Fabrication of Injectable Kartogenin-Conjugated Composite Hydrogel with a Sustained Drug Release for Cartilage Repair
Abstract
:1. Introduction
2. Materials and Methods
2.1. Materials
2.2. Synthesis of the CS-KGN Polymer
2.3. Synthesis of the OSA Polymer
2.4. Preparation of the CS-KGN/OSA Composite Hydrogel
2.5. Structural Characterizations
2.6. Compressive Strength Measurement
2.7. Rheology Study
2.8. Adhesive Study
2.9. Burst Pressure Test
2.10. Swelling Behavior
2.11. Cumulative Release of KGN In Vitro
2.12. Cell Seeding and Cell–Hydrogel Composite Culture
2.13. Cell Cytotoxicity and Proliferation
2.14. Live and Dead Assay
2.15. Semiquantitative RT-PCR
2.16. Quantification of DNA, GAG, and COL-2 Content
2.17. Statistics Analysis
3. Results and Discussion
3.1. Preparation and Characterization of Polymers
3.2. The Porous Structures and Mechanical Properties of Hydrogels
3.3. The Swelling Property and Drug Release from the CS-KGN/OSA Hydrogel
3.4. Cell Biocompatibility of the CS-KGN/OSA Hydrogels
3.5. Chondrogenic Differentiation
4. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Langer, R.; Vacanti, J.T. Tissue engineering. Science 1993, 260, 920. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Chung, C.; Burdick, J.A. Engineering cartilage tissue. Adv. Drug Deliv. Rev. 2008, 60, 243–262. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Huey, D.J.; Hu, J.C.; Athanasiou, K.A. Unlike bone, cartilage regeneration remains elusive. Science 2012, 338, 917–921. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Klein, J. Repair or replacement—A joint perspective. Science 2009, 323, 47–48. [Google Scholar] [CrossRef] [PubMed]
- Detterline, A.J.; Goldberg, S.; Bach, B.R.; Cole, B.J. Treatment options for articular cartilage defects of the knee. Orthop. Nurs. 2005, 24, 361–366. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Mardones, R.; Jofré, C.M.; Minguell, J.J. Cell therapy and tissue engineering approaches for cartilage repair and/or regeneration. Int. J. Stem Cells 2015, 8, 48–53. [Google Scholar] [CrossRef]
- Marlovits, S.; Zeller, P.; Singer, P.; Resinger, C.; Vécsei, V. Cartilage repair: Generations of autologous chondrocyte transplantation. Eur. J. Radiol. 2006, 57, 24–31. [Google Scholar] [CrossRef]
- Xu, B.; Ye, J.; Yuan, F.-Z.; Zhang, J.-Y.; Chen, Y.-R.; Fan, B.-S.; Jiang, D.; Jiang, W.-B.; Wang, X.; Yu, J.-K. Advances of stem cell-laden hydrogels with biomimetic microenvironment for osteochondral repair. Front. Bioeng. Biotechnol. 2020, 8, 247. [Google Scholar] [CrossRef] [Green Version]
- Zhang, W.; Chen, R.; Xu, X.; Zhu, L.; Liu, Y.; Yu, X.; Tang, G. Construction of biocompatible hydrogel scaffolds with a long-term drug release for facilitating cartilage repair. Front. Pharmacol. 2022, 13, 922032. [Google Scholar] [CrossRef]
- Hu, X.; Wang, Y.; Tan, Y.; Wang, J.; Liu, H.; Wang, Y.; Yang, S.; Shi, M.; Zhao, S.; Zhang, Y.; et al. A difunctional regeneration scaffold for knee repair based on aptamer-directed cell recruitment. Adv. Mater. 2017, 29, 1605235. [Google Scholar] [CrossRef]
