A Novel 1259 bp Intragenic Deletion in the GJB2 Gene in a Mexican Family with Congenital Profound Hearing Loss
Abstract
1. Introduction
2. Case Presentation
3. Discussion
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
Abbreviations
| 3′-UTR | 3′ Untranslated Region |
| CDS | Coding DNA Sequence |
| ORF | Open Reading Frame |
References
- World Health Organization. Deafness and Hearing Loss. 2025. Available online: https://www.who.int/news-room/fact-sheets/detail/deafness-and-hearing-loss (accessed on 15 June 2025).
- Castorena-Maldonado, A.; Ramírez-García, A.; Carranco-Hernández, L.; Pérez-Delgadillo, G.; Toledo-Varela, M. Análisis geoespacial de la discapacidad auditiva en México. An. Orl. Me. 2022, 67, 52–61. [Google Scholar] [CrossRef]
- Gobierno de México. 046. En México, Tres de Cada Mil Nacidos Presentarán Discapacidad por Sordera. 2019. Available online: http://www.gob.mx/salud/prensa/046-en-mexico-tres-de-cada-mil-nacidos-presentaran-discapacidad-por-sordera (accessed on 15 June 2025).
- Estrella, C.D.; López, M.J.A.; Zapata, P.A.; Canto, H.J. Caracterización de las limitaciones funcionales auditivas en una muestra de la población de Yucatán, México. Rev. Mex. Med. Fis. Rehab. 2012, 24, 10–15. Available online: https://www.medigraphic.com/cgi-bin/new/resumen.cgi?IDARTICULO=36210 (accessed on 20 December 2022).
- Arenas-Sordo, M.; Linares-Mendoza, E.P.; Peñuelas-Romero, K.J.; Castro-Peña, S.; Agís-Ocaña, J.G. Hipoacusia no sindrómica de origen genético. Conceptos actuales. An. Orl. Mex. 2020, 65, 43–58. Available online: https://otorrino.org.mx/article/hipoacusia-no-sindromica-de-origen-genetico-conceptos-actuales/ (accessed on 2 October 2022).
- Organización Panamericana de la Salud. Informe Mundial Sobre la Audición; Organización Panamericana de la Salud: Washington, DC, USA, 2021. [Google Scholar] [CrossRef]
- Mao, L.; Wang, Y.; An, L.; Zeng, B.; Wang, Y.; Frishman, D.; Liu, M.; Chen, Y.; Tang, W.; Xu, H. Molecular Mechanisms and Clinical Phenotypes of GJB2 Missense Variants. Biology 2023, 12, 505. [Google Scholar] [CrossRef] [PubMed]
- Dai, P.; Yu, F.; Han, B.; Yuan, Y.; Li, Q.; Wang, G.; Liu, X.; He, J.; Huang, D.; Kang, D.; et al. The prevalence of the 235delC GJB2 mutation in a Chinese deaf population. Genet. Med. 2007, 9, 283–289. [Google Scholar] [CrossRef]
- National Institutes of Health. ClinVar. Available online: https://www.ncbi.nlm.nih.gov/clinvar (accessed on 15 June 2025).
- Safka Brozkova, D.; Uhrova Meszarosova, A.; Lassuthova, P.; Varga, L.; Staněk, D.; Borecká, S.; Laštůvková, J.; Čejnová, V.; Rašková, D.; Lhota, F.; et al. The Cause of Hereditary Hearing Loss in GJB2 Heterozygotes-A Comprehensive Study of the GJB2/DFNB1 Region. Genes 2021, 12, 684. [Google Scholar] [CrossRef]
- de la Torre-González, C.; Villanueva-García, D.; García-Delgado, C.; Castillo-Castillo, S.; Huante-Guido, M.; Chichitz-Madrigal, J.; Juárez-Torres, M.E.; Sánchez-Sandoval, A.L.; Barrón-Palma, E.V.; Morán-Barroso, V.F.; et al. Congenital hearing loss: A literature review of the genetic etiology in a Mexican population. Bol. Med. Hosp. Infant. Mex. 2022, 79, 206–214. [Google Scholar] [CrossRef]
