The Gene Expression Profile of Milk Somatic Cells of Small Ruminant Lentivirus-Seropositive and -Seronegative Dairy Goats (Capra hircus) During Their First Lactation
Abstract
1. Introduction
2. Materials and Methods
2.1. Animals
2.2. Serodiagnosis of SRLV
2.3. Milk Somatic Cells Sampling and RNA Isolation
RNA Quality Assessment
2.4. Microarray Analysis
2.5. Signal Detection and Statistical Analysis
2.6. Validation of Microarray Data
2.7. Functional Analysis of Differentially Expressed Genes
3. Results
3.1. Milk Yield and Composition in Relation to SRLV Serological Status
3.2. Microarray Analysis, Along with Validation Through Reverse Transcription Quantitative PCR (RT-qPCR)
4. Discussion
4.1. Downregulation of DUSP 26 and APBB2 and Potential Connections with MSCs in SRLV-SP Goats
4.2. Downregulation of SCARA3
4.3. Low Expression of APBB2
4.4. Association of Studied Gene Expressions with Milk Yield and Composition
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Potarniche, A.V.; Cerbu, C.G.; Czopowicz, M.; Szalus-Jordanow, O.; Kaba, J.; Spinu, M. The epidemiological background of small ruminant lentivirus infection in goats from Romania. Vet. World 2020, 13, 1344–1350. [Google Scholar] [CrossRef] [PubMed]
- Blacklaws, B.A. Small ruminant lentiviruses: Immunopathogenesis of visna-maedi and caprine arthritis and encephalitis virus. Comp. Immunol. Microbiol. Infect. Dis. 2012, 35, 259–269. [Google Scholar] [CrossRef] [PubMed]
- Ramírez, H.; Reina, R.; Amorena, B.; Andrés, D.D.; Martínez, H.A. Small Ruminant Lentiviruses: Genetic Variability, Tropism and Diagnosis. Viruses 2013, 5, 1175–1207. [Google Scholar] [CrossRef] [PubMed]
- Kaba, J.; Czopowicz, M.; Witkowski, L.; Szaluś-Jordanow, O.; Mickiewicz, M.; Markowska-Daniel, I.; Puchała, R.; Bagnicka, E. Longitudinal Study on Seroreactivity of Goats Exposed to Colostrum and Milk of Small Ruminant Lentivirus-infected Dams. J. Vet. Res. 2022, 66, 511–521. [Google Scholar] [CrossRef]
- Axén, C.; Brytting, M.; Bujila, I.; Chenais, E.; Dryselius, R.; Eriksson, H.; Forsgren, E.; Grant, M.; Gröndahl, G.; Hallgren, G.; et al. Surveillance of Infectious Diseases in Animals and Humans in Sweden 2020; National Veterinary Institute (SVA): Uppsala, Sweden, 2020. [Google Scholar]
- Thomann, B.; Falzon, L.C.; Bertoni, G.; Vogt, H.R.; Schüpbach-Regula, G.; Magouras, I. A census to determine the prevalence and risk factors for caprine arthritis-encephalitis virus and visna/maedi virus in the Swiss goat population. Prev. Vet. Med. 2017, 137 Pt A, 52–58. [Google Scholar] [CrossRef]
- Tavella, A.; Bettini, A.; Ceol, M.; Zambotto, P.; Stifter, E.; Kusstatscher, N.; Lombardi, R.; Nardeli, S.; Beato, M.S.; Capello, K.; et al. Achievements of an eradication programme against caprine arthritis encephalitis virus in South Tyrol, Italy. Vet. Rec. 2018, 182, 51. [Google Scholar] [CrossRef]
- Nagel-Alne, G.E. Healthier Goats Disease Eradication Programme: A Healthy Initiative. Ph.D. Thesis, Norwegian University of Life Sciences, Ås, Norway, 2015. [Google Scholar]
- Jerre, A.; Rømo, G.; Klevar, S.; Åkerstedt, J.; Kampen, A.H.; Hektoen, L.; Nordstoga, A.B. Challenges using serological diagnostics in elimination of visna/maedi: Serological results from two outbreaks in Norwegian sheep. Small Rumin. Res. 2023, 229, 107149. [Google Scholar] [CrossRef]
