Prevalence of Antibiotic Resistant E. coli Strains Isolated from Farmed Broilers and Hens in Greece, Based on Phenotypic and Molecular Analyses
Abstract
1. Introduction
2. Materials and Methods
2.1. Sample Collection and Isolation of Bacteria
2.2. Examination of Phenotypic Antimicrobial Susceptibility
2.3. E. coli Phylogeny
2.4. Molecular Investigation of Antimicrobial Resistance Genes and Phylogeny
| Primer | Sequence (5′-3′) | Target Gene | Expected Band Size | Annealing Temperature | Reference |
|---|---|---|---|---|---|
| mcr-1F | AGTCCGTTTGTTCTTGTGGC | Colistin resistance gene 1 | 320 bp | 55 °C | [38] |
| mcr-1F | AGATCCTTGGTCTCGGCTTG | ||||
| mcr-2F | CAAGTGTGTTGGTCGCAGTT | Colistin resistance gene 2 | 715 bp | 55 °C | [38] |
| mcr-2R | TCTAGCCCGACAAGCATACC | ||||
| blaTEM-F | CATTTCCGTGTCGCCCTTATTC | Carbapenem resistance gene | 800 bp | 60 °C | [39] |
| blaTEM-R | CGTTCATCCATAGTTGCCTGAC | ||||
| tet(X)-F | GGAAACCGGCTAATGGCAT | Tetracycline resistance genes | 230 bp | 55 °C | [40] |
| tet(X)-R | AATCCTACAAATGACAACGTCG | ||||
| qnrA-F | AGAGGATTTCTCACGCCAGG | Quinolones resistance gene | 580 bp | 54 °C | [41] |
| qnrA-R | TGCCAGGCACAGATCTTGAC | ||||
| ChuA.1 | GACGAACCAACGGTCAGGAT | chuA | 279 bp | 55 °C | [34] |
| ChuA.2 | TGCCGCCAGTACCAAAGACA | ||||
| YjaA.1 | TGAAGTGTCAGGAGACGCTG | yjaA | 211 bp | 55 °C | [34] |
| YjaA.2 | ATGGAGAATGCGTTCCTCAAC | ||||
| TspE4C2.1 | GAGTAATGTCGGGGCATTCA | fragment TSPE4.C2 | 152 bp | 55 °C | [34] |
| TspE4C2.2 | CGCGCCAACAAAGTATTACG |
2.5. Statistical Analysis
3. Results
3.1. Antimicrobial Susceptibility
3.2. Phenotypic Tests for the Detection of ESBLs and AmpC-β-Lactamases
3.3. Molecular Identification
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Silbergeld, E.K.; Graham, J.; Price, L.B. Industrial Food Animal Production, Antimicrobial Resistance, and Human Health. Annu. Rev. Public Health 2008, 29, 151–169. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Dawadi, P.; Bista, S.; Bista, S. Prevalence of Colistin-Resistant Escherichia coli from Poultry in South Asian Developing Countries. Vet. Med. Int. 2021, 2021, 6398838. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Skerman, V.B.D.; Sneath, P.H.A.; McGowan, V. Approved Lists of Bacterial Names. Int. J. Syst. Evol. Microbiol. 1980, 30, 225–420. [Google Scholar] [CrossRef] [Scilit]
- Lukjancenko, O.; Wassenaar, T.M.; Ussery, D.W. Comparison of 61 Sequenced Escherichia coli Genomes. Microb. Ecol. 2010, 60, 708–720. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- World Health Organization. E. coli. 2018. Available online: http://www.who.int/mediacentre/factsheets/fs125/en/ (accessed on 7 December 2022).
