Analysis of Pineapple Mealybug Wilt Associated Virus -1 and -2 for Potential RNA Silencing Suppressors and Pathogenicity Factors
Abstract
1. Introduction
2. Materials and Methods
2.1. DNA Constructs

| Primers | Description or Sequence | Modifications |
|---|---|---|
| Primers for constructing expression vectors | ||
| PMWaV-2 (HSP70) F | NNNGGATCCATGGAAGTAGGATACGA | BamH1 |
| PMWaV-2 (HSP70) F | NNNGAATTCCTATAGCCATCTCTTAC | EcoR-1 |
| PMWaV-2 (P46) F | NNNGGATCCATGCATCGCGAGTCCGC | BamH1 |
| PMWaV-2 (P46) R | NNNGAATTCTTAAGTATTCGAACCAT | EcoR-1 |
| PMWaV-2 (CP) F | NNNGGATCCATGGCTCAGAATTACGTAGC | BamH1 |
| PMWaV-2 (CP) R | NNNGGTACCCTACCCTGAAACAGCTC | Kpn-1 |
| PMWaV-2 (Cpd) F | NNNAGGCCTATGGAATTACAGCGGAT | Stu-1 |
| PMWaV-2 (Cpd) R | NNNGAATTCCTAAACTCCATTATTTC | EcoR-1 |
| PMWaV-2 (P20) F | NNNGGATCCATGGAGTTTAGACCGAT | BamH1 |
| PMWaV-2 (P20) R | NNNGAATTCTCATACTGGTATTTTGG | EcoR-1 |
| PMWaV-2 (p22) F | NNNGGATCCATGAGTGAGGAGATCCTG | BamH1 |
| PMWaV-2 (p22) R | NNNGGTACCTCATTTCTTACGACAGTTTCGG | Kpn-1 |
| PMWaV-2 (P6) F | NNNGGATCCATGAACACGAATGCTAA | BamH1 |
| PMWaV-2 (P6) R | NNNGAATTCTTAATATTCATTTATAT | EcoR-1 |
| PMWaV-1 (Hsp70) F | NNNGGATCCATGGAGGTGGGTATTGATTT | BamH1 |
| PMWaV-1 (Hsp70) R | NNNGGTACCTCACCTAACAATTTTGGAAT | Kpn-1 |
| PMWaV-1 (p61) F | NNNAGGCCTATGGCTTTGAGAGCAACTAG | Stu-1 |
| PMWaV-1 (p61) F | NNNGGTACCTCACTGAGTGTGTTTTAATA | Kpn-1 |
| PMWaV-1 (CP) F | NNNAGGCCTATGGCTGATTCGAGCAAACA | Stu-1 |
| PMWaV-1 (CP) R | NNNGGTACCTTAGCGTCCACCCATAA | Kpn-1 |
| PMWaV-1 (P24) F | NNNAGGCCTATGGAGAGGATTATATTGGT | Stu-1 |
| PMWaV-1 (P24) R | NNNGGTACCTTAGATTTCAGATAGGATAC | Kpn-1 |
| Primers for constructing PVX vectors | ||
| PVX-PMWaV-2 (P20)F | NNNATCGATGGTAGCGACTCTGAGGTCTACAA | Cla-1 |
| PVX-PMWaV-2 (P20)R | NNNCCCGGGCAGGATCTCCTCACTCATACTGGT | Xma-1 |
| PVX-PMWaV-2 (P22)F | NNNGTCGACCGCTATTAGACGCAACTATTCTGTTACC | Sal-1 |
| PVX-PMWaV-2 (P22)R | NNNCCCGGGAGCATTCGTGTTCATTTCTTACGACA | Xma-1 |
| PVX-PMWaV-2 (CP)F | NNNATCGATTCGTAGATTAAAGGCGATATGGCTC | Cla-1 |
| PVX-PMWaV-2 (CP)R | NNNGTCGACTTCTTCCTCCTACCCTGAAACAG | Sal-1 |
| PVX PMWaV-2 (p20fs)F | GAGATCTCGACTGAAGTCGG | |
| PVX PMWaV-2 (p20fs)R | CCGACTTCAGTCGAGATCTC | |
| Primers to clone genes for producing in vitro transcription templates | ||
| pTOPO (GFP)F | TTTCACTGGAGTTGTCCCAA | |
| pTOPO (GFP)R | GGCCATGGAACAGGTAGTTT | |
| PVX (CP)F | ATGTCAGCACCAGCTAGCACAACAC | |
| PVX (CP)R | TTATGGTGGTAGAGTGACAACAGCC | |
2.2. RNA Isolation and Analysis
3. Results
3.1. Screening the 3’-Proximal ORFs of PMWaV-1 and PMWaV-2 for Local RNA Silencing Suppressors


3.2. Effects of PMWaVs ORFs on the Short Distance Spread (10-15 cells) of the GFP Silencing Signal in N. Benthamiana 16C Plants

3.3. Effect of GFP dsRNA on PMWaV-2 p20 and CP Suppression of GFP Local Silencing


3.4. Screening for Systemic RNA Silencing Suppressors from the 3’-end Proximal ORFs of PMWaV-1 and PMWaV-2
| Silenced | Not Silenced | ||
|---|---|---|---|
| Virus | Gene/Construct | No. Plants Infiltrated | Suppression Efficiency (%) |
| pBIC Vector | 61 | 33 | |
| TBSV | P19 | 45 | 100* |
| PMWaV-2 | Hsp70 | 40 | 22 |
| PMWaV-2 | P46 | 55 | 20 |
| PMWaV-2 | CP | 69 | 74 * |
| PMWaV-2 | CPd | 50 | 30 |
| PMWaV-2 | P20 | 63 | 52 * |
