Next Article in Journal
Functional Characterisation of Two Novel Deacetylases from Streptococcus pyogenes
Previous Article in Journal
Deoxynivalenol: An Overview on Occurrence, Chemistry, Biosynthesis, Health Effects and Its Detection, Management, and Control Strategies in Food and Feed
 
 
Search for Articles:
Title / Keyword
Author / Affiliation / Email
Journal
Article Type
 
 
Advanced Search
 
Section
Special Issue
Volume
Issue
Number
Page
 
Journals
Microbiology Research
Volume 13
Issue 2
10.3390/microbiolres13020024
microbiolres-logo
Submit to this Journal Review for this Journal Propose a Special Issue
► Article Menu

Article Menu

share Share announcement Help format_quote Cite question_answer Discuss in SciProfiles
first_page
settings
Order Article Reprints
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Identification of Fungi in Flaxseed (L. usitatissimum L.) Using the ITS1 and ITS2 Intergenic Regions

by
Nathalia de Castro Rollemberg
1,
Guilherme de Souza Hassemer
2,
Milena Dutra Pierezan
1,
Bruna Marchesan Maran
1,
Flávia Michelon Dalla Nora
3 and
Silvani Verruck
1,*
1
Department of Food Science and Technology, Federal University of Santa Catarina, Rodovia Admar Gonzaga, 1346, Itacorubi, Florianópolis 88034-000, SC, Brazil
2
Department of Food Engineering, Regional Integrated University of Alto Uruguai e das Missões, Avenida Sete de Setembro, 1621, Fátima, Erechim 99709-910, RS, Brazil
3
Department of Food Science and Technology, Federal University of Santa Maria, Avenida Roraima, 1000, Camobi, Santa Maria 97105-900, RS, Brazil
*
Author to whom correspondence should be addressed.
Microbiol. Res. 2022, 13(2), 315-322; https://doi.org/10.3390/microbiolres13020024
Submission received: 8 December 2021 / Revised: 6 January 2022 / Accepted: 7 January 2022 / Published: 1 June 2022
Browse Figure
Versions Notes

Abstract

Flaxseed (Linum usitatissimum L.) displays functional properties and contains α-linolenic acid (omega-3). It also contains soluble and insoluble fiber, lignans, phenolic acids, flavonoids, phytic acid, vitamins, and minerals. However, its microbiota can cause fungal contaminations, drastically reducing its quality. The objective of this work was to identify the fungi present in bulk flaxseed through the internal transcribed spacer (ITS1) intergenic region using a metataxonomics approach. Fungal identification was performed via high-performance sequencing of the ITS1 region using ITS1 (GAACCWGCGGARGGATCA) and ITS2 (GCTGCGTTCTTCATCGATGC) as primers with 300 cycles and single-end sequencing in the MiSeq Sequencing System equipment (Illumina Inc., San Diego, CA, USA). Six genera and eight species of fungi were found in the sample. The genus Aspergillus stood out with three xerophilic species found, A. cibarius, A. Appendiculatus, and A. amstelodami, the first being the most abundant. The second most abundant genus was Wallemia, with the species W. muriae. This is one of the fungi taxa with great xerophilic potential, and some strains can produce toxins. Metataxonomics has proved to be a complete, fast, and efficient method to identify different fungi. Furthermore, high-performance genetic sequencing is an important ally in research, helping to develop novel technological advances related to food safety.
Keywords: metataxonomics; genomics; flaxseed; fungi; genetic sequencing metataxonomics; genomics; flaxseed; fungi; genetic sequencing

Share and Cite

MDPI and ACS Style

Rollemberg, N.d.C.; Hassemer, G.d.S.; Pierezan, M.D.; Maran, B.M.; Dalla Nora, F.M.; Verruck, S. Identification of Fungi in Flaxseed (L. usitatissimum L.) Using the ITS1 and ITS2 Intergenic Regions. Microbiol. Res. 2022, 13, 315-322. https://doi.org/10.3390/microbiolres13020024

AMA Style

Rollemberg NdC, Hassemer GdS, Pierezan MD, Maran BM, Dalla Nora FM, Verruck S. Identification of Fungi in Flaxseed (L. usitatissimum L.) Using the ITS1 and ITS2 Intergenic Regions. Microbiology Research. 2022; 13(2):315-322. https://doi.org/10.3390/microbiolres13020024

Chicago/Turabian Style

Rollemberg, Nathalia de Castro, Guilherme de Souza Hassemer, Milena Dutra Pierezan, Bruna Marchesan Maran, Flávia Michelon Dalla Nora, and Silvani Verruck. 2022. "Identification of Fungi in Flaxseed (L. usitatissimum L.) Using the ITS1 and ITS2 Intergenic Regions" Microbiology Research 13, no. 2: 315-322. https://doi.org/10.3390/microbiolres13020024

APA Style

Rollemberg, N. d. C., Hassemer, G. d. S., Pierezan, M. D., Maran, B. M., Dalla Nora, F. M., & Verruck, S. (2022). Identification of Fungi in Flaxseed (L. usitatissimum L.) Using the ITS1 and ITS2 Intergenic Regions. Microbiology Research, 13(2), 315-322. https://doi.org/10.3390/microbiolres13020024

Article Metrics

Back to TopTop