- Cengiz, F.B.; Yilmazer, R.; Olgun, L.; Sennaroglu, L.; Kirazli, T.; Alper, H.; Olgun, Y.; Incesulu, A.; Atik, T.; Huesca-Hernandez, F.; et al. Novel Pathogenic Variants Underlie SLC26A4-telated Hearing Loss in a Multiethnic Cohort. Int. J. Pediatr. Otorhinolaryngol. 2017, 101, 167–171. [Google Scholar] [CrossRef]
- Bademci, G.; Foster, J.; Mahdieh, N.; Bonyadi, M.; Duman, D.; Cengiz, F.B.; Menendez, I.; Diaz-Horta, O.; Shirkavand, A.; Zeinali, S.; et al. Comprehensive analysis via exome sequencing uncovers genetic etiology in autosomal recessive nonsyndromic deafness in a large multiethnic cohort. Genet. Med. 2016, 18, 364–371. [Google Scholar] [CrossRef]
- Arenas-Sordo, M.; Menendez, I.; Hernández-Zamora, E.; Sirmaci, A.; Gutiérrez-Tinajero, D.; McGetrick, M.; Murphy-Ruiz, P.; Leyva-Juárez, X.; Huesca-Hernández, F.; Dominguez-Aburto, J.; et al. Unique spectrum of GJB2 mutations in Mexico. Int. J. Pediatr. Otorhinolaryngol. 2012, 76, 1678–1680. [Google Scholar] [CrossRef]
- Hernández-Juárez, A.A.; Lugo-Trampe, J.d.J.; Campos-Acevedo, L.D.; Lugo-Trampe, A.; Treviño-González, J.L.; de-la-Cruz-Ávila, I.; Martínez-de-Villarreal, L.E. GJB2 and GJB6 mutations are an infrequent cause of autosomal-recessive nonsyndromic hearing loss in residents of Mexico. Int. J. Pediatr. Otorhinolaryngol. 2014, 78, 2107–2112. [Google Scholar] [CrossRef]
- Hernandez-Nieto, C.; Alkon-Meadows, T.; Lee, J.; Cacchione, T.; Iyune-Cojab, E.; Garza-Galvan, M.; Luna-Rojas, M.; Copperman, A.B.; Sandler, B. Expanded carrier screening for preconception reproductive risk assessment: Prevalence of carrier status in a Mexican population. Prenat. Diagn. 2020, 40, 635–643. [Google Scholar] [CrossRef] [PubMed]
- Loeza-Becerra, F.; del Refugio Rivera-Vega, M.; Martínez-Saucedo, M.; Gonzalez-Huerta, L.M.; Urueta-Cuellar, H.; Berrruecos-Villalobos, P.; Cuevas-Covarrubias, S. Particular distribution of the GJB2/GJB6 gene mutations in Mexican population with hearing impairment. Int. J. Pediatr. Otorhinolaryngol. 2014, 78, 1057–1060. [Google Scholar] [CrossRef]
- Martínez-Saucedo, M.; Rivera-Vega, M.R.; Gonzalez-Huerta, L.; Urueta-Cuellar, H.; Toral-López, J.; Berruecos-Villalobos, P.; Cuevas-Covarrubias, S. Two novel compound heterozygous families with a trimutation in the GJB2 gene causing sensorineural hearing loss. Int. J. Pediatr. Otorhinolaryngol. 2015, 79, 2295–2299. [Google Scholar] [CrossRef] [PubMed]
- Mendelsberg-Fishbein, P.; Márquez-Ávila, C.S.; García-Delgado, C.; Sánchez-Boiso, A.; Rodríguez-Espino, B.A.; Vázquez-Martínez, E.R.; Roque-Lee, G.; Ortiz-Rodríguez, S.; Fierro-Evans, M.Á.; Castillo-Castillo, S.; et al. Importancia del diagnóstico de mutaciones en el gen de la conexina 26 en el manejo integral de la sordera congénita no sindrómica. Bol. Med. Hosp. Infant. Mex. 2013, 70, 89–97. Available online: https://www.medigraphic.com/cgi-bin/new/resumen.cgi?IDARTICULO=40573 (accessed on 8 February 2023).
- INEGI México en Cifras. Available online: https://www.inegi.org.mx/app/areasgeograficas/#collapse-Resumen (accessed on 16 June 2025).