- Ramírez, H.; Reina, R.; Amorena, B.; de Andrés, D.; Luján, L.; Martínez, H.A.; Pérez, M.M.; Barbezán, J.; Badiola, J.J.; Blacklaws, B.; et al. Small Ruminant Lentiviruses: Genetic Variability, Tropism and Diagnosis. Viruses 2013, 5, 1175–1207. [Google Scholar] [CrossRef]
- Nalbert, T.; Czopowicz, M.; Szaluś-Jordanow, O.; Witkowski, L.; Moroz, A.; Mickiewicz, M.; Markowska-Daniel, I.; Słoniewska, D.; Bagnicka, E.; Kaba, J.; et al. The effect of the subclinical small ruminant lentivirus infection of female goats on the growth of kids. PLoS ONE 2020, 15, e0230617. [Google Scholar] [CrossRef]
- Martínez-Navalón, B.; Peris, C.; Gómez, E.A.; Peris, B.; Roche, M.L.; Caballero, C.; Goyena, E.; Berriatua, E. Quantitative estimation of the impact of caprine arthritis encephalitis virus infection on milk production by dairy goats. Vet. J. 2013, 197, 311–317. [Google Scholar] [CrossRef]
- Kaba, J.; Strzałkowska, N.; Jóźwik, A.; Krzyżewski, J.; Bagnicka, E. Twelve-year cohort study on the influence of caprine arthritis-encephalitis virus infection on milk yield and composition. J. Dairy Sci. 2012, 95, 1617–1622. [Google Scholar] [CrossRef] [PubMed]
- Reczyńska, D.; Zalewska, M.; Czopowicz, M.; Kaba, J.; Zwierzchowski, L.; Bagnicka, E. Small Ruminant Lentivirus Infection Influences Expression of Acute Phase Proteins and Cathelicidin Genes in Milk Somatic Cells and Peripheral Blood Leukocytes of Dairy Goats. Vet. Res. 2018, 49, 113. [Google Scholar] [CrossRef] [PubMed]
- Kowalski, M. Normy żywienia kóz mlecznych. W: Normy żywienia przeżuwaczy: Wartość pokarmowa francuskich i krajowych pasz dla przeżuwaczy [In Polish], Standard of dairy goats’ feeging. In Standard of Ruminants’ Feeding: Nutrient Value of French and Domestic Fodders for Ruminants; Strzelecki, J., Ed.; Research Institute of Animal Production: Cracow, Poland, 2009; pp. 109–119. [Google Scholar]
- Czopowicz, M.; Szaluś-Jordanow, O.; Moroz, A.; Mickiewicz, M.; Witkowski, L.; Markowska-Daniel, I.; Bagnicka, E.; Kaba, J. Use of two commercial caprine arthritis-encephalitis immunoenzymatic assays for screening of arthritic goats. J. Vet. Diagn. Investig. 2018, 30, 36–41. [Google Scholar] [CrossRef]
- Pławińska-Czarnak, J.; Zarzyńska, J.; Bogdan, J.; Majewska, A.; Karwański, M.; Kizerwetter-Świda, M.; Kaba, J.; Anusz, K.; Bagnicka, E. An Optimized Method of RNA Isolation from Goat Milk Somatic Cells for Transcriptomic Analysis, Ann. Anim. Sci. 2019, 19, 605–617. [Google Scholar] [CrossRef]
- Pławińska-Czarnak, J.; Ochnio, L.; Zarzyńska, J.; Bogdan, J.; Kaba, J.; Majewska, A.; Bagnicka, E. Design and implementation of a database enhancing the collection, management and analysis of data in an animal sciences project. Anim. Sci. Pap. Rep. 2018, 36, 159–170. [Google Scholar]
- Pławińska-Czarnak, J.; Majewska, A.; Zarzyńska, J.; Bogdan, J.; Kaba, J.; Anusz, K.; Bagnicka, E. Gene Expression Profile in Peripheral Blood Nuclear Cells of Small Ruminant Lentivirus-Seropositive and Seronegative Dairy Goats in Their First Lactation. Animals 2021, 11, 940. [Google Scholar] [CrossRef]
- Zuker, M. Mfold web server for nucleic acid folding and hybridization prediction. Nucleic Acids Res. 2003, 31, 3406–3415. [Google Scholar] [CrossRef]
- Available online: http://oligocalc.eu/ (accessed on 27 May 2019).