| PMWaV-2 | P22 | 64 | 36 |
| PMWaV-2 | P6 | 45 | 20 |
| PMWaV-1 | Hsp70 | 50 | 24 |
| PMWaV-1 | P61 | 60 | 30 |
| PMWaV-1 | CP | 55 | 36 |
| PMWaV-1 | P24 | 45 | 18 |
| Virus | Gene | 1 | 2 | 3 | 4 | ||
|---|---|---|---|---|---|---|---|
| No. Plants Infiltrated | Suppression Efficiency (%) | Suppression Efficiency (%) | No. Plants Infiltrated | Suppression Efficiency (%) | Suppression Efficiency (%) | ||
| Vector | 53 | 4 | 17 | 35 | 3 | 2 | |
| TBSV | p19 | 40 | 97 * | 7 | 25 | 92 * | 42 |
| PMWaV-2 | CP | 28 | 100 * | 7 | 28 | 100 * | 42 |
| PMWaV-2 | p20 | 20 | 85 * | 35 | 30 | 83 * | 34 |
| PMWaV-2 | Hsp70 | 20 | 15 | 5 | 25 | 16 | 24 |
| PMWaV-2 | p22 | 24 | 83 * | 29 | 24 | 79 * | 25 |
| PMWaV-2 | p6 | 24 | 12 | 17 | 24 | 13 | 29 |
| PMWaV-2 | Cpd | 20 | 60 * | 6 | 25 | 84 * | 28 |
| PMWaV-2 | p46 | 20 | 40 | 6 | 22 | 27 | 14 |
| PMWaV-1 | Hsp70 | 20 | 15 | 5 | 24 | 16 | 29 |
| PMWaV-1 | CP | 16 | 37 | 19 | 16 | 38 | 31 |
| PMWaV-1 | p61 | 24 | 75 * | 17 | 20 | 88 * | 30 |
| PMWaV-1 | p24 | 24 | 41 | 25 | 22 | 18 | 32 |

3.5. PMWaV-2 p20 and CP have the Ability to Repress Accumulation of Secondary siRNAs

3.6. Identification of Pathogenicity Factors by Expression of Selected PMWaV-2 ORFs from the Heterologous Potato Virus X Vector
| Description | p22 | p20 | CP | p20 FS | PVX |
|---|---|---|---|---|---|
| Number of plants with PVX symptoms/total number of plants | 13/32 | 11/32 | 13/32 | 4/8 | 24/28 |
| Number of plants with gene specific symptoms/total number of plants with PVX symptoms | 3/13 | 7/11 | 0/13 | 0/4 | - |

4. Discussion
Supplementary Files
Supplementary File 1Acknowledgments
Author Contributions
Conflicts of Interest
References
- Martelli, G.; Agranovsky, A.; Bar-Joseph, M.; Boscia, D.; Candresse, T.; Coutts, R.; Dolja, V.; Falk, B.; Gonsalves, D.; Jelkmann, W. The family closteroviridae revised. Arch. Virol. 2002, 147, 2039–2044. [Google Scholar] [CrossRef] [PubMed]
- Gambley, C.; Steele, V.; Geering, A.; Thomas, J. The genetic diversity of ampeloviruses in australian pineapples and their association with mealybug wilt disease. Australas. Plant Pathol. 2008, 37, 95–105. [Google Scholar] [CrossRef]
- Sether, D.; Ullman, D.; Hu, J. Transmission of pineapple mealybug wilt-associated virus by two species of mealybug (Dysmicoccus spp.). Phytopathology 1998, 88, 1224–1230. [Google Scholar] [CrossRef] [PubMed]
- Sether, D.; Hu, J. Closterovirus infection and mealybug exposure are necessary for the development of mealybug wilt of pineapple disease. Phytopathology 2002, 92, 928–935. [Google Scholar] [CrossRef] [PubMed]
- Dolja, V.V.; Kreuze, J.F.; Valkonen, J. Comparative and functional genomics of closteroviruses. Virus Res. 2006, 117, 38–51. [Google Scholar] [CrossRef] [PubMed]
- Jarugula, S.; Gowda, S.; Dawson, W.O.; Naidu, R.A. 3'-coterminal subgenomic rnas and putative cis-acting elements of grapevine leafroll-associated virus 3 reveals' unique'features of gene expression strategy in the genus ampelovirus. Virol. J. 2010, 7, 1–14. [Google Scholar] [CrossRef] [PubMed]
- Sether, D.; Hu, J. Yield impact and spread of pineapple mealybug wilt associated virus-2 and mealybug wilt of pineapple in hawaii. Plant Dis. 2002, 86, 867–874. [Google Scholar] [CrossRef]