- Herzer, P.J.; Inouye, S.; Inouye, M.; Whittam, T.S. Phylogenetic distribution of branched RNA-linked multicopy single-stranded DNA among natural isolates of Escherichia coli. J. Bacteriol. 1990, 172, 6175–6181. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Clermont, O.; Christenson, J.K.; Denamur, E.; Gordon, D.M. The Clermont Escherichia coli phylo-typing method revisited: Improvement of specificity and detection of new phylo-groups. Environ. Microbiol. Rep. 2013, 5, 58–65. [Google Scholar] [CrossRef] [Scilit]
- Clermont, O.; Dixit, O.V.; Vangchhia, B.; Condamine, B.; Dion, S.; Bridier-Nahmias, A.; Denamur, E.; Gordon, D. Characterization and rapid identification of phylogroup G in Escherichia coli, a lineage with high virulence and antibiotic re-sistance potential. Environ. Microbiol. 2019, 21, 3107–3117. [Google Scholar] [CrossRef] [Scilit]
- Clermont, O.; Olier, M.; Hoede, C.; Diancourt, L.; Brisse, S.; Keroudean, M.; Glodt, J.; Picard, B.; Oswald, E.; Denamur, E. Animal and human pathogenic Escherichia coli strains share common genetic backgrounds. Infect. Genet. Evol. 2011, 11, 654–662. [Google Scholar] [CrossRef] [Scilit]
- Tenaillon, O.; Skurnik, D.; Picard, B.; Denamur, E. The population genetics of commensal Escherichia coli. Nat. Rev. Microbiol. 2010, 8, 207–217. [Google Scholar] [CrossRef] [Scilit]
- Pitout, J.D.D. Extraintestinal Pathogenic Escherichia coli: A Combination of Virulence with Antibiotic Resistance. Front. Microbiol. 2012, 3, 9. [Google Scholar] [CrossRef] [Scilit]
- Abdelwahab, G.E.; Ishag, H.Z.A.; Al Hammadi, Z.M.; Al Yammahi, S.M.S.; Mohd Yusof, M.F.B.; Al Yassi, M.S.Y.; Al Mansoori, A.M.A.; Al Hamadi, F.H.A.; Al Hamadi, I.A.S.; Hosani, M.A.A.A.; et al. Antibiotics Re-sistance in Escherichia coli Isolated from Livestock in the Emirate of Abu Dhabi, UAE, 2014–2019. Int. J. Microbiol. 2022, 2022, 3411560. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Arbab, S.; Ullah, H.; Wang, W.; Zhang, J. Antimicrobial drug resistance against Escherichia coli and its harmful effect on animal health. Vet. Med. Sci. 2022, 8, 1780–1786. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Daneman, N.; Fridman, D.; Johnstone, J.; Langford, B.J.; Lee, S.M.; MacFadden, D.M.; Mponponsuo, K.; Patel, S.N.; Schwartz, K.L.; Brown, K.A. Antimicrobial resistance and mortality following E. coli bacteremia. Eclinicalmedicine 2023, 56, 101781. [Google Scholar] [CrossRef] [Scilit]
- Falagas, M.E.; Polemis, M.; Alexiou, V.G.; Marini-Mastrogiannaki, A.; Kremastinou, J.; Vatopoulos, A.C. Antimicro-bial resistance of Esherichia coli urinary isolates from primary care patients in Greece. Med. Sci. Monit. 2008, 14, CR75. [Google Scholar] [PubMed]
- Papadopoulos, D.; Papadopoulos, T.; Papageorgiou, K.; Sergelidis, D.; Adamopoulou, M.; Kritas, S.K.; Petridou, E. Antimicrobial resistance rates in commensal Escherichia coli isolates from healthy pigs in Greek swine farms. J. Hell. Vet. Med. Soc. 2021, 72, 2909–2916. [Google Scholar]