- Finot, L.; Marnet, P.G.; Dessauge, F. Reference gene selection for quantitative real-time PCR normalization: Application in the caprine mammary gland. Small Rumin. Res. 2011, 95, 20–26. [Google Scholar] [CrossRef]
- Livak, K.J.; Schmittgen, T.D. Analysis of relative gene expression data using real-time quantitative PCR and the 2-ΔΔCT method. Methods 2001, 25, 402–408. [Google Scholar] [CrossRef]
- Jena, M.K.; Khan, F.B.; Ali, S.A.; Abdullah, A.; Sharma, A.K.; Yadav, V.; Kancharla, S.; Kolli, P.; Mandadapu, G.; Sahoo, A.K.; et al. Molecular complexity of mammary glands development: A review of lactogenic differentiation in epithelial cells. Artif. Cells Nanomed. Biotechnol. 2023, 51, 491–508. [Google Scholar] [CrossRef] [PubMed]
- Ha, J.; Kang, E.; Seo, J.; Cho, S. Phosphorylation Dynamics of JNK Signaling: Effects of Dual-Specificity Phosphatases (DUSPs) on the JNK Pathway. Int. J. Mol. Sci. 2019, 20, 6157. [Google Scholar] [CrossRef] [PubMed]
- Tian, Y.; Zhou, K.; Hu, J.; Shan, M.F.; Chen, H.J.; Cheng, S.; Liu, L.F.; Mei, X.L. Scavenger receptor class a, member 3 is associated with severity of hand, foot, and mouth disease in a case-control study. Medicine 2019, 98, e17471. [Google Scholar] [CrossRef] [PubMed]
- Mattson, M.P.; Meffert, M.K. Roles for NF-κB in nerve cell survival, plasticity, and disease. Cell Death Differ. 2006, 13, 852–860. [Google Scholar] [CrossRef] [PubMed]
- Golding, A.P.; Ferrier, B.; New, L.A.; Lu, P.; Martin, C.E.; Shata, E.; Jones, R.A.; Moorehead, R.A.; Jones, N. Distinct Requirements for Adaptor Proteins NCK1 and NCK2 in Mammary Gland Development. J. Mammary Gland. Biol. Neoplasia 2023, 28, 19. [Google Scholar] [CrossRef]
- Won, E.Y.; Xie, Y.; Takemoto, C.; Chen, L.; Liu, Z.-J.; Wang, B.-C.; Lee, D.; Woo, E.-J.; Park, S.G.; Shirouzu, M.; et al. High-resolution crystal structure of the catalytic domain of human dual-specificity phosphatase 26. Acta Crystallogr. Sect. D Struct. Biol. 2013, 69 Pt 6, 1160–1170. [Google Scholar] [CrossRef]
- Tanuma, N.; Nomura, M.; Ikeda, M.; Kasugai, I.; Tsubaki, Y.; Takagaki, K.; Kawamura, T.; Yamashita, Y.; Sato, I.; Sato, M.; et al. Protein phosphatase Dusp26 associates with KIF3 motor and promotes N-cadherin-mediated cell-cell adhesion. Oncogene 2009, 28, 752–761. [Google Scholar] [CrossRef]
- Hu, K.; Guo, Y.; Li, Y.; Zhou, S.; Lu, C.; Cai, C.; Yang, H.; Li, Y.; Wang, W. Identification and Validation of PTGS2 Gene as an Oxidative Stress-Related Biomarker for Arteriovenous Fistula Failure. Antioxidants 2023, 13, 5. [Google Scholar] [CrossRef] [PubMed] [PubMed Central]
- Selkoe, D.J. Alzheimer’s disease: Genes, proteins, and therapy. Physiol. Rev. 2001, 81, 741–766. [Google Scholar] [CrossRef]
- Goedert, M.; Spillantini, M.G. A century of Alzheimer’s disease. Science 2006, 314, 777–781. [Google Scholar] [CrossRef]
- Takashima, A. GSK-3 is essential in the pathogenesis of Alzheimer’s disease. J. Alzheimer’s Dis. 2006, 9 (Suppl. S3), 309–317. [Google Scholar] [CrossRef]