- Melzer, M.; Karasev, A.; Sether, D.; Hu, J. Nucleotide sequence, genome organization and phylogenetic analysis of pineapple mealybug wilt-associated virus-2. J. Gen. Virol. 2001, 82, 1–7. [Google Scholar] [PubMed]
- Melzer, M.; Sether, D.; Karasev, A.; Borth, W.; Hu, J. Complete nucleotide sequence and genome organization of pineapple mealybug wilt-associated virus-1. Arch. Virol. 2008, 153, 707–714. [Google Scholar] [CrossRef] [PubMed]
- Llave, C. Virus-derived small interfering rnas at the core of plant–virus interactions. Trends Plant Sci. 2010, 15, 701–707. [Google Scholar] [CrossRef] [PubMed]
- Ding, S.-W.; Voinnet, O. Antiviral immunity directed by small rnas. Cell 2007, 130, 413–426. [Google Scholar] [CrossRef] [PubMed]
- Li, F.; Ding, S.-W. Virus counterdefense: Diverse strategies for evading the rna-silencing immunity. Annu. Rev. Microbiol. 2006, 60, 503–531. [Google Scholar] [CrossRef] [PubMed]
- Hamilton, A.; Voinnet, O.; Chappell, L.; Baulcombe, D. Two classes of short interfering rna in rna silencing. EMBO J. 2002, 21, 4671–4679. [Google Scholar] [CrossRef] [PubMed]
- Burgyán, J.; Havelda, Z. Viral suppressors of rna silencing. Trends Plant Sci. 2011, 16, 265–272. [Google Scholar] [CrossRef] [PubMed]
- Qu, F.; Ren, T.; Morris, T.J. The coat protein of turnip crinkle virus suppresses posttranscriptional gene silencing at an early initiation step. J. Virol. 2003, 77, 511–522. [Google Scholar] [CrossRef] [PubMed]
- Brodersen, P.; Voinnet, O. The diversity of rna silencing pathways in plants. Trends Genetics 2006, 22, 268–280. [Google Scholar] [CrossRef]
- Silhavy, D.; Molnár, A.; Lucioli, A.; Szittya, G.; Hornyik, C.; Tavazza, M.; Burgyán, J. A viral protein suppresses rna silencing and binds silencing-generated, 21-to 25-nucleotide double-stranded rnas. EMBO J. 2002, 21, 3070–3080. [Google Scholar] [CrossRef] [PubMed]
- Kasschau, K.D.; Xie, Z.; Allen, E.; Llave, C.; Chapman, E.J.; Krizan, K.A.; Carrington, J.C. P1/hc-pro, a viral suppressor of rna silencing, interferes with arabidopsis development and miRNA function. Dev. Cell 2003, 4, 205–217. [Google Scholar] [CrossRef] [PubMed]
- Reed, J.C.; Kasschau, K.D.; Prokhnevsky, A.I.; Gopinath, K.; Pogue, G.P.; Carrington, J.C.; Dolja, V.V. Suppressor of rna silencing encoded by beet yellows virus. Virology 2003, 306, 203–209. [Google Scholar] [CrossRef] [PubMed]
- Chapman, E.J.; Prokhnevsky, A.I.; Gopinath, K.; Dolja, V.V.; Carrington, J.C. Viral rna silencing suppressors inhibit the microrna pathway at an intermediate step. Genes Dev. 2004, 18, 1179–1186. [Google Scholar] [CrossRef] [PubMed]
- Dunoyer, P.; Lecellier, C.-H.; Parizotto, E.A.; Himber, C.; Voinnet, O. Probing the microrna and small interfering rna pathways with virus-encoded suppressors of rna silencing. Plant Cell 2004, 16, 1235–1250. [Google Scholar] [CrossRef] [PubMed]
- Vargason, J.M.; Szittya, G.; Burgyán, J.; Hall, T.M.T. Size selective recognition of sirna by an rna silencing suppressor. Cell 2003, 115, 799–811. [Google Scholar] [CrossRef] [PubMed]