- Laube, H.; Friese, A.; von Salviati, C.; Guerra, B.; Käsbohrer, A.; Kreienbrock, L.; Roesler, U. Longitudinal Monitoring of Extended-Spectrum-Beta-Lactamase/AmpC-Producing Escherichia coli at German Broiler Chicken Fattening Farms. Appl. Environ. Microbiol. 2013, 79, 4815–4820. [Google Scholar] [CrossRef] [Scilit]
- Cantón, R.; González-Alba, J.M.; Galán, J.C. CTX-M Enzymes: Origin and Diffusion. Front. Microbiol. 2012, 3, 110. [Google Scholar] [CrossRef] [Scilit]
- Blanc, V.; Mesa, R.; Saco, M.; Lavilla, S.; Prats, G.; Miró, E.; Navarro, F.; Cortés, P.; Llagostera, M. ESBL- and plasmidic class C β-lactamase-producing E. coli strains isolated from poultry, pig and rabbit farms. Vet. Microbiol. 2006, 118, 299–304. [Google Scholar] [CrossRef] [Scilit]
- Ewers, C.; Bethe, A.; Semmler, T.; Guenther, S.; Wieler, L. Extended-spectrum β-lactamase-producing and AmpC-producing Escherichia coli from livestock and companion animals, and their putative impact on public health: A global perspective. Clin. Microbiol. Infect. 2012, 18, 646–655. [Google Scholar] [CrossRef] [Scilit]
- Jiang, H.-X.; Tang, D.; Liu, Y.-H.; Zhang, X.-H.; Zeng, Z.-L.; Xu, L.; Hawkey, P.M. Prevalence and characteristics of -lactamase and plasmid-mediated quinolone resistance genes in Escherichia coli isolated from farmed fish in China. J. Antimicrob. Chemother. 2012, 67, 2350–2353. [Google Scholar] [CrossRef] [Scilit]
- Dierikx, C.M.; Van Duijkeren, E.; Schoormans, A.H.W.; Van Essen-Zandbergen, A.; Veldman, K.; Kant, A.; Huijsdens, X.W.; Van Der Zwaluw, K.; Wagenaar, J.A.; Mevius, D.J. Occurrence and characteristics of extended-spectrum-β-lactamase- and AmpC-producing clinical isolates derived from companion animals and horses. J. Antimicrob. Chemother. 2012, 67, 1368–1374. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Dierikx, C.; van Essen-Zandbergen, A.; Veldman, K.; Smith, H.; Mevius, D. Increased detection of extended spectrum beta-lactamase producing Salmonella enterica and Escherichia coli isolates from poultry. Vet. Microbiol. 2010, 145, 273–278. [Google Scholar] [CrossRef] [Scilit]
- Hancock, R.E.W.; Chapple, D.S. Peptide Antibiotics. Antimicrob. Agents Chemother. 1999, 43, 1317–1323. [Google Scholar] [CrossRef] [Scilit]
- Biswas, S.; Brunel, J.-M.; Dubus, J.-C.; Reynaud-Gaubert, M.; Rolain, J.-M. Colistin: An update on the antibiotic of the 21st century. Expert Rev. Anti-Infect. Ther. 2012, 10, 917–934. [Google Scholar] [CrossRef] [Scilit]
- Zhang, J.; Chen, L.; Wang, J.; Yassin, A.K.; Butaye, P.; Kelly, P.; Gong, J.; Guo, W.; Li, J.; Li, M.; et al. Molecular detection of colistin resistance genes (mcr-1, mcr-2 and mcr-3) in nasal/oropharyngeal and anal/cloacal swabs from pigs and poultry. Sci. Rep. 2018, 8, 3705. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Borowiak, M.; Baumann, B.; Fischer, J.; Thomas, K.; Deneke, C.; Hammerl, J.A.; Szabo, I.; Malorny, B. Development of a Novel mcr-6 to mcr-9 Multiplex PCR and Assessment of mcr-1 to mcr-9 Occurrence in Colistin-Resistant Salmonella enterica Isolates From Environment, Feed, Animals and Food (2011–2018) in Germany. Front. Microbiol. 2020, 11, 80. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Hoelzer, K.; Wong, N.; Thomas, J.; Talkington, K.; Jungman, E.; Coukell, A. Antimicrobial drug use in food-producing animals and associated human health risks: What, and how strong, is the evidence? BMC Vet. Res. 2017, 13, 211. [Google Scholar] [CrossRef] [Scilit]