- Portuondo, L.R.T.; González, I.G.; Castillo, D.E.; Escalante, D.D.C.P.; Sierra, O.V.; Castellanos, R.R.; Ucán, A.C.; Herrera, J.C.; Baas, R.V.; García, A.J.G.; et al. Estimación de la consanguinidad mediante isonimia marital en la comunidad maya de Chicán, Yucatán, México. Rev. Mus. Antropol. 2024, 17, 119–126. [Google Scholar] [CrossRef]
- Le Guen, O. The signing community of Chicán, Yucatán, Mexico. In Sign Languages in Village Communities: Anthropological and Linguistic Insights; Zeshan, U., de Vos, C., Eds.; Walter de Gruyter: Berlin, Germany, 2014; pp. 209–232. [Google Scholar]
- Carranza, C.; Menendez, I.; Herrera, M.; Castellanos, P.; Amado, C.; Maldonado, F.; Rosales, L.; Escobar, N.; Guerra, M.; Alvarez, D.; et al. A Mayan founder mutation is a common cause of deafness in Guatemala. Clin. Genet. 2016, 89, 461–465. [Google Scholar] [CrossRef]
- Richards, S.; Aziz, N.; Bale, S.; Bick, D.; Das, S.; Gastier-Foster, J.; Grody, W.W.; Hegde, M.; Lyon, E.; Spector, E.; et al. Standards and Guidelines for the Interpretation of Sequence Variants: A Joint Consensus Recommendation of the American College of Medical Genetics and Genomics and the Association for Molecular Pathology. Genet. Med. 2015, 17, 405–423. [Google Scholar] [CrossRef]
- Oza, A.M.; DiStefano, M.T.; Hemphill, S.E.; Cushman, B.J.; Grant, A.R.; Siegert, R.K.; Shen, J.; Chapin, A.; Boczek, N.J.; Schimmenti, L.A.; et al. Expert Specification of the ACMG/AMP Variant Interpretation Guidelines for Genetic Hearing Loss. Hum. Mutat. 2018, 39, 1593–1613. [Google Scholar] [CrossRef]
- Abou Tayoun, A.N.; Pesaran, T.; DiStefano, M.T.; Oza, A.; Rehm, H.L.; Biesecker, L.G.; Harrison, S.M. Recommendations for interpreting the loss of function PVS1 ACMG/AMP variant criterion. Hum. Mutat. 2018, 39, 1517–1524. [Google Scholar] [CrossRef]
- del Castillo, I.; Villamar, M.; Moreno-Pelayo, M.A.; del Castillo, F.J.; Alvarez, A.; Tellería, D.; Menéndez, I.; Moreno, F. A Deletion Involving the Connexin 30 Gene in Nonsyndromic Hearing Impairment. N. Engl. J. Med. 2002, 346, 243–249. [Google Scholar] [CrossRef]
- del Castillo, F.J.; Rodríguez-Ballesteros, M.; Alvarez, A.; Hutchin, T.; Leonardi, E.; de Oliveira, C.A.; Azaiez, H.; Brownstein, Z.; Avenarius, M.R.; Marlin, S.; et al. A Novel Deletion Involving the Connexin-30 Gene, Del(GJB6-D13s1854), Found in Trans with Mutations in the GJB2 Gene (Connexin-26) in Subjects with DFNB1 Non-Syndromic Hearing Impairment. J. Med. Genet. 2005, 42, 588–594. [Google Scholar] [CrossRef]
- Cifuentes, G.A.; Diñeiro, M.; Huete, A.R.; Capín, R.; Santiago, A.; Vargas, A.A.R.; Carrero, D.; Martínez, E.L.; Aguiar, B.; Fischer, A.; et al. A Novel Recurrent 200 Kb CRYL1 Deletion Underlies DFNB1A Hearing Loss in Patients from Northwestern Spain. Genes 2025, 16, 670. [Google Scholar] [CrossRef]
- Abou Tayoun, A.N.; Mason-Suares, H.; Frisella, A.L.; Bowser, M.; Duffy, E.; Mahanta, L.; Funke, B.; Rehm, H.L.; Amr, S.S. Targeted Droplet-Digital PCR as a Tool for Novel Deletion Discovery at the DFNB1 Locus. Hum. Mutat. 2016, 37, 119–126. [Google Scholar] [CrossRef] [PubMed]
- Wilch, E.; Azaiez, H.; Fisher, R.A.; Elfenbein, J.; Murgia, A.; Birkenhäger, R.; Bolz, H.; Da Silva-Costa, S.M.; Del Castillo, I.; Haaf, T.; et al. A Novel DFNB1 Deletion Allele Supports the Existence of a Distant Cis-Regulatory Region That Controls GJB2 and GJB6 Expression. Clin. Genet. 2010, 78, 267–274. [Google Scholar] [CrossRef] [PubMed]