- Lakatos, L.; Csorba, T.; Pantaleo, V.; Chapman, E.J.; Carrington, J.C.; Liu, Y.P.; Dolja, V.V.; Calvino, L.F.; López-Moya, J.J.; Burgyán, J. Small rna binding is a common strategy to suppress rna silencing by several viral suppressors. EMBO J. 2006, 25, 2768–2780. [Google Scholar] [CrossRef] [PubMed]
- Mérai, Z.; Kerényi, Z.; Kertész, S.; Magna, M.; Lakatos, L.; Silhavy, D. Double-stranded rna binding may be a general plant rna viral strategy to suppress rna silencing. J. Virol. 2006, 80, 5747–5756. [Google Scholar] [CrossRef] [PubMed]
- Ding, S.-W. Rna-based antiviral immunity. Nat. Rev. Immunol. 2010, 10, 632–644. [Google Scholar] [CrossRef] [PubMed]
- Voinnet, O. Non-cell autonomous rna silencing. FEBS Lett. 2005, 579, 5858–5871. [Google Scholar] [CrossRef] [PubMed]
- Voinnet, O.; Vain, P.; Angell, S.; Baulcombe, D.C. Systemic spread of sequence-specific transgene rna degradation in plants is initiated by localized introduction of ectopic promoterless DNA. Cell 1998, 95, 177–187. [Google Scholar] [CrossRef] [PubMed]
- Chitwood, D.H.; Timmermans, M.C. Small rnas are on the move. Nature 2010, 467, 415–419. [Google Scholar] [CrossRef] [PubMed]
- Buhtz, A.; Springer, F.; Chappell, L.; Baulcombe, D.C.; Kehr, J. Identification and characterization of small rnas from the phloem of brassica napus. Plant J. 2008, 53, 739–749. [Google Scholar] [CrossRef] [PubMed]
- Schwach, F.; Vaistij, F.E.; Jones, L.; Baulcombe, D.C. An rna-dependent rna polymerase prevents meristem invasion by potato virus x and is required for the activity but not the production of a systemic silencing signal. Plant Physiol. 2005, 138, 1842–1852. [Google Scholar] [CrossRef] [PubMed]
- Himber, C.; Dunoyer, P.; Moissiard, G.; Ritzenthaler, C.; Voinnet, O. Transitivity-dependent and-independent cell-to-cell movement of rna silencing. EMBO J. 2003, 22, 4523–4533. [Google Scholar] [CrossRef] [PubMed]
- Zhang, X.; Yuan, Y.-R.; Pei, Y.; Lin, S.-S.; Tuschl, T.; Patel, D.J.; Chua, N.-H. Cucumber mosaic virus-encoded 2b suppressor inhibits arabidopsis argonaute1 cleavage activity to counter plant defense. Genes Dev. 2006, 20, 3255–3268. [Google Scholar] [CrossRef] [PubMed]
- Deleris, A.; Gallego-Bartolome, J.; Bao, J.; Kasschau, K.D.; Carrington, J.C.; Voinnet, O. Hierarchical action and inhibition of plant dicer-like proteins in antiviral defense. Science 2006, 313, 68–71. [Google Scholar] [CrossRef] [PubMed]
- Haas, G.; Azevedo, J.; Moissiard, G.; Geldreich, A.; Himber, C.; Bureau, M.; Fukuhara, T.; Keller, M.; Voinnet, O. Nuclear import of camv p6 is required for infection and suppression of the rna silencing factor drb4. EMBO J. 2008, 27, 2102–2112. [Google Scholar] [CrossRef] [PubMed]
- Wu, Q.; Wang, X.; Ding, S.-W. Viral suppressors of rna-based viral immunity: Host targets. Cell Host Microbe 2010, 8, 12–15. [Google Scholar] [CrossRef] [PubMed]
- Glick, E.; Zrachya, A.; Levy, Y.; Mett, A.; Gidoni, D.; Belausov, E.; Citovsky, V.; Gafni, Y. Interaction with host sgs3 is required for suppression of rna silencing by tomato yellow leaf curl virus v2 protein. Proc. Natl. Acad. Sci. USA 2008, 105, 157–161. [Google Scholar] [CrossRef] [PubMed]
- Brigneti, G.; Voinnet, O.; Li, W.X.; Ji, L.H.; Ding, S.W.; Baulcombe, D.C. Viral pathogenicity determinants are suppressors of transgene silencing in nicotiana benthamiana. EMBO J. 1998, 17, 6739–6746. [Google Scholar] [CrossRef] [PubMed]