- Hohman, T.J.; Koran, M.E.; Thornton-Wells, T.A.; Alzheimer’s Neuroimaging Initiative. Interactions between GSK3β and amyloid genes explain variance in amyloid burden. Neurobiol. Aging 2014, 35, 460–465. [Google Scholar] [CrossRef] [PubMed]
- Davis, R.J. Signal transduction by the JNK group of MAP kinases. Cell 2000, 103, 239–252. [Google Scholar] [CrossRef] [PubMed]
- Liu, T.; Zhang, L.; Joo, D.; Sun, S.-C. NF-κB signaling in inflammation. Signal Transduct. Target. Ther. 2017, 2, 17023. [Google Scholar] [CrossRef] [PubMed]
- Rex, J.; Lutz, A.; Faletti, L.E.; Albrecht, U.; Thomas, M.; Bode, J.G.; Borner, C.; Sawodny, O.; Merfort, I. IL-1β and TNFα Differentially Influence NF-κB Activity and FasL-Induced Apoptosis in Primary Murine Hepatocytes During LPS-Induced Inflammation. Front. Physiol. 2019, 10, 117. [Google Scholar] [CrossRef]
- Eroglu, B.; Jin, X.; Deane, S.; Öztürk, B.; Ross, O.A.; Moskophidis, D.; Mivechi, N.F. Dusp26 phosphatase regulates mitochondrial respiration and oxidative stress and protects neuronal cell death. Cell. Mol. Life Sci. 2022, 79, 198. [Google Scholar] [CrossRef]
- Kumar, R.; Khandelwal, N.; Thachamvally, R.; Tripathi, B.N.; Barua, S.; Kashyap, S.K.; Maherchandani, S.; Kumar, N. Role of MAPK/MNK1 signaling in virus replication. Virus Res. 2018, 253, 48–61. [Google Scholar] [CrossRef]
- PrabhuDas, M.R.; Baldwin, C.L.; Bollyky, P.L.; Bowdish, D.M.E.; Drickamer, K.; Febbraio, M.; Herz, J.; Kobzik, L.; Krieger, M.; Loike, J.; et al. A Consensus Definitive Classification of Scavenger Receptors and Their Roles in Health and Disease. J. Immunol. 2017, 198, 3775–3789. [Google Scholar] [CrossRef]
- Brown, C.O.; Schibler, J.; Fitzgerald, M.P.; Singh, N.; Salem, K.; Zhan, F.; Goel, A. Scavenger receptor class A member 3 (SCARA3) in disease progression and therapy resistance in multiple myeloma. Leuk. Res. 2013, 37, 963–969. [Google Scholar] [CrossRef]
- Zub, K.A.; de Sousa, M.M.L.; Sarno, A.; Sharma, A.; Demirovic, A.; Rao, S.; Young, C.; Aas, P.A.; Ericsson, I.; Sundan, A.; et al. Modulation of cell metabolic pathways and oxidative stress signaling contribute to acquired melphalan resistance in multiple myeloma cells. PLoS ONE 2015, 10, e0119857. [Google Scholar] [CrossRef]
- Kim, J.; You, H.J.; Youn, C. SCARA3 inhibits cell proliferation and EMT through AKT signaling pathway in lung cancer. BMC Cancer 2022, 22, 552. [Google Scholar] [CrossRef]
- Guénette, S.Y.; Chen, J.; Jondro, P.D.; Tanzi, R.E. Association of a novel human FE65-like protein with the cytoplasmic domain of the beta-amyloid precursor protein. Proc. Natl. Acad. Sci. USA 1996, 93, 10832–10837. [Google Scholar] [CrossRef] [PubMed]
- McLoughlin, D.M.; Miller, C.C. The FE65 proteins and Alzheimer’s disease. J. Neurosci. Res. 2008, 86, 744–754. [Google Scholar] [CrossRef] [PubMed]
- Dontu, G.; Jackson, K.W.; McNicholas, E.; Kawamura, M.J.; Abdallah, W.M.; Wicha, M.S. Role of Notch signaling in cell-fate determination of human mammary stem/progenitor cells. Breast Cancer Res. 2004, 6, R605. [Google Scholar] [CrossRef]