- Lin, Z.; Xiang, J.; Sun, X.; Song, N.; Liu, X.; Cai, Q.; Yang, J.; Ye, H.; Xu, J.; Zhang, H.; et al. Genome Sequencing Unveils the Role of Copy Number Variants in Hearing Loss and Identifies Novel Deletions with Founder Effect in the DFNB1 Locus. Hum. Mutat. 2024, 2024, 9517114. [Google Scholar] [CrossRef] [PubMed]
- Feldmann, D.; Le Maréchal, C.; Jonard, L.; Thierry, P.; Czajka, C.; Couderc, R.; Ferec, C.; Denoyelle, F.; Marlin, S.; Fellmann, F. A New Large Deletion in the DFNB1 Locus Causes Nonsyndromic Hearing Loss. Eur. J. Med. Genet. 2009, 52, 195–200. [Google Scholar] [CrossRef]
- Bliznetz, E.A.; Lalayants, M.R.; Markova, T.G.; Balanovsky, O.P.; Balanovska, E.V.; Skhalyakho, R.A.; Pocheshkhova, E.A.; Nikitina, N.V.; Voronin, S.V.; Kudryashova, E.K.; et al. Update of the GJB2/DFNB1 mutation spectrum in Russia: A founder Ingush mutation del(GJB2-D13S175) is the most frequent among other large deletions. J. Hum. Genet. 2017, 62, 789–795. [Google Scholar] [CrossRef][Green Version]
- Abe, S.; Nishio, S.-Y.; Yokota, Y.; Moteki, H.; Kumakawa, K.; Usami, S.-I. Diagnostic pitfalls for GJB2-related hearing loss: A novel deletion detected by Array-CGH analysis in a Japanese patient with congenital profound hearing loss. Clin. Case. Rep. 2018, 6, 2111–2116. [Google Scholar] [CrossRef]
- del Castillo, F.J.; del Castillo, I. DFNB1 Non-Syndromic Hearing Impairment: Diversity of Mutations and Associated Phenotypes. Front. Mol. Neurosci. 2017, 10, 428. [Google Scholar] [CrossRef]
- Choung, Y.H.; Moon, S.-K.; Park, H.-J. Functional Study of GJB2 in Hereditary Hearing Loss. Laryngoscope 2002, 112, 1667–1671. [Google Scholar] [CrossRef] [PubMed]
- Xiao, Z.; Yang, Z.; Liu, X.; Xie, D. Impaired membrane targeting and aberrant cellular localization of human Cx26 mutants associated with inherited recessive hearing loss. Acta Oto-Laryngol. 2011, 131, 59–66. [Google Scholar] [CrossRef]
- Bai, D.; Yue, B.; Aoyama, H. Crucial motifs and residues in the extracellular loops influence the formation and specificity of connexin docking. Biochim. Biophys. Acta 2018, 1860, 9–21. [Google Scholar] [CrossRef] [PubMed]
- Adadey, S.M.; Wonkam-Tingang, E.; Twumasi Aboagye, E.; Nayo-Gyan, D.W.; Boatemaa Ansong, M.; Quaye, O.; Awandare, G.A.; Wonkam, A. Connexin Genes Variants Associated with Non-Syndromic Hearing Impairment: A Systematic Review of the Global Burden. Life 2020, 10, 258. [Google Scholar] [CrossRef] [PubMed]





| Amplicons | Sequences | Position in GJB2 CDS * | |
|---|---|---|---|
| Start | End | ||
| CDS | CDSA: 5′ ACCTGTTTTGGTGAGGTTGTGT 3′ | −22 − 140 | −22 − 119 |
| CDSB: 5′ TGAGCACGGGTTGCCTCATC 3′ | 745 | 726 | |
| F1 | F1A: 5′ CAAACCGCCCAGAGTAGAAG 3′ | −20 | −1 |
| F1B: 5′ GTGATCGTAGCACACGTTCTTG 3′ | 201 | 180 | |
| F2 | F2A: 5′ CCAGGCTGCAAGAACGTGTG 3′ | 172 | 191 |
| F2B: 5′ TCGAAGATGACCCGGAAGAA 3′ | 440 | 421 | |
| F3 | F3A: 5′ TCGAGGAGATCAAAACCCAGAAG 3′ | 353 | 375 |
| F3B: 5′ GCAAATTCCAGACACTGCAATCA 3′ | 606 | 584 | |
| F4 | F4A: 5′ GCCTTGTCCCAACACTGTGGACT 3′ | 516 | 538 |
| CDSB: 5′ TGAGCACGGGTTGCCTCATC 3′ | 745 | 726 | |
| F5 | F5A: 5′ AAAGGAGGTGTGGGGAGATGAG 3′ | 120 | 141 |
| F5B: 5′ GGCAACTTACCCATTGGTGTTAT 3′ | 2112 + 103 | −2112 + 81 | |
| Detection test | DTA: 5′ CGCATTATGATCCTCGTTGTG 3′ | 94 | 114 |