- Kasschau, K.D.; Carrington, J.C. A counterdefensive strategy of plant viruses: Suppression of posttranscriptional gene silencing. Cell 1998, 95, 461–470. [Google Scholar] [CrossRef] [PubMed]
- Voinnet, O.; Pinto, Y.M.; Baulcombe, D.C. Suppression of gene silencing: A general strategy used by diverse DNA and rna viruses of plants. Proc. Natl. Acad. Sci. USA 1999, 96, 14147–14152. [Google Scholar] [CrossRef] [PubMed]
- Meister, G.; Tuschl, T. Mechanisms of gene silencing by double-stranded rna. Nature 2004, 431, 343–349. [Google Scholar] [CrossRef] [PubMed]
- Chen, J.; Li, W.X.; Xie, D.; Peng, J.R.; Ding, S.W. Viral virulence protein suppresses RNA silencing-mediated defense but upregulates the role of microrna in host gene expression. Plant Cell 2004, 16, 1302–1313. [Google Scholar] [CrossRef] [PubMed]
- Díaz-Pendón, J.A.; Ding, S.-W. Direct and indirect roles of viral suppressors of rna silencing in pathogenesis. Annu. Rev. Phytopathol. 2008, 46, 303–326. [Google Scholar] [CrossRef] [PubMed]
- Scholthof, H.B.; Scholthof, K.; Jackson, A.O. Identification of tomato bushy stunt virus host-specific symptom determinants by expression of individual genes from a potato virus x vector. Plant Cell 1995, 7, 1157–1172. [Google Scholar] [CrossRef] [PubMed]
- Pruss, G.; Ge, X.; Shi, X.M.; Carrington, J.C.; Vance, V.B. Plant viral synergism: The potyviral genome encodes a broad-range pathogenicity enhancer that transactivates replication of heterologous viruses. Plant Cell 1997, 9, 859–868. [Google Scholar] [CrossRef] [PubMed]
- Cañizares, M.C.; Navas-Castillo, J.; Moriones, E. Multiple suppressors of rna silencing encoded by both genomic rnas of the crinivirus, tomato chlorosis virus. Virology 2008, 379, 168–174. [Google Scholar] [CrossRef] [PubMed]
- Young, B.A.; Stenger, D.C.; Qu, F.; Morris, T.J.; Tatineni, S.; French, R. Tritimovirus p1 functions as a suppressor of rna silencing and an enhancer of disease symptoms. Virus Res. 2012, 163, 672–677. [Google Scholar] [CrossRef] [PubMed]
- Lu, R.; Folimonov, A.; Shintaku, M.; Li, W.-X.; Falk, B.W.; Dawson, W.O.; Ding, S.-W. Three distinct suppressors of rna silencing encoded by a 20-kb viral rna genome. Proc. Natl. Acad. Sci. USA 2004, 101, 15742–15747. [Google Scholar] [CrossRef] [PubMed]
- Gouveia, P.; Dandlen, S.; Costa, Â.; Marques, N.; Nolasco, G. Identification of an RNA silencing suppressor encoded by grapevine leafroll-associated virus 3. Eur. J. Plant Pathol. 2012, 133, 237–245. [Google Scholar] [CrossRef]
- Takeda, A.; Sugiyama, K.; Nagano, H.; Mori, M.; Kaido, M.; Mise, K.; Tsuda, S.; Okuno, T. Identification of a novel rna silencing suppressor, nss protein of tomato spotted wilt virus. FEBS Lett. 2002, 532, 75–79. [Google Scholar] [CrossRef] [PubMed]
- Cañizares, M.C.; Taylor, K.M.; Lomonossoff, G.P. Surface-exposed c-terminal amino acids of the small coat protein of cowpea mosaic virus are required for suppression of silencing. J. Gen. Virol. 2004, 85, 3431–3435. [Google Scholar] [CrossRef] [PubMed]
- Hamilton, A.J.; Baulcombe, D.C. A species of small antisense rna in posttranscriptional gene silencing in plants. Science 1999, 286, 950–952. [Google Scholar] [CrossRef] [PubMed]