- Ruiz, J. Mechanisms of resistance to quinolones: Target alterations, decreased accumulation and DNA gyrase protection. J. Antimicrob. Chemother. 2003, 51, 1109–1117. [Google Scholar] [CrossRef] [Scilit]
- Johnson, J.R.; Kuskowski, M.A.; Smith, K.; O’bryan, T.T.; Tatini, S. Antimicrobial-Resistant and Extraintestinal Pathogenic Escherichia coliin Retail Foods. J. Infect. Dis. 2005, 191, 1040–1049. [Google Scholar] [CrossRef] [Scilit]
- Seo, K.; Lee, Y. Prevalence and characterization of plasmid-mediated quinolone resistance determinants qnr and aac (6’)-Ib-cr in ciprofloxacin-resistant Escherichia coli isolates from commercial layer in Korea. J. Microbiol. Biotechnol. 2020, 30, 1180–1183. [Google Scholar] [CrossRef] [Scilit]
- Dotas, V.; Gourdouvelis, D.; Hatzizisis, L.; Kaimakamis, I.; Mitsopoulos, I.; Symeon, G. Typology, Structural Char-acterization and Sustainability of Integrated Broiler Farming System in Epirus, Greece. Sustainability 2021, 13, 13084. [Google Scholar] [CrossRef] [Scilit]
- CLSI. Performance Standards for Antimicrobial Disk Susceptibility Tests, 11th ed.; Approved Standard; Clinical and Laboratory Standards Institute (CLSI): Wayne, PA, USA, 2012. [Google Scholar]
- Clermont, O.; Bonacorsi, S.; Bingen, E. Rapid and Simple Determination of the Escherichia coli Phylogenetic Group. Appl. Environ. Microbiol. 2000, 66, 4555–4558. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- The European Committee on Antimicrobial Susceptibility Testing. Breakpoint Tables for Interpretation of MICs and Zone Di-ameters. Version 6.0. 2016. Available online: http://www.eucast.org (accessed on 7 December 2022).
- Dunne, W.M.; Hardin, D.J. Use of several inducer and substrate antibiotic combinations in a disk approximation assay format to screen for AmpC induction in patient isolates of Pseudomonas aeruginosa, Enterobacter spp., Citrobacter spp., and Serratia spp. J. Clin. Microbiol. 2005, 43, 5945–5949. [Google Scholar] [CrossRef] [Scilit]
- Yuan, J.; Wang, X.; Shi, D.; Ge, Q.; Song, X.; Hu, W.; Wei, D.; Ge, C.; Li, X.; Hu, C. Extensive antimicrobial resistance and plasmid-carrying resistance genes in mcr-1-positive E. coli sampled in swine, in Guangxi, South China. BMC Vet. Res. 2021, 17, 86. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Rebelo, A.R.; Bortolaia, V.; Kjeldgaard, J.S.; Pedersen, S.K.; Leekitcharoenphon, P.; Hansen, I.M.; Guerra, B.; Malorny, B.; Borowiak, M.; Hammerl, J.A.; et al. Multiplex PCR for detection of plasmid-mediated colistin resistance determinants, mcr-1, mcr-2, mcr-3, mcr-4 and mcr-5 for surveillance purposes. Eurosurveillance 2018, 23, 17-00672. [Google Scholar] [CrossRef] [Scilit]
