Next Article in Journal
Seroprevalence and Epidemiological Insights into Severe Fever with Thrombocytopenia Syndrome on Jeju Island, Republic of Korea
Previous Article in Journal
Identification of B-Cell Epitopes Located on the Surface of the S1 Protein of Infectious Bronchitis Virus M41 Strains
 
 
Search for Articles:
Title / Keyword
Author / Affiliation / Email
Journal
Article Type
 
 
Advanced Search
 
Section
Special Issue
Volume
Issue
Number
Page
 
Journals
Viruses
Volume 17
Issue 4
10.3390/v17040465
viruses-logo
Submit to this Journal Review for this Journal Propose a Special Issue
► Article Menu

Article Menu

share Share announcement Help format_quote Cite question_answer Discuss in SciProfiles
first_page
settings
Order Article Reprints
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Promoter Methylation of HIV Coreceptor-Related Genes CCR5 and CXCR4: Original Research

by
Anna Esman
1,*,
Svetlana Salamaikina
1,
Alina Kirichenko
1,
Michael Vinokurov
1,
Darya Fomina
1,2,
Kirill Sikamov
1,
Arina Syrkina
1,
Anastasia Pokrovskaya
1,3 and
Vasily Akimkin
1
1
Federal Service for Surveillance on Consumer Rights Protection and Human Wellbeing, Central Research Institute of Epidemiology, 111123 Moscow, Russia
2
State Research Center—Burnazyan Federal Medical Biophysical Center of Federal Medical Biological Agency, 123098 Moscow, Russia
3
Medical Institute, Peoples’ Friendship University of Russia (RUDN University), 117198 Moscow, Russia
*
Author to whom correspondence should be addressed.
Viruses 2025, 17(4), 465; https://doi.org/10.3390/v17040465
Submission received: 29 January 2025 / Revised: 3 March 2025 / Accepted: 6 March 2025 / Published: 25 March 2025
(This article belongs to the Section Human Virology and Viral Diseases)
Browse Figures
Review Reports Versions Notes

Abstract

:
The persistence of human immunodeficiency virus (HIV) within viral reservoirs poses significant challenges to eradication efforts. Epigenetic alterations, including DNA methylation, are potential factors influencing the latency and persistence of HIV. This study details the development and application of techniques to assess CpG methylation in the promoter regions of the CCR5 and CXCR4 genes, which are key HIV-1 coreceptors. Using both Sanger sequencing and pyrosequencing methods, we examined 51 biological samples from 17 people living with HIV at three time points: baseline (week 0) and post-antiretroviral therapy (ART) at weeks 24 and 48. Our results revealed that CXCR4 promoter CpG sites were largely unmethylated, while CCR5 promoter CpGs exhibited significant variability in methylation levels. Specifically, CCR5 CpG 1 showed a significant decrease in methylation from week 0 to week 48, while CXCR4 CpG 3 displayed a significant decrease between week 0 and week 24. These differences were statistically significant when compared with non-HIV-infected controls. These findings demonstrate distinct methylation patterns between CCR5 and CXCR4 promoters in people living with HIV over time, suggesting that epigenetic modifications may play a role in regulating the persistence of HIV-1. Our techniques provide a reliable framework for assessing gene promoter methylation and could be applied in further research on the epigenetics of HIV.