- Wang, S.J.; Jiang, D.; Zhang, Z.Z.; Chen, Y.R.; Yang, Z.D.; Zhang, J.Y.; Shi, J.J.; Wang, X.; Yu, J.K. Biomimetic nanosilica-collagen scaffolds for in situ bone regeneration: Toward a cell-free, one-step surgery. Adv. Mater. 2019, 31, 1904341. [Google Scholar] [CrossRef]
- Xu, B.; Ye, J.; Fan, B.-S.; Wang, X.; Zhang, J.-Y.; Song, S.; Song, Y.; Jiang, W.-B.; Wang, X.; Yu, J.-K. Protein-spatiotemporal partition releasing gradient porous scaffolds and anti-inflammatory and antioxidant regulation remodel tissue engineered anisotropic meniscus. Bioact. Mater. 2023, 20, 194–207. [Google Scholar] [CrossRef]
- Wang, X.; Yang, Y.; Shi, Y.; Jia, F. Editorial: Smart hydrogels in tissue engineering and regenerative medicine. Front. Chem. 2020, 8, 245. [Google Scholar] [CrossRef]
- Dou, X.; Cao, Q.; Sun, F.; Wang, Y.; Wang, H.; Shen, H.; Yang, F.; Wang, X.; Wu, D. Synergistic control of dual cross-linking strategy toward tailor-made hydrogels. Sci. China Chem. 2020, 63, 1793–1798. [Google Scholar] [CrossRef]
- Zhu, T.; Wang, H.; Jing, Z.; Fan, D.; Liu, Z.; Wang, X.; Tian, Y. High efficacy of tetra-PEG hydrogel sealants for sutureless dural closure. Bioact. Mater. 2022, 8, 12–19. [Google Scholar] [CrossRef]
- Yu, Y.; Yu, T.; Wang, X.; Liu, D. Functional hydrogels and their applications in craniomaxillofacial bone regeneration. Pharmaceutics 2023, 15, 150. [Google Scholar] [CrossRef]
- Mohammadpour, Z.; Kharaziha, M.; Zarrabi, A. 3D-printing of silk nanofibrils reinforced alginate for soft tissue engineering. Pharmaceutics 2023, 15, 763. [Google Scholar] [CrossRef]
- Dou, X.; Wang, H.; Yang, F.; Shen, H.; Wang, X.; Wu, D. One-step soaking strategy toward anti-swelling hydrogels with a stiff “armor”. Adv. Sci. 2023, 10, 2206242. [Google Scholar] [CrossRef]
- Hua, Y.; Xia, H.; Jia, L.; Zhao, J.; Zhao, D.; Yan, X.; Zhang, Y.; Tang, S.; Zhou, G.; Zhu, L.; et al. Ultrafast, tough, and adhesive hydrogel based on hybrid photocrosslinking for articular cartilage repair in water-filled arthroscopy. Sci. Adv. 2021, 7, eabg0628. [Google Scholar] [CrossRef]
- Lin, Y.-T.; Hsu, T.-T.; Liu, Y.-W.; Kao, C.-T.; Huang, T.-H. Bidirectional differentiation of human-derived stem cells induced by biomimetic calcium silicate-reinforced gelatin methacrylate bioink for odontogenic regeneration. Biomedicines 2021, 9, 929. [Google Scholar] [CrossRef]
- Seliktar, D. Designing cell-compatible hydrogels for biomedical applications. Science 2012, 336, 1124–1128. [Google Scholar] [CrossRef] [PubMed]
- Tang, G.; Zhou, B.; Li, F.; Wang, W.; Liu, Y.; Wang, X.; Liu, C.; Ye, X.J. Advances of naturally-derived and synthetic hydrogels for intervertebral disc regeneration. Front. Bioeng. Biotechnol. 2020, 8, 745. [Google Scholar] [CrossRef]
- Wang, H.; Wang, X.; Wu, D. Recent advances of natural polysaccharide-based double network hydrogels for tissue repair. Chem-Asian J. 2022, 17, e202200659. [Google Scholar] [CrossRef] [PubMed]
- Yang, Y.; Zhou, M.; Peng, J.; Wang, X.; Liu, Y.; Wang, W.; Wu, D. Robust, anti-freezing and conductive bonding of chitosan-based double-network hydrogels for stable-performance flexible electronic. Carbohydr. Polym. 2022, 276, 118753. [Google Scholar] [CrossRef] [PubMed]
- Feng, W.; Wang, Z. Biomedical applications of chitosan-graphene oxide nanocomposites. iScience 2022, 25, 103629. [Google Scholar] [CrossRef]