- Dunoyer, P.; Himber, C.; Voinnet, O. Dicer-like 4 is required for rna interference and produces the 21-nucleotide small interfering rna component of the plant cell-to-cell silencing signal. Nat. Genet. 2005, 37, 1356–1360. [Google Scholar] [CrossRef] [PubMed]
- Dunoyer, P.; Himber, C.; Ruiz-Ferrer, V.; Alioua, A.; Voinnet, O. Intra-and intercellular rna interference in arabidopsis thaliana requires components of the microrna and heterochromatic silencing pathways. Nat. Genet. 2007, 39, 848–856. [Google Scholar] [CrossRef] [PubMed]
- Johansen, L.K.; Carrington, J.C. Silencing on the spot. Induction and suppression of rna silencing in the agrobacterium-mediated transient expression system. Plant Physiol. 2001, 126, 930–938. [Google Scholar] [CrossRef] [PubMed]
- Martínez-Priego, L.; Donaire, L.; Barajas, D.; Llave, C. Silencing suppressor activity of the tobacco rattle virus encoded 16-kda protein and interference with endogenous small rna-guided regulatory pathways. Virology 2008, 376, 346–356. [Google Scholar] [CrossRef] [PubMed]
- Dunoyer, P.; Schott, G.; Himber, C.; Meyer, D.; Takeda, A.; Carrington, J.C.; Voinnet, O. Small rna duplexes function as mobile silencing signals between plant cells. Science 2010, 328, 912–916. [Google Scholar] [CrossRef] [PubMed]
- Molnar, A.; Melnyk, C.W.; Bassett, A.; Hardcastle, T.J.; Dunn, R.; Baulcombe, D.C. Small silencing rnas in plants are mobile and direct epigenetic modification in recipient cells. Science 2010, 328, 872–875. [Google Scholar] [CrossRef] [PubMed]
- Yaegashi, H.; Takahashi, T.; Isogai, M.; Kobori, T.; Ohki, S.; Yoshikawa, N. Apple chlorotic leaf spot virus 50 kda movement protein acts as a suppressor of systemic silencing without interfering with local silencing in nicotiana benthamiana. J. Gen. Virol. 2007, 88, 316–324. [Google Scholar] [CrossRef] [PubMed]
- Zhang, J.; Dong, J.; Xu, Y.; Wu, J. V2 protein encoded by tomato yellow leaf curl china virus is an rna silencing suppressor. Virus Res. 2012, 163, 51. [Google Scholar] [CrossRef] [PubMed]
- Guo, H.S.; Ding, S.W. A viral protein inhibits the long range signaling activity of the gene silencing signal. EMBO J. 2002, 21, 398–407. [Google Scholar] [CrossRef] [PubMed]
- Vaistij, F.E.; Jones, L.; Baulcombe, D.C. Spreading of rna targeting and DNA methylation in rna silencing requires transcription of the target gene and a putative rna-dependent rna polymerase. Plant Cell 2002, 14, 857–867. [Google Scholar] [CrossRef] [PubMed]
- Moissiard, G.; Parizotto, E.A.; Himber, C.; Voinnet, O. Transitivity in arabidopsis can be primed, requires the redundant action of the antiviral dicer-like 4 and dicer-like 2, and is compromised by viral-encoded suppressor proteins. Rna 2007, 13, 1268–1278. [Google Scholar] [CrossRef] [PubMed]
- Guo, H.; Song, X.; Xie, C.; Huo, Y.; Zhang, F.; Chen, X.; Geng, Y.; Fang, R. Rice yellow stunt rhabdovirus protein 6 suppresses systemic rna silencing by blocking rdr6-mediated secondary sirna synthesis. Mol. Plant Microbe Interact. 2013, 26, 927–936. [Google Scholar] [CrossRef] [PubMed]