- Xiong, J.; Bao, J.; Hu, W.; Shang, M.; Zhang, L. Whole-genome resequencing reveals genetic diversity and selection characteristics of dairy goat. Front. Genet. 2023, 13, 1044017. [Google Scholar] [CrossRef]
- Bagnicka, E.; Winnicka, A.; Jóźwik, A.; Rzewuska, M.; Strzałkowska, N.; Kościuczuk, E.; Prusak, B.; Kaba, J.; Horbańczuk, J.; Krzyżewski, J. Relationship between somatic cell count and bacterial pathogens in goat milk. Small Rumin. Res. 2011, 100, 72–77. [Google Scholar] [CrossRef]
- Bagnicka, E.; Hamann, H.; Distl, O. Structure and the non-genetic and genetic effects on milk traits in Polish dairy goat population. Anim. Sci. Pap. Rep. 2015, 33, 59–69. [Google Scholar]
- Patterson, K.I.; Brummer, T.; O’Brien, P.M.; Daly, R.J. Dual-specificity phosphatases: Critical regulators with diverse cellular targets. Biochem. J. 2009, 418, 475–489. [Google Scholar] [CrossRef]
- Pławińska-Czarnak, J.; Bagnicka, E.; Kaba, J.; Bogdan, J.; Zarzyńska, J. Analysis of the CAEV infection impact on the milk yield and milk SCC of polish dairy goats. J. Microbiol. Biotechnol. Food Sci. 2014, 3, 39–42. [Google Scholar]
- Hou, J.X.; Fang, F.; An, X.P.; Yan, Y.; Ma, T.; Han, P.; Meng, F.X.; Song, Y.X.; Wang, J.G.; Cao, B.Y. Polymorphisms of PRLR and FOLR1 genes and association with milk production traits in goats. Genet. Mol. Res. 2014, 13, 2555–2562. [Google Scholar] [CrossRef]
- Xuan, R.; Wang, J.; Zhao, X.; Li, Q.; Wang, Y.; Du, S.; Duan, Q.; Guo, Y.; Ji, Z.; Chao, T. Transcriptome Analysis of Goat Mammary Gland Tissue Reveals the Adaptive Strategies and Molecular Mechanisms of Lactation and Involution. Int. J. Mol. Sci. 2022, 23, 14424. [Google Scholar] [CrossRef]
- Dige, M.S.; Gurao, A.; Singh, L.P.; Chitkara, M.; Singh, M.K.; Dass, G.; Verma, A.K.; Pundir, R.K.; Kataria, R.S. Transcriptomic analysis reveals molecular insights into lactation dynamics in Jakhrana goat mammary gland. BMC Genom. 2024, 25, 874. [Google Scholar] [CrossRef] [PubMed]



| Gene Name (Gene Symbol) | Primer (5′–3′) | Product Length | NCBI Accession Number | Source |
|---|---|---|---|---|
| Capra hircus dual-specificity phosphatase 26 (putative) (DUSP26) | F: GCACCCTTTCCTCAATGTCT | 126 pb | XM_018042128.1 | This study |
| R: CGGTGGTTGTTGGCTATTTC | ||||
| Capra hircus prolactin receptor (PRL-R) | F: CTGTATCCTCCCACCAGTTC | 177 pb | XM_013972804.2 | This study |
| R: TGTTGGTCCTCACTGTCATC | ||||
| Capra hircus scavenger receptor class A, member 3 (SCARA3) | F: AAATCTCCAAGGGCTGGATCT | 234 pb | XM_018051874.1 | This study |
| R: ATCTGGTGAACGGAGAAAGAG | ||||
| Capra hircus amyloid beta (A4) precursor protein-binding, family B, member 2 (APBB2) | F: TTATGGCCGAACGGAAGAAT | 223 pb | XM_018049396.1 | This study |
| R: TCCTTGCTAGAGGAGGTCAT | ||||
| Capra hircus olfactory receptor OR4F4 | F: TTCTGTTCTTCGGACCATGT | 164 pb | XM_005685436.2 | This study |
| R:TCTCAGCCGTCTCATTGC | ||||
| Capra hircus peptidylprolyl isomerase A (cyclophilin A) (PPIA) | F: GTCCCGAAGACAGCAGAAAA | 151 pb | XM_018047035.1 | This study—reference gene |
| R: AGATGGACTTGCCACCAGTA | ||||