- Dallenne, C.; Da Costa, A.; Decre, D.; Favier, C.; Arlet, G. Development of a set of multiplex PCR assays for the detection of genes encoding important beta-lactamases in Enterobacteriaceae. J. Antimicrob. Chemother. 2010, 65, 490–495. [Google Scholar] [CrossRef] [Scilit]
- He, T.; Wang, R.; Liu, D.; Walsh, T.R.; Zhang, R.; Lv, Y.; Ke, Y.; Ji, Q.; Wei, R.; Liu, Z.; et al. Emergence of plasmid-mediated high-level tigecycline resistance genes in animals and humans. Nat. Microbiol. 2019, 4, 1450–1456. [Google Scholar] [CrossRef] [Scilit]
- Cattoir, V.; Poirel, L.; Rotimi, V.; Soussy, C.-J.; Nordmann, P. Multiplex PCR for detection of plasmid-mediated quinolone resistance qnr genes in ESBL-producing enterobacterial isolates. J. Antimicrob. Chemother. 2007, 60, 394–397. [Google Scholar] [CrossRef] [Scilit]
- Leverstein-van Hall, M.A.; Dierikx, C.M.; Cohen Stuart, J.; Voets, G.M.; van den Munckhof, M.P.; van Essen-Zandbergen, A.; Platteel, T.; Fluit, A.C.; van de Sande-Bruinsma, N.; Scharinga, J.; et al. Dutch patients, retail chicken meat and poultry share the same ESBL genes, plasmids and strains. Clin. Microbiol. Infect. 2011, 17, 873–880. [Google Scholar] [CrossRef] [Scilit]
- Webber, M.; Piddock, L.J. Quinolone resistance in Escherichia coli. Vet. Res. 2001, 32, 275–284. [Google Scholar] [CrossRef] [Scilit]
- EFSA (European Food Safety Authority); ECDC (European Centre for Disease Prevention and Control). The European Union summary report on antimicrobia resistance in zoonotic and indicator bacteria from humans, animals and food in 2016. EFSA J. 2018, 16, 5182–5270. [Google Scholar]
- Skočková, A.; Koláčková, I.; Bogdanovičová, K.; Karpíšková, R. Characteristic and antimicrobial resistance in Escherichia coli from retail meats purchased in the Czech Republic. Food Control. 2015, 47, 401–406. [Google Scholar] [CrossRef] [Scilit]
- Hricová, K.; Röderová, M.; Pudová, V.; Hanulík, V.; Halová, D.; Julínková, P.; Dolejská, M.; Papoušek, I.; Bardoň, J. Quinolone-resistant Escherichia coli in Poultry Farming. Central Eur. J. Public Health 2017, 25, 163–167. [Google Scholar] [CrossRef] [Scilit]
- VAN Hoorebeke, S.; VAN Immerseel, F.; Berge, A.C.; Persoons, D.; Schulz, J.; Hartung, J.; Harisberger, M.; Regula, G.; Barco, L.; Ricci, A.; et al. Antimicrobial resistance of Escherichia coli and Enterococcus faecalisin housed laying-hen flocks in Europe. Epidemiol. Infect. 2010, 139, 1610–1620. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Harisberger, M.; Gobeli, S.; Hoop, R.; Dewulf, J.; Perreten, V.; Regula, G. Antimicrobial Resistance in Swiss Laying Hens, Prevalence and Risk Factors. Zoonoses Public Health 2011, 58, 377–387. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Moreno, M.A.; García-Soto, S.; Hernández, M.; Bárcena, C.; Rodríguez-Lázaro, D.; Ugarte-Ruíz, M.; Domínguez, L. Day-old chicks are a source of antimicrobial resistant bacteria for laying hen farms. Vet. Microbiol. 2019, 230, 221–227. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Tan, H.S.; Yan, P.; Agustie, H.A.; Loh, H.S.; Rayamajhi, N.; Fang, C.M. Characterisation of ESBL/AmpC-Producing Enterobacteriaceae isolated from poultry farms in Peninsular Malaysia. Lett. Appl. Microbiol. 2023, 76, ovac044. [Google Scholar]