- Borroto-Fernández, E.; Torres-Acosta, J.; Laimer, M. Rt-pcr detection and protein-protein interaction of viral components of pineapple mealybug wilt-associated virus 2 in cuba. J. Plant Pathol. 2007, 89, 435–439. [Google Scholar]
- Gowda, S.; Satyanarayana, T.; Davis, C.L.; Navas-Castillo, J.; Albiach-Martı́, M.R.; Mawassi, M.; Valkov, N.; Bar-Joseph, M.; Moreno, P.; Dawson, W.O. The p20 gene product of citrus tristeza virus accumulates in the amorphous inclusion bodies. Virology 2000, 274, 246–254. [Google Scholar] [CrossRef] [PubMed]
- Peng, C.-W.; Napuli, A.J.; Dolja, V.V. Leader proteinase of beet yellows virus functions in long-distance transport. J. Virol. 2003, 77, 2843–2849. [Google Scholar] [CrossRef] [PubMed]
- Prokhnevsky, A.I.; Peremyslov, V.V.; Napuli, A.J.; Dolja, V.V. Interaction between long-distance transport factor and hsp70-related movement protein of beet yellows virus. J. Virol. 2002, 76, 11003–11011. [Google Scholar] [CrossRef] [PubMed]
- Kong, L.; Wang, Y.; Yang, X.; Sunter, G.; Zhou, X. Broad bean wilt virus 2 encoded vp53, vp37 and large capsid protein orchestrate suppression of rna silencing in plant. Virus Res. 2014, 192, 62–73. [Google Scholar] [CrossRef] [PubMed]
- Curaba, J.; Chen, X. Biochemical activities of arabidopsis rna-dependent rna polymerase 6. J. Biol. Chem. 2008, 283, 3059–3066. [Google Scholar] [CrossRef] [PubMed]
- Luo, Z.; Chen, Z. Improperly terminated, unpolyadenylated mrna of sense transgenes is targeted by rdr6-mediated rna silencing in arabidopsis. Plant Cell 2007, 19, 943–958. [Google Scholar] [CrossRef] [PubMed]
- Wassenegger, M.; Krczal, G. Nomenclature and functions of rna-directed rna polymerases. Trends Plant Sci. 2006, 11, 142–151. [Google Scholar] [CrossRef] [PubMed]
- Morel, J.-B.; Godon, C.; Mourrain, P.; Béclin, C.; Boutet, S.; Feuerbach, F.; Proux, F.; Vaucheret, H. Fertile hypomorphic argonaute (ago1) mutants impaired in post-transcriptional gene silencing and virus resistance. Plant Cell 2002, 14, 629–639. [Google Scholar] [CrossRef] [PubMed]
- Glazov, E.; Phillips, K.; Budziszewski, G.J.; Meins, F.; Levin, J.Z. A gene encoding an rnase d exonuclease‐like protein is required for post‐transcriptional silencing in arabidopsis. Plant J. 2003, 35, 342–349. [Google Scholar] [CrossRef] [PubMed]
- Dalmay, T.; Horsefield, R.; Braunstein, T.H.; Baulcombe, D.C. Sde3 encodes an rna helicase required for post‐transcriptional gene silencing in arabidopsis. EMBO J. 2001, 20, 2069–2077. [Google Scholar] [CrossRef] [PubMed]
- Gasciolli, V.; Mallory, A.C.; Bartel, D.P.; Vaucheret, H. Partially redundant functions of arabidopsis dicer-like enzymes and a role for dcl4 in producing trans-acting sirnas. Curr. Biol. 2005, 15, 1494–1500. [Google Scholar] [CrossRef] [PubMed]
- Xie, Z.; Allen, E.; Wilken, A.; Carrington, J.C. Dicer-like 4 functions in trans-acting small interfering rna biogenesis and vegetative phase change in arabidopsis thaliana. Proc. Natl. Acad. Sci. USA 2005, 102, 12984–12989. [Google Scholar] [CrossRef] [PubMed]
- Baumberger, N.; Tsai, C.-H.; Lie, M.; Havecker, E.; Baulcombe, D.C. The polerovirus silencing suppressor p0 targets argonaute proteins for degradation. Curr. Biol. 2007, 17, 1609–1614. [Google Scholar] [CrossRef] [PubMed]