| DTB: 5′ AGGCTGAAGGGGTAAGCAAAC 3′ | 1809 | 1789 | |
| Amplicons | PCR Programs |
|---|---|
| CDS | 96 °C, 5 min/94 °C for 40 s, 60 °C for 40 s, 72 °C for 1 min (30 cycles)/72 °C, 7 min |
| F1–F4 | 96 °C, 5 min/94 °C for 40 s, 60 °C for 40 s, 72 °C for 30 s (30 cycles)/72 °C, 7 min |
| F5 | 94 °C for 40 s, 68 °C (−1 °C/cycle) for 40 s, 72 °C for 90 s (5 cycles)/94 °C for 40 s, 63 °C for 40 s, 72 °C for 90 s (30 cycles)/72 °C, 10 min |
| Detection test | 96 °C, 5 min; 94 °C for 40 s, 59 °C for 40 s, 72 °C for 1 min 45 s (30 cycles); 72 °C, 7 min |
| Deletion Name | Size | Chr13 * | Affected Genes | Reference | |
|---|---|---|---|---|---|
| Start | End | ||||
| del(920 kb) | 920 kb | 19,558,829–19,569,782 (breakpoint unknown) | 20,489,408–20,491,267 (breakpoint unknown) | MPHOSPH8, PSPC1, ZMYM5, ZMYM2, GJA3, GJB2, GJB6, CRYL1 | [31] |
| del(GJB6-D13S1830) | 309 kb | 20,223,038 | 20,531,806 | GJB6, CRYL1 | [25] |
| del(GJB6-D13S1854) | 232 kb | 20,228,588 | 20,460,629 | GJB6, CRYL1 | [26] |
| del(200 kb)insATTATA | 200 kb | 20,361,160 | 20,561,391 | CRYL1 | [27] |
| del(179 kb) | 179 kb | 20,347,572 | 20,526,976 | CRYL1 | [28] |
| del(131 kb) | 131 kb | 20,365,205 | 20,496,559 | CRYL1 | [29] |
| del(125 kb) | 125 kb | 20,398,370 | 20,523,823 | CRYL1 | [30] |
| del(GJB2-D13S175) | 101 kb | 20,182,882 | 20,284,255 | GJB2, GJB6 | [32] |
| del(8 kb) | 8 kb | 20,189,271 | 20,197,662 | GJB2 | [33] |
| del(1259 bp) | 1259 bp | 20,188,077 | 20,189,335 | GJB2 (intragenic) | This work |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2025 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Oaxaca-Castillo, D.; Taño-Portuondo, L.; Rodríguez-Ballesteros, M.; Pérez-Mendoza, G.; García-González, I.; Canto-Herrera, J.; Domínguez-Ruiz, M.; Pinto-Escalante, D.; Vargas-Sierra, O.; Estrella-Castillo, D.; et al. A Novel 1259 bp Intragenic Deletion in the GJB2 Gene in a Mexican Family with Congenital Profound Hearing Loss. Audiol. Res. 2025, 15, 111. https://doi.org/10.3390/audiolres15050111
Oaxaca-Castillo D, Taño-Portuondo L, Rodríguez-Ballesteros M, Pérez-Mendoza G, García-González I, Canto-Herrera J, Domínguez-Ruiz M, Pinto-Escalante D, Vargas-Sierra O, Estrella-Castillo D, et al. A Novel 1259 bp Intragenic Deletion in the GJB2 Gene in a Mexican Family with Congenital Profound Hearing Loss. Audiology Research. 2025; 15(5):111. https://doi.org/10.3390/audiolres15050111
Chicago/Turabian StyleOaxaca-Castillo, David, Laura Taño-Portuondo, Montserrat Rodríguez-Ballesteros, Gerardo Pérez-Mendoza, Igrid García-González, Jorge Canto-Herrera, María Domínguez-Ruiz, Doris Pinto-Escalante, Orlando Vargas-Sierra, Damaris Estrella-Castillo, and et al. 2025. "A Novel 1259 bp Intragenic Deletion in the GJB2 Gene in a Mexican Family with Congenital Profound Hearing Loss" Audiology Research 15, no. 5: 111. https://doi.org/10.3390/audiolres15050111
APA StyleOaxaca-Castillo, D., Taño-Portuondo, L., Rodríguez-Ballesteros, M., Pérez-Mendoza, G., García-González, I., Canto-Herrera, J., Domínguez-Ruiz, M., Pinto-Escalante, D., Vargas-Sierra, O., Estrella-Castillo, D., López-González, P., Sosa-Escalante, J. E., del Castillo, I., & González-Herrera, L. (2025). A Novel 1259 bp Intragenic Deletion in the GJB2 Gene in a Mexican Family with Congenital Profound Hearing Loss. Audiology Research, 15(5), 111. https://doi.org/10.3390/audiolres15050111