- Yang, Y.; Wang, X.; Yang, F.; Wang, L.; Wu, D. Highly elastic and ultratough hybrid ionic-covalent hydrogels with tunable structures and mechanics. Adv. Mater. 2018, 30, 1707071. [Google Scholar] [CrossRef]
- Yang, Y.; Wang, X.; Wu, D. Chitosan-based high-mechanical double-network hydrogels: Construction, modulation and applications. Acta Chim. Sin. 2021, 79, 1. [Google Scholar] [CrossRef]
- Peers, S.; Montembault, A.; Ladavière, C. Chitosan hydrogels incorporating colloids for sustained drug delivery. Carbohydr. Polym. 2022, 275, 118689. [Google Scholar] [CrossRef]
- Ding, W.; Zhou, J.; Zeng, Y.; Wang, Y.-N.; Shi, B. Preparation of oxidized sodium alginate with different molecular weights and its application for crosslinking collagen fiber. Carbohydr. Polym. 2017, 157, 1650–1656. [Google Scholar] [CrossRef]
- Gomez, C.; Rinaudo, M.; Villar, M. Oxidation of sodium alginate and characterization of the oxidized derivatives. Carbohydr. Polym. 2007, 67, 296–304. [Google Scholar] [CrossRef]
- Johnson, K.; Zhu, S.; Tremblay, M.S.; Payette, J.N.; Wang, J.; Bouchez, L.C.; Meeusen, S.; Althage, A.; Cho, C.Y.; Wu, X.; et al. A stem cell–based approach to cartilage repair. Science 2012, 336, 717–721. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Chen, Y.R.; Yan, X.; Yuan, F.Z.; Lin, L.; Wang, S.J.; Ye, J.; Zhang, J.Y.; Yang, M.; Wu, D.C.; Wang, X.; et al. KGN-conjugated double-network hydrogel combined with stem cells transplantation and tracing for cartilage repair. Adv. Sci. 2022, 9, 2105571. [Google Scholar] [CrossRef] [PubMed]
- Xu, X.; Liang, Y.; Li, X.; Ouyang, K.; Wang, M.; Cao, T.; Li, W.; Liu, J.; Xiong, J.; Li, B.; et al. Exosome-mediated delivery of kartogenin for chondrogenesis of synovial fluid-derived mesenchymal stem cells and cartilage regeneration. Biomaterials 2022, 269, 120539. [Google Scholar] [CrossRef] [PubMed]
- Yuan, F.-Z.; Wang, H.-F.; Guan, J.; Fu, J.-N.; Yang, M.; Zhang, J.-Y.; Chen, Y.-R.; Wang, X.; Yu, J.-K. Fabrication of injectable chitosan-chondroitin sulfate hydrogel embedding kartogenin-loaded microspheres as an ultrasound-triggered drug delivery system for cartilage tissue engineering. Pharmaceutics 2021, 13, 1487. [Google Scholar] [CrossRef] [PubMed]
- Yu, X.; Lin, F.; Li, P.; Yan, S.; Zhang, K.; Cui, W.; Yin, J. Porous scaffolds with enzyme-responsive Kartogenin release for recruiting stem cells and promoting cartilage regeneration. Chem. Eng. J. 2022, 447, 137454. [Google Scholar] [CrossRef]
- Houreh, A.B.; Masaeli, E.; Nasr-Esfahani, M.H. Chitosan/polycaprolactone multilayer hydrogel: A sustained Kartogenin delivery model for cartilage regeneration. Int. J. Biol. Macromol. 2021, 177, 589–600. [Google Scholar] [CrossRef]
- Hu, Q.; Ding, B.; Yan, X.; Peng, L.; Duan, J.; Yang, S.; Cheng, L.; Chen, D. Polyethylene glycol modified PAMAM dendrimer delivery of kartogenin to induce chondrogenic differentiation of mesenchymal stem cells. Nanomedicine 2017, 13, 2189–2198. [Google Scholar] [CrossRef]
- Dong, Y.; Liu, Y.; Chen, Y.; Sun, X.; Zhang, L.; Zhang, Z.; Wang, Y.; Qi, C.; Wang, S.; Yang, Q. Spatiotemporal regulation of endogenous MSCs using a functional injectable hydrogel system for cartilage regeneration. NPG Asia Mater. 2021, 13, 71. [Google Scholar] [CrossRef]