- Bortolamiol, D.; Pazhouhandeh, M.; Marrocco, K.; Genschik, P.; Ziegler-Graff, V. The polerovirus f box protein p0 targets argonaute1 to suppress rna silencing. Curr. Biol. 2007, 17, 1615–1621. [Google Scholar] [CrossRef] [PubMed]
- Goto, K.; Kobori, T.; Kosaka, Y.; Natsuaki, T.; Masuta, C. Characterization of silencing suppressor 2b of cucumber mosaic virus based on examination of its small rna-binding abilities. Plant Cell Physiol. 2007, 48, 1050–1060. [Google Scholar] [CrossRef] [PubMed]
- Diaz-Pendon, J.A.; Li, F.; Li, W.-X.; Ding, S.-W. Suppression of antiviral silencing by cucumber mosaic virus 2b protein in arabidopsis is associated with drastically reduced accumulation of three classes of viral small interfering rnas. Plant Cell 2007, 19, 2053–2063. [Google Scholar] [CrossRef] [PubMed]
- Sarmiento, C.; Gomez, E.; Meier, M.; Kavanagh, T.A.; Truve, E. Cocksfoot mottle virus p1 suppresses rna silencing in nicotiana benthamiana and nicotiana tabacum. Virus Res. 2007, 123, 95–99. [Google Scholar] [CrossRef] [PubMed]
- Fusaro, A.F.; Correa, R.L.; Nakasugi, K.; Jackson, C.; Kawchuk, L.; Vaslin, M.F.; Waterhouse, P.M. The enamovirus p0 protein is a silencing suppressor which inhibits local and systemic rna silencing through ago1 degradation. Virology 2012, 426, 178–187. [Google Scholar] [CrossRef] [PubMed]
- Cao, X.; Zhou, P.; Zhang, X.; Zhu, S.; Zhong, X.; Xiao, Q.; Ding, B.; Li, Y. Identification of an RNA silencing suppressor from a plant double-stranded rna virus. J. Virol. 2005, 79, 13018–13027. [Google Scholar] [CrossRef] [PubMed]
- Palauqui, J.C.; Elmayan, T.; Pollien, J.M.; Vaucheret, H. Systemic acquired silencing: Transgene‐specific post‐transcriptional silencing is transmitted by grafting from silenced stocks to non‐silenced scions. EMBO J. 1997, 16, 4738–4745. [Google Scholar] [CrossRef] [PubMed]
- Gouveia, P.; Nolasco, G. The p19.7 RNA silencing suppressor from grapevine leafroll-associated virus 3 shows different levels of activity across phylogenetic groups. Virus Genes 2012, 45, 333–339. [Google Scholar] [CrossRef] [PubMed]
© 2015 by the authors; licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Dey, K.K.; Borth, W.B.; Melzer, M.J.; Wang, M.-L.; Hu, J.S. Analysis of Pineapple Mealybug Wilt Associated Virus -1 and -2 for Potential RNA Silencing Suppressors and Pathogenicity Factors. Viruses 2015, 7, 969-995. https://doi.org/10.3390/v7030969
Dey KK, Borth WB, Melzer MJ, Wang M-L, Hu JS. Analysis of Pineapple Mealybug Wilt Associated Virus -1 and -2 for Potential RNA Silencing Suppressors and Pathogenicity Factors. Viruses. 2015; 7(3):969-995. https://doi.org/10.3390/v7030969
Chicago/Turabian StyleDey, Kishore K., Wayne B. Borth, Michael J. Melzer, Ming-Li Wang, and John S. Hu. 2015. "Analysis of Pineapple Mealybug Wilt Associated Virus -1 and -2 for Potential RNA Silencing Suppressors and Pathogenicity Factors" Viruses 7, no. 3: 969-995. https://doi.org/10.3390/v7030969
APA StyleDey, K. K., Borth, W. B., Melzer, M. J., Wang, M.-L., & Hu, J. S. (2015). Analysis of Pineapple Mealybug Wilt Associated Virus -1 and -2 for Potential RNA Silencing Suppressors and Pathogenicity Factors. Viruses, 7(3), 969-995. https://doi.org/10.3390/v7030969