1. Introduction

The lifelong persistence of human immunodeficiency virus (HIV) in people living with HIV (PLWH) is a global public health problem. Antiretroviral therapy (ART) significantly reduces mortality and the risk of transmission in PLWH through the suppression of viral replication [1,2,3,4], and HIV RNA counts are reduced in ART recipients with sustained virologic response to undetectable values (<50 copies/mL plasma). However, the provirus activates within a few weeks after the interruption of ART, leading to an increase in the viral load [5,6].
HIV-1 enters CD4+ T-cells via chemokine coreceptors and persists as a provirus. Recent data have indicated that resting CD4+ T-cells are a basic reservoir of the virus and a primary barrier to the elimination of HIV-1, even with ART [7]. Current therapies do not cure HIV infection, and the virus continues to persist in reservoirs.
The chemokine receptors CXCR4 and CCR5 serve as major coreceptors for the entry of HIV-1 into CD4+ T-cells. CD4+ T-cells can be categorized into distinct subsets, including naive, central memory, effector memory, and activated T-cells. Naive T-cells predominantly express CXCR4 [8], while memory and activated T-cells generally exhibit higher CCR5 expression, facilitating HIV replication [9].
HIV-1 primarily uses CCR5 as its coreceptor (R5-tropic HIV-1 strains), and only approximately 5% of all viral strains (X4-tropic HIV-1 strains) utilize CXCR4 as the primary coreceptor [10,11,12]. During the early stages of clinical HIV-1 infection, R5-tropic viruses are predominantly transmitted. In contrast, X4-tropic viruses are commonly detected in humans who have undergone multiple ART regimens and are in the later stages of infection, often with rapid disease progression [13,14,15,16,17].
The level of CCR5 expression on the surface of activated CD4+ T-cells [8,9,18] has been observed to be elevated in PLWH, when compared to healthy controls [17]. The high expression of the CCR5 gene significantly influences disease progression and hampers immune recovery during antiretroviral therapy [19]. Elevated CCR5 levels could activate resting T-cells, triggering apoptosis and their subsequent destruction. On the other hand, therapies targeting CCR5 expression could slow down the depletion of the CD4+ T-cell pool; however, they may not exhibit direct antiviral effects [20].
To the contrary, the reduced expression of CCR5 correlates with decreased HIV-1 concentrations within cells [21]. Moreover, the deletion of 32 base pairs in the CCR5 gene resulted in a truncated protein that is unable to function properly, thereby blocking the entry of R5-tropic HIV variants and providing resistance to approximately 50% of HIV-1 strains [22].
Epigenetic modifications, including DNA methylation and histone modification, play a crucial role in the regulation of gene expression without altering the underlying DNA sequence. These modifications influence various cellular processes, such as development, differentiation, and responses to environmental stimuli. The main forms of epigenetic inheritance include genomic imprinting, DNA methylation at CpG loci, and histone modifications [23].
DNA methylation, particularly cytosine methylation (5 mC) at CpG loci within gene promoter regions, is strongly associated with transcriptional silencing. This process is a key mechanism of epigenetic regulation and can prevent the binding of transcription factors to DNA, thus reducing the expression of genes [24,25,26,27,28,29]. Methylation near the transcription initiation site is especially impactful in regulating gene activity as it disrupts the normal functioning of regulatory elements within these regions.
In the context of HIV-1, gene methylation plays a pivotal role in regulating coreceptor expression on the cell surface. The methylation of genes that encode HIV coreceptors can reduce their expression, potentially preventing HIV-1 from entering the cell. These epigenetic changes do not involve alterations in the DNA sequence but can significantly influence cellular functions and viral susceptibility. Moreover, HIV-1 latency and reactivation may be regulated by changes in the chromatin structure near the viral promoter located at the 5′ long terminal repeat (LTR), further highlighting the importance of epigenetic regulation in the viral life cycle [30].
In this way, increased DNA methylation in cis-regulatory modules of the CCR5 gene reduces its activity. A significant correlation exists between the methylation level of the CCR5 gene and its expression on the surface of T-cells [20], with lower expression levels being associated with the demethylation of these cis-regulatory modules. Naive T-cells—which are activated via HLA receptors in response to infection—show increased CCR5 expression that directly supports T-cell activation. While hypermethylation of the gene is associated with lower viral loads and higher CD4+ T-cell counts, the cis-regulatory modules in PLWH remain demethylated when compared to those with normal CD4+ T-cell counts [31]. The demethylation of the CCR5 gene cis-modules results in increased gene expression, which raises the amount of CCR5 protein on the cell membrane, thus facilitating the entry of HIV-1 into uninfected CD4+ T-cells [32]. In this way, the human immune system inadvertently supports HIV-1 replication. However, ART—which suppresses viral replication—has been linked to an increased methylation level of the CCR5 gene [20].
Although studies on the impacts of CXCR4 gene methylation on HIV-1 replication are limited, some data suggest a strong correlation between CXCR4 expression levels and the potential for entry of HIV-1 into cells [33]. The activation of CD4+ T-cells can reduce the number of CXCR4 receptors on the cell surface, thus limiting the spread of the infection [11]. Moreover, decreased CXCR4 gene expression is associated with progression of the disease [17].
In this study, we develop methodologies and assess the impacts of cytosine methylation at CpG loci within CCR5 and CXCR4 genes promoter regions in ART-treated HIV-positive individuals compared to healthy, HIV-negative controls.

