation. Prostaglandins Leukot. Essent. Fatty Acids 2011, 85, 361–368. [Google Scholar] [CrossRef]
1st Cohort | 2nd Cohort | |||||
---|---|---|---|---|---|---|
Endpoint | SO | CO | p | SO | CO | p |
Body Mass (g) | ||||||
Begin | 53.7 ± 2.2 | 54.8 ± 2.7 | 0.32 | 57.1 ± 4.0 | 57.4 ± 4.1 | 0.85 |
End | 224.9 ± 7.7 | 235.9 ± 10.2 | 0.01 | 253.2 ± 11.2 | 253.8 ± 15.5 | 0.92 |
Liver Mass (g) | 6.6 ± 0.4 | 7.3 ± 0.7 | <0.01 | 7.4 ± 0.4 | 7.3 ± 0.5 | 0.59 |
Brain Mass (g) | 1.6 ± 0.1 | 1.6 ± 0.1 | 0.27 | 1.7 ± 0.1 | 1.7 ± 0.1 | 0.74 |
Brain/Body (%) | 0.69 ± 0.04 | 0.67 ± 0.05 | 0.43 | 0.65 ± 0.03 | 0.65 ± 0.04 | 0.93 |
Tissue Concentration, µmol/g | |||
---|---|---|---|
FAs | SO | CO | p |
16:0 | 17.23 ± 2.16 | 19.08 ± 1.89 | 0.06 |
18:0 | 14.62 ± 1.92 | 15.62 ± 1.47 | 0.21 |
20:0 | 0.35 ± 0.06 | 0.33 ± 0.04 | 0.53 |
22:0 | 0.22 ± 0.03 | 0.22 ± 0.03 | 0.94 |
24:0 | 0.22 ± 0.05 | 0.23 ± 0.04 | 0.97 |
16:1n-7 | 0.30 ± 0.03 | 0.30 ± 0.03 | 0.74 |
18:1n-7 | 3.37 ± 0.44 | 3.60 ± 0.35 | 0.22 |
18:1n-9 | 14.19 ± 2.03 | 14.76 ± 1.35 | 0.47 |
20:1n-9 | 1.50 ± 0.24 | 1.42 ± 0.16 | 0.42 |
22:1n-9 | 0.18 ± 0.02 | 0.17 ± 0.03 | 0.37 |
18:2n-6 | 1.29 ± 0.19 | 1.23 ± 0.13 | 0.44 |
20:2n-6 | 0.35 ± 0.06 | 0.33 ± 0.03 | 0.51 |
20:3n-6 | 0.41 ± 0.07 | 0.40 ± 0.03 | 0.42 |
20:4n-6 (AA) | 6.11 ± 0.81 | 6.96 ± 0.61 | 0.02 |
22:4n-6 (DTA) | 1.92 ± 0.28 | 2.33 ± 0.19 | <0.01 |
22:5n-6 (DPAn6) | 0.27 ± 0.03 | 1.13 ± 0.17 | <0.01 |
n-6 LCPUFAs 1 | 9.06 ± 1.22 | 11.15 ± 0.93 | <0.01 |
22:5n-3 | 0.31 ± 0.12 | 0.27 ± 0.11 | 0.42 |
22:6n-3 (DHA) | 10.13 ± 1.33 | 10.01 ± 0.85 | 0.81 |
n-3 LCPUFAs 2 | 10.44 ± 1.39 | 10.27 ± 0.85 | 0.75 |
Group | ID | Paired Reads | Uniquely Mapping | % | Annotated Transcripts |
---|---|---|---|---|---|
SO | 23552 | 16,672,271 | 12,849,214 | 77.1 | 20,399 |
23553 | 22,682,731 | 19,036,095 | 83.9 | 20,944 | |
23554 | 14,456,057 | 11,930,561 | 82.5 | 19,577 | |
23555 | 29,567,630 | 19,869,689 | 67.2 | 21,578 | |
23556 | 28,959,204 | 23,777,578 | 82.1 | 21,562 | |
23557 | 17,119,385 | 13,192,970 | 77.1 | 20,715 | |
23558 | 11,037,221 | 8,945,862 | 81.1 | 19,354 | |
23559 | 36,432,242 | 30,316,383 | 83.2 | 22,242 | |
23560 | 33,211,308 | 27,063,716 | 81.5 | 21,985 | |
23561 | 49,759,399 | 36,660,886 | 73.7 | 22,787 | |
CO | 23562 | 15,976,576 | 13,229,505 | 82.8 | 20,080 |
23563 | 24,312,065 | 18,465,257 | 76.0 | 21,272 | |
23564 | 16,002,390 | 13,155,503 | 82.2 | 20,556 | |
23565 | 48,831,450 | 38,802,478 | 79.5 | 23,180 | |
23566 | 23,814,884 | 19,463,164 | 81.7 | 21,361 | |