| Ribosomal protein large, P0 (RPLP0) | F: CAACCCTGAAGTGCTTGACAT | 227 pb | NM_001012682.1 | Reference gene [22] |
| R: AGGCAGATGGATCAGCCA | ||||
| 18S ribosomal RNA (18S rRNA) | F: CAAATTACCCACTCCCGACCC | 114 pb | DQ_066896.1 | Reference gene [22] |
| R: AATGGATCCTCGCGGAAGG |
| SRLV-SP | SRLV-SN | |||||
|---|---|---|---|---|---|---|
| Mean | SD | CV [%] | Mean | SD | CV [%] | |
| MSCs (×1000) | 557.33 | 428.35 | 77 | 501.33 | 410.20 | 82 |
| Milk yield [kg] | 2.03 | 0.12 | 6 | 2.57 | 0.55 | 21 |
| Fat [%] | 2.59 | 0.07 | 3 | 2.77 | 0.20 | 7 |
| Protein [%] | 2.59 | 0.07 | 3 | 2.75 | 0.14 | 8 |
| Casein [%] | 1.76 | 0.07 | 4 | 2.02 | 0.14 | 7 |
| Lactose [%] | 4.77 | 0.10 | 2 | 4.78 | 0.19 | 4 |
| Gene Name (Gene Symbol) | Direction of Expression Changes | |||||
|---|---|---|---|---|---|---|
| Capra Hircus Microarray | RT-qPCR | |||||
| Fold Change | Regulation | p-Value | Fold Change | Regulation | p-Value | |
| PREDICTED: Capra hircus dual-specificity phosphatase 26 (putative) (DUSP26), mRNA | −11.38339 | down | 4.610555 × 10−5 | −3.91994 | down | 0.01939 |
| PREDICTED: Capra hircus prolactin receptor (PRLR) | −5.3226624 | down | 8.543044 × 10−5 | −1.25194 | down | 0.24871 |
| PREDICTED: Capra hircus scavenger receptor class A, member 3 (SCARA3) | −3.5556233 | down | 8.145998 × 10−5 | −3.38698 | down | 0.02875 |
| PREDICTED: Capra hircus amyloid beta (A4) precursor protein-binding, family B, member 2 (APBB2) | −2.9709337 | down | 5.4867196 × 10−5 | −1.76949 | down | 0.039 |
| PREDICTED: Capra hircus olfactory receptor 4F4 (LOC102187321), mRNA | −3.3447337 | down | 5.5302753 × 10−5 | nd | nd | - |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2025 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Pławińska-Czarnak, J.; Majewska, A.; Zarzyńska, J.M.; Kaba, J.; Bagnicka, E. The Gene Expression Profile of Milk Somatic Cells of Small Ruminant Lentivirus-Seropositive and -Seronegative Dairy Goats (Capra hircus) During Their First Lactation. Viruses 2025, 17, 944. https://doi.org/10.3390/v17070944
Pławińska-Czarnak J, Majewska A, Zarzyńska JM, Kaba J, Bagnicka E. The Gene Expression Profile of Milk Somatic Cells of Small Ruminant Lentivirus-Seropositive and -Seronegative Dairy Goats (Capra hircus) During Their First Lactation. Viruses. 2025; 17(7):944. https://doi.org/10.3390/v17070944
Chicago/Turabian StylePławińska-Czarnak, Joanna, Alicja Majewska, Joanna Magdalena Zarzyńska, Jarosław Kaba, and Emilia Bagnicka. 2025. "The Gene Expression Profile of Milk Somatic Cells of Small Ruminant Lentivirus-Seropositive and -Seronegative Dairy Goats (Capra hircus) During Their First Lactation" Viruses 17, no. 7: 944. https://doi.org/10.3390/v17070944
APA StylePławińska-Czarnak, J., Majewska, A., Zarzyńska, J. M., Kaba, J., & Bagnicka, E. (2025). The Gene Expression Profile of Milk Somatic Cells of Small Ruminant Lentivirus-Seropositive and -Seronegative Dairy Goats (Capra hircus) During Their First Lactation. Viruses, 17(7), 944. https://doi.org/10.3390/v17070944