2. Materials and Methods

2.1. Study Population

Depersonalized samples from 17 antiretroviral-naïve PLWH collected during 2021–2023 and 27 non-HIV-infected individuals during 2024 at the infectious disease clinics of the Central Research Institute of Epidemiology (CRIE) were used in this study. HIV was diagnosed in accordance with country-specific measures based on the WHO guidelines, in particular, based on two positive ELISA tests confirmed via immunoblot [34,35].
Inclusion criteria were as follows: age over 18 years, viral load <500,000 copies/mL, CD4+ T-cell count >200 cells/mm3, less than 3 visits, written informed consent.
The first-line ART regimen prescribed was lamivudine/dolutegravir (3TC/DTG). Whole-blood samples from PLWH were obtained at baseline (week 0) and after ART started (weeks 24 and 48). In summary, this study included 51 samples from 17 HIV-1 PLWH collected during three visits.

2.2. Biological Samples

CD4 T-cell counts were obtained using a FACSCalibur flow cytometer (Becton Dickinson, Franklin Lakes, NJ, USA), according to the standard manufacturer’s protocols.
Whole human blood samples were examined for the presence of HIV DNA using the AmpliSens® “DNA-HIV-FL” reagent kit (Amplisens, CRIE, Moscow, Russia), which includes a plasmid calibrator with a known concentration of human β-globin gene and HIV pol gene.
Samples purified with hemolytic reagents (Amplisens, CRIE, Moscow, Russia) were used for selective lysis of blood erythrocytes during pre-processing of clinical materials of whole peripheral blood prior to DNA extraction.
DNA extraction was carried out using the “RIBO-prep” kit (Amplisens, CRIE, Moscow, Russia), according to the manufacturer’s instructions.
The concentration of the starting DNA was measured via real-time PCR for the β-globin gene using plasmid calibrators with concentrations of 10,000 and 100 copies per mL. The obtained values were then converted from “copies/µL” to “ng” using the SciencePrimer tool’s copy number calculator for real-time PCR [36] (where 1 ng DNA is equivalent to approximately 300 copies). The average concentration of starting DNA before the bisulfite conversion reaction was 9000 copies per μL (or 30 ng).
Bisulfite conversion was performed on samples using the “EpiTect Bisulfite KIT” (QIAGEN, Hilden, Germany). DNA samples were kept at —20 °C after bisulfite conversion and eluted 10× in the TE buffer (AmpliSens, CRIE, Moscow, Russia) for PCR analysis.
It is necessary to note that incomplete bisulfite conversion of DNA results in the interpretation of unconverted cytosines as being methylated in assays [37]. Large amounts of DNA (>10 μg/mL) could decrease the conversion rate by depleting the available bisulfite in the reaction mix and increasing the pH due to the formation of NH4+ as a by-product of the reaction.

2.3. CpG Loci Selection

The database of the University of California, Santa Cruz (UCSC), was used to select the CCR5 and CXCR4 promoter regions and related predicted transcription factors (JASPAR CORE) [38]. The whole CXCR4 promoter region was chosen for this study. According to the database, the CCR5 gene contains 2 promoter regions: promoter region 1 follows the first exon and produces a truncated product that is primarily expressed in naïve T-cells and in memory T-cells [39], while promoter region 2 contributes to transcription of a product with exon 1, which is typical for T-cells. We studied promoter region 2 as the results of the study conducted by Gornalusse et al. showed that hypermethylation of this DNA region correlates significantly with the CCR5 expression level [20].
Target loci were chosen by comparing promoter sequences from the EPD (Eukaryotic Promoter Database) [40], which contains experimentally confirmed regions at the beginning of transcription, including sequences from CpG islands; that is, regions where CpG is present more frequently than in other regions.
Coordinate data and CpG identifiers were obtained from the Illumina GRCh37.p13 genome assembly methylation array (GEO Access Viewer) [41] and NCBI database [42].
A typical procedure for methylation research would include a gene expression study, the identification of genes that are downregulated, and an NCBI search (National Center for Biotechnology Information) [42] to locate the promoter sequence and transcription start site of the gene. The selected genomic sequence is then used to aid in the selection of primers.
Detailed descriptions of the chosen loci and predicted transcription factors are presented in Table 1 and Table 2 in which the CpGs assessed in our study are indicated by blue color.