- Falgenhauer, L.; Imirzalioglu, C.; Oppong, K.; Akenten, C.W.; Hogan, B.; Krumkamp, R.; Poppert, S.; Levermann, V.; Schwengers, O.; Sarpong, N.; et al. Detection and Characterization of ESBL-Producing Escherichia coli From Humans and Poultry in Ghana. Front. Microbiol. 2019, 9, 3358. [Google Scholar] [CrossRef] [Scilit]
- Chai, M.H.; Sukiman, M.Z.; Jasmy, N.; Zulkifly, N.A.; Yusof, N.A.S.M.; Mohamad, N.M.; Ariffin, S.M.Z.; Ghazali, M.F. Molecular Detection and Antibiogram of ESBL-Producing and Carbapenem-Resistant Escherichia coli from Rabbit, Swine, and Poultry in Malaysia. Trop. Anim. Sci. J. 2022, 45, 16–23. [Google Scholar] [CrossRef] [Scilit]
- Köck, R.; Daniels-Haardt, I.; Becker, K.; Mellmann, A.; Friedrich, A.W.; Mevius, D.; Schwarz, S.; Jurke, A. Carbapenem-resistant Enterobacteriaceae in wildlife, food-producing, and companion animals: A systematic review. Clin. Microbiol. Infect. 2018, 24, 1241–1250. [Google Scholar] [CrossRef] [Scilit]
- Schwaiger, K.; Schmied, E.-M.V.; Bauer, J. Comparative Analysis of Antibiotic Resistance Characteristics of Gram-negative Bacteria Isolated from Laying Hens and Eggs in Conventional and Organic Keeping Systems in Bavaria, Germany. Zoonoses Public Health 2008, 55, 331–341. [Google Scholar] [CrossRef] [Scilit]
- Liu, Y.-Y.; Wang, Y.; Walsh, T.R.; Yi, L.-X.; Zhang, R.; Spencer, J.; Doi, Y.; Tian, G.; Dong, B.; Huang, X.; et al. Emergence of plasmid-mediated colistin resistance mechanism MCR-1 in animals and human beings in China: A microbiological and molecular biological study. Lancet Infect. Dis. 2016, 16, 161–168. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Quesada, A.; Ugarte-Ruiz, M.; Iglesias, M.R.; Porrero, M.C.; Martínez, R.; Florez-Cuadrado, D.; Campos, M.J.; García, M.; Píriz, S.; Sáez, J.L.; et al. Detection of plasmid mediated colistin resistance (MCR-1) in Escherichia coli and Salmonella enterica isolated from poultry and swine in Spain. Res. Vet. Sci. 2016, 105, 134–135. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Anjum, M.F.; Duggett, N.A.; AbuOun, M.; Randall, L.; Nunez-Garcia, J.; Ellis, R.J.; Rogers, J.; Horton, R.; Brena, C.; Williamson, S.; et al. Colistin resistance in Salmonella and Escherichia coli isolates from a pig farm in Great Britain. J. Antimicrob. Chemother. 2016, 71, 2306–2313. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Cannatelli, A.; Giani, T.; Antonelli, A.; Principe, L.; Luzzaro, F.; Rossolini, G.M. First Detection of the mcr-1 Colistin Resistance Gene in Escherichia coli in Italy. Antimicrob. Agents Chemother. 2016, 60, 3257–3258. [Google Scholar] [CrossRef] [Scilit]
- Zurfluh, K.; Klumpp, J.; Nüesch-Inderbinen, M.; Stephan, R. Full-Length Nucleotide Sequences of mcr-1 -Harboring Plasmids Isolated from Extended-Spectrum-β-Lactamase-Producing Escherichia coli Isolates of Different Origins. Antimicrob. Agents Chemother. 2016, 60, 5589–5591. [Google Scholar] [CrossRef] [Scilit]