- Li, Y.; Zhou, M.; Zheng, W.; Yang, J.; Jiang, N. Scaffold-based tissue engineering strategies for soft–hard interface regeneration. Regen. Biomater. 2023, 10, rbac091. [Google Scholar] [CrossRef]
- Azuma, K.; Nishihara, M.; Shimizu, H.; Itoh, Y.; Takashima, O.; Osaki, T.; Itoh, N.; Imagawa, T.; Murahata, Y.; Tsuka, T.; et al. Biological adhesive based on carboxymethyl chitin derivatives and chitin nanofibers. Biomaterials 2015, 42, 20–29. [Google Scholar] [CrossRef]
- Wang, H.; Cheng, J.; Sun, F.; Dou, X.; Liu, J.; Wang, Y.; Li, M.; Gao, J.; Liu, X.; Wang, X.; et al. A super tough, rapidly biodegradable, ultrafast hemostatic bioglue. Adv. Mater. 2023, 35, 2208622. [Google Scholar] [CrossRef]
- Atala, A.; Bauer, S.B.; Soker, S.; Yoo, J.J.; Retik, A.B. Tissue-engineered autologous bladders for patients needing cystoplasty. Lancet 2006, 367, 1241–1246. [Google Scholar] [CrossRef]
- Roy, D.; Tomo, S.; Modi, A.; Purohit, P.; Sharma, P. Optimising total RNA quality and quantity by phenol-chloroform extraction method from human visceral adipose tissue: A standardisation study. MethodsX 2020, 7, 101113. [Google Scholar] [CrossRef]
- Ghaffar, A.; Draaisma GJ, J.; Mihov, G.; Dias, A.A.; Schoenmakers, P.J.; Van Der Wal, S. Monitoring the in vitro enzyme-mediated degradation of degradable poly(ester amide) for controlled drug delivery by LC-TOF-MS. Biomacromolecules 2011, 12, 3243–3251. [Google Scholar] [CrossRef]
- Zhang, J.; Wang, J.H.-C. Kartogenin induces cartilage-like tissue formation in tendon–bone junction. Bone Res. 2014, 2, 14008. [Google Scholar] [CrossRef] [Green Version]
Gene | Forward Primers (5′–3′) | Reverse Primers (5′–3′) |
---|---|---|
COL2 | GCAGCTGTGTGCAGGAGGGGAAG | TGGCAGTGGCGAGGTCAGTAGGG |
ACAN | GACTCATTGTTAGAGGACAGCCA | CACTCCCAAAAAGAACTCCAGAT |
PRG4 | GGCAGGGAATGTGACTGTGATG | TGGGTGAGCGTTTAGTTGTTGA |
SOX9 | CGGCGGAGGAAGTCGGTGAAGA | AGTGGTGGGTGGGGTGGTGGTG |
GAPDH | CATCAAGAAGGTGGTGAAGCAGG | AGCATCGAAGGTAGAGGAGTGGG |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Li, C.; Liu, Y.; Weng, T.; Yang, M.; Wang, X.; Chai, W. Fabrication of Injectable Kartogenin-Conjugated Composite Hydrogel with a Sustained Drug Release for Cartilage Repair. Pharmaceutics 2023, 15, 1949. https://doi.org/10.3390/pharmaceutics15071949
Li C, Liu Y, Weng T, Yang M, Wang X, Chai W. Fabrication of Injectable Kartogenin-Conjugated Composite Hydrogel with a Sustained Drug Release for Cartilage Repair. Pharmaceutics. 2023; 15(7):1949. https://doi.org/10.3390/pharmaceutics15071949
Chicago/Turabian StyleLi, Chao, Yubo Liu, Tujun Weng, Muyuan Yang, Xing Wang, and Wei Chai. 2023. "Fabrication of Injectable Kartogenin-Conjugated Composite Hydrogel with a Sustained Drug Release for Cartilage Repair" Pharmaceutics 15, no. 7: 1949. https://doi.org/10.3390/pharmaceutics15071949
APA StyleLi, C., Liu, Y., Weng, T., Yang, M., Wang, X., & Chai, W. (2023). Fabrication of Injectable Kartogenin-Conjugated Composite Hydrogel with a Sustained Drug Release for Cartilage Repair. Pharmaceutics, 15(7), 1949. https://doi.org/10.3390/pharmaceutics15071949