2.4. Primer Design

Selected CpG loci were detected using pyrosequencing and Sanger sequencing methods. Figure 1 shows the common scheme of the oligonucleotide positions.
NB! CpGs at annealing sites should be avoided in oligonucleotide design. The length of the amplicon for pyrosequencing was in the range of 100–250 bp [43].
Viruses 17 00465 g001
Figure 1. Common scheme of techniques for determining the methylation level of CpG loci (created with BioRender [44]).
Figure 1. Common scheme of techniques for determining the methylation level of CpG loci (created with BioRender [44]).
Viruses 17 00465 g001
Oligonucleotides were designed according to standard conditions. The Tm mean calculated using the OligoAnalyzer™ Tool [45] was 60 °C. The CG content was rather low due to the features of the converted DNA product, with an average of 33%. Table 3 summarizes the sequences of the oligonucleotides used in this study.

2.5. PCR Conditions

The “Tercyc” amplification system (DNA-technology, Protvino, Russia) was used for PCR sample preparation before sequencing. The amplification program was as follows: hold 95 °C for 15 min, then 45 cycles of 95 °C for 5 s, 60 °C for 20 s, and 72 °C for 5 s.
PCR reactions were carried out in a final volume of 25 μL, containing 5 μL of PCR-mix-1 (dNTPs and primers; the concentration of primers was experimentally determined as 0.7 µM), 10 µL of PCR-mix-2 (Tris-buffer and MgCl2), and 0.5 µL of TaqF polymerase. All used reagents and kits were developed in the Central Research Institute of Epidemiology, Federal Service for Surveillance on Consumer Rights Protection and Human Wellbeing Russian Federation (AmpliSens, Moscow, Russia). Finally, 10 μL of bisulfite-treated DNA sample was added to the prepared tubes.
Completely methylated DNA and fully unmethylated DNA (as negative control) were used as controls for amplification [46,47] (QIAGEN, Hilden, Germany).

2.6. Pyrosequencing Conditions

Sample preparation was carried out using the PyroMark Q24 vacuum station (QIAGEN, Hilden, Germany) and a “Amplisens® Pyroscreen” sample preparation kit (Amplisens, CRIE, Moscow, Russia), according to the manufacturers’ recommendations.
The reaction was performed with 5 μL of the PCR products. Incubation with the sequencing primer was carried out at 80 °C for 2 min (at a concentration of 7.5 pmol/µL).
Pyrosequencing was performed using the “PyroMark Gold Q24 Reagents kit” (Qiagen, Hilden, Germany).
Methylation levels of CpGs via pyrosequencing were calculated automatically using the PyroMark Q24 software (Qiagen, Hilden, Germany). Quantitative bisulfite pyrosequencing determines DNA methylation levels through analyzing artificial “C/T” SNPs at CpG sites within a specific pyrosequencing assay [43].

2.7. Sanger Sequencing Conditions

The amplification system “T100” (BioRad Laboratories, Hercules, CA, USA) was used for PCR sample preparation with the following steps: 96 °C for 1 min, followed by 25 cycles of 96 °C for 10 s, 50 °C for 5 s, 60 °C for 4 min. Sanger sequencing was performed using the “AmpliSense® HIV-Resist-Seq” reagent kit (Amplisens®, CRIE, Moscow, Russia) and an Applied Biosystems 3500 genetic analyzer (LifeTechnologies, Waltham, MA, USA).

2.8. Tropism Assay

The AmpliSens® “HIV-Resist-Seq” reagent kit (AmpliSens, Moscow, Russia) was used for DNA extraction from whole-blood samples, as well as for amplification and sequencing of the third variable region (V3) of the HIV-1 envelope protein gp120 (6960–7370 bp according to the HXB-2 strain; GenBank accession number K03455).
Viral tropism was determined using the algorithm of the Geno2pheno genotypic tool [48], with 20% false positive rate (FPR).

2.9. Statistical Methods

Methylation analysis of CpGs via Sanger sequencing was performed according to the protocol of Parrish et al. [49]. Methylation level data for each CpG locus were preliminarily processed in Microsoft Excel [50]. All statistical tests were run using R 4.2.2 [51,52]. Descriptive statistical analysis, two-way ANOVA with Dunnett test (for comparison of gene methylation levels between control non-HIV-infected individuals and PLWH at baseline/week 0, week 24, and week 48), and Mann–Whitney U-test (for comparison of CpGs methylation level in PLWH at baseline/week 0, week 24, and week 48 with each other) were employed for evaluation of the data. The results were considered statistically significant at p < 0.01. Data visualization was performed using the graph application provided at BioRender.com [44].