23568 | 17,616,302 | 14,507,861 | 82.4 | 20,296 | |
23569 | 54,876,507 | 44,754,936 | 81.6 | 22,953 | |
23570 | 54,528,411 | 45,878,644 | 84.1 | 22,850 | |
23571 | 31,881,735 | 26,108,279 | 81.9 | 21,694 | |
23567 | 35,021,051 | 28,774,451 | 82.2 | 21,789 |
Normalization | Total | Genes |
---|---|---|
UQ & TPM | 70 | Ube2l3, Atp6v1h, Dusp1, Trnp1, Dbndd2, Scpep1, Tmem42, Thy1, Tlk1, Phactr3, Ndufa9, Gmfb, Klhl11, C2cd3, Opalin, Tmem231, Ptafr, Gstt3, Nrn1, Elovl2, Atp5g3, Tmem206, March8, S100b, Fam13c, Tbc1d15, Hsp90ab1, Ftsj1, Asrgl1, Htra1, Gga3, Pitrm1, Rnasek, Rpl7l1, Tgfa, Ifngr1, Sox8, Scamp3, Pgap2, Tspan1, Elp5, Ldoc1, Anp32b, Yars, Cpe, Klhl2, Fam220a, Mpzl1, Zfp212, LOC314140, Mrpl40, Sh2b2, Nxph4, Idh3a, Sec62, Ankrd40, Stmn2, Nr4a3, Bfar, Atp6v0c, Rps16, Hsbp1, LOC100911248, Ndufa3, Lix1l, Zfp449, Ralbp1, Dnajc7, Srfbp1, Smim17 |
UQ | 30 | LOC108351039, LOC103692551, Pik3cb, Ttc33, Socs5, LOC103690204, Prepl, Rnr1, Rcbtb2, Ppp3r1, Wee1, Noa1, Mfsd11, Gatm, Gmcl1, Rnr2, Pde4b, Tmem214, Meis3, Errfi1, Trnm, Mbtd1, Cnih1, Rab7a, Vac14, Trap1, Clcn4, Amz2, Ywhae, Aida |
TPM | 37 | Nlrp3, Golga5, Ube2j2, Ica1, Snrpa1, Gtf2f2, Abcf2, Uvrag, Vps45, Stim2, Metap2, Kpna1, Nkain4, Nutf2, Rundc1, Ppp1r8, Tnpo3, Pithd1, Osbpl2, Samd10, Fbxw4, Cul1, Ptpmt1, Tmem184c, Cdc34, Cnrip1, Atp5a1, Metap1, Ppcs, Vdac2, Pold3, Cetn2, Mrpl9, Ndufb7, Qrich2, Pex3, Gadd45gip1 |
© 2019 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Mehus, A.A.; Dickey, A.M.; Smith, T.P.L.; Yeater, K.M.; Picklo, M.J. Next-Generation Sequencing Identifies Polyunsaturated Fatty Acid Responsive Genes in the Juvenile Rat Cerebellum. Nutrients 2019, 11, 407. https://doi.org/10.3390/nu11020407
Mehus AA, Dickey AM, Smith TPL, Yeater KM, Picklo MJ. Next-Generation Sequencing Identifies Polyunsaturated Fatty Acid Responsive Genes in the Juvenile Rat Cerebellum. Nutrients. 2019; 11(2):407. https://doi.org/10.3390/nu11020407
Chicago/Turabian StyleMehus, Aaron A., Aaron M. Dickey, Timothy P. L. Smith, Kathleen M. Yeater, and Matthew J. Picklo. 2019. "Next-Generation Sequencing Identifies Polyunsaturated Fatty Acid Responsive Genes in the Juvenile Rat Cerebellum" Nutrients 11, no. 2: 407. https://doi.org/10.3390/nu11020407
APA StyleMehus, A. A., Dickey, A. M., Smith, T. P. L., Yeater, K. M., & Picklo, M. J. (2019). Next-Generation Sequencing Identifies Polyunsaturated Fatty Acid Responsive Genes in the Juvenile Rat Cerebellum. Nutrients, 11(2), 407. https://doi.org/10.3390/nu11020407