- Yang, Y.-Q.; Li, Y.-X.; Song, T.; Yang, Y.-X.; Jiang, W.; Zhang, A.-Y.; Guo, X.-Y.; Liu, B.-H.; Wang, Y.-X.; Lei, C.-W.; et al. Colistin Resistance Gene mcr-1 and Its Variant in Escherichia coli Isolates from Chickens in China. Antimicrob. Agents Chemother. 2017, 61, e01204-16. [Google Scholar] [CrossRef] [Scilit]
- Schwarz, S.; Johnson, A.P. Transferable resistance to colistin: A new but old threat. J. Antimicrob. Chemother. 2016, 71, 2066–2070. [Google Scholar] [CrossRef] [Scilit]

| Antimicrobial | Disk Composition | Thresholds (mm) | Resistant Strains–Broilers | Resistant Strains–Egg-Laying Hens | Resistant Strains–Total | |
|---|---|---|---|---|---|---|
| Sensitive | Resistant | |||||
| Sulfamethoxazole | 23.75 μg | ≥15 | ≤11 | 83 (91.1%) | 3 (18.8%) | 86 (81.1%) |
| Nalidixic acid | 30 μg | ≥19 | ≤13 | 71 (78%) | 7 (43.8%) | 78 (73.6%) |
| Tetracycline | 30 μg | ≥15 | ≤11 | 68 (74.7%) | 7 (43.8%) | 75 (70.8%) |
| Piperacillin | 100 μg | ≥21 | ≤17 | 55 (60.4%) | 12 (75%) | 67 (63.2%) |
| Streptomycin | 10 μg | ≥15 | ≤11 | 69 (75.8%) | 6 (3.8%) | 75 (70.8%) |
| Enrofloxacin | 5 μg | ≥21 | ≤15 | 54 (59.3%) | 10 (6.3%) | 64 (60.3%) |
| Aztreonam | 30 μg | ≥21 | ≤17 | 1 (1.1%) | - | 1 (1%) |
| Ceftazidime | 10 μg | ≥21 | ≤17 | 3 (3.3%) | - | 3 (2.8%) |
| Ceftriaxone | 30 μg | ≥23 | ≤19 | 4 (4.4%) | - | 4 (3.7%) |
| Cefoxitin | 30 μg | ≥18 | ≤14 | 5 (5.5%) | - | 5 (4.7%) |
| Cefotaxime | 30 μg | ≥26 | ≤22 | 5 (5.5%) | - | 5 (4.7%) |
| Imipenem | 10 μg | ≥23 | ≤19 | - | - | 0 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Xexaki, A.; Papadopoulos, D.K.; Alvanou, M.V.; Giantsis, I.A.; Papageorgiou, K.V.; Delis, G.A.; Economou, V.; Kritas, S.K.; Sossidou, E.N.; Petridou, E. Prevalence of Antibiotic Resistant E. coli Strains Isolated from Farmed Broilers and Hens in Greece, Based on Phenotypic and Molecular Analyses. Sustainability 2023, 15, 9421. https://doi.org/10.3390/su15129421
Xexaki A, Papadopoulos DK, Alvanou MV, Giantsis IA, Papageorgiou KV, Delis GA, Economou V, Kritas SK, Sossidou EN, Petridou E. Prevalence of Antibiotic Resistant E. coli Strains Isolated from Farmed Broilers and Hens in Greece, Based on Phenotypic and Molecular Analyses. Sustainability. 2023; 15(12):9421. https://doi.org/10.3390/su15129421
Chicago/Turabian StyleXexaki, Anna, Dimitrios K. Papadopoulos, Maria V. Alvanou, Ioannis A. Giantsis, Konstantinos V. Papageorgiou, Georgios A. Delis, Vangelis Economou, Spyridon K. Kritas, Evangelia N. Sossidou, and Evanthia Petridou. 2023. "Prevalence of Antibiotic Resistant E. coli Strains Isolated from Farmed Broilers and Hens in Greece, Based on Phenotypic and Molecular Analyses" Sustainability 15, no. 12: 9421. https://doi.org/10.3390/su15129421
APA StyleXexaki, A., Papadopoulos, D. K., Alvanou, M. V., Giantsis, I. A., Papageorgiou, K. V., Delis, G. A., Economou, V., Kritas, S. K., Sossidou, E. N., & Petridou, E. (2023). Prevalence of Antibiotic Resistant E. coli Strains Isolated from Farmed Broilers and Hens in Greece, Based on Phenotypic and Molecular Analyses. Sustainability, 15(12), 9421. https://doi.org/10.3390/su15129421