3. Results

3.1. Sample Description

First, we analyzed the viral load, viral reservoir size, and CD4+ T-cell counts in samples collected from PLWH at baseline (week 0) and after ART (weeks 24 and 48).
Viral load at the first visit for PLWH varied from 1371 to 208,538 copies/mL, with a median of 38,181 copies/mL. All PLWH presented viral suppression (HIV plasma RNA < 50 copies/mL) at weeks 24 and 48. There were no treatment-related adverse effects requiring regimen changes, and there was no clinical progression of infection in the sense of HIV-associated diseases. All PLWH reached the virological efficacy of ART by week 24 of treatment and remained at week 48.
HIV-1 viral reservoir volume decreased systematically over the course; however, there was no statistically significant reduction.
Normally, CD4+ T-cell counts in non-HIV-infected individuals range from 500 to 1500 cells per mm3. There was a positive trend of CD4+ T-cell counts (Figure 2).
Information about viral load, size of the viral reservoir (measured in copies of HIV DNA per million cells), and CD4+ T-cell count (cells/mm3) for all PLWH has been collected in [50].

3.2. Development of CpG Locus Methylation Techniques

Pyrosequencing and Sanger sequencing methods were used to assess CpG locus methylation in promoter regions of the CCR5 and CXCR4 genes. Pyrosequencing is undoubtedly more accurate in measuring the C/(C + T) ratio of peak heights, and this method is considered the “gold standard” for quantitative allele quantification at single base resolution [53].
Figure 3 presents an example of the CXCR4 gene promoter sequence. The pyrogram obtained from the PyroMarkQ24 (Qiagen, Hilden, Germany) is shown in the upper part of the figure, the same region obtained via Sanger sequencing is in the middle, and the expected sequence is shown in the lower part of the figure. Lines link the related CpG loci on the pyrogram and chromatogram.
Considering the CpG locations in the CCR5 gene’s second promoter region, several combinations of oligonucleotides were used to read 100–250 bp amplicon length sites via pyrosequencing. These combinations are presented in Section 2.4 (Methodology Design/Primers Design).
Fully methylated control reactions containing bisulfite-treated DNA (QIAGEN, Hilden, Germany) were on average 88% and 93.5%, while fully unmethylated control reactions with bisulfite-treated DNA (QIAGEN, Hilden, Germany) were on average of 1% and 4.8% in assays for CCR5 and CXCR4, respectively. Comparison of the results obtained using the pyrosequencing and Sanger sequencing methods indicated no statistically significant differences.

3.3. Application Results of the Developed Techniques

The results obtained using the developed pyrosequencing and Sanger sequencing techniques did not reveal any significant differences. Therefore, for the purposes of this study, we chose to use data generated only using the Sanger method.
The mean methylation levels of the CCR5 and CXCR4 promoters in PLWH at baseline (week 0), week 24, and week 48 differed with respect to those of non-HIV-infected individuals in a statistically significant manner (p < 0.0001; Figure 4). We also observed that methylation levels of CXCR4 promoter regions were significantly lower than those for CCR5.
Next, we analyzed all CpGs in the CCR5 gene separately in PLWH at baseline (week 0), week 24, and week 48. The CpG 1 methylation level of the CCR5 promoter ranged from 33% to 99%, that for CpG 2 from 4% to 83%, that for CpG 3 from 0 to 42%, and that for CpG 4 from 1% to 21%. Analysis of the methylation of CpGs in the promoters of CCR5 revealed statistically significant differences in methylation levels between PLWH at different follow-up stages, specifically between the week 0 and week 48 groups, at CpG 1 (p = 0.0015; Figure 5).
Analysis of the CXCR4 promoter region indicated that the CpG 1 methylation level ranged from 0% to 17%, that for CpG 2 from 0% to 21%, that for CpG 3 from 0% to 21%, that for CpG 4 from 0% to 25%, that for CpG 5 from 1% to 17%, that for CpG 6 from 1% to 16%, that for CpG 7 from 0% to 11%, and that for CpG 8 from 0% to 15%. Statistical differences were observed in CpG3 between baseline (week 0) and week 24 (p = 0.002; Figure 5).
Based on these results, we compared the methylation levels of CCR5 (CpG 1) and CXCR4 (CpG 3) CpGs between baseline (week 0) and week 48, as well as between week 0 and week 24, according to the statistical differences with respect to non-HIV-infected individuals. Statistical differences were observed for the following groups via two-way ANOVA with Bonferroni multiple comparisons test (Table 4).
We compared the methylation levels in promoter regions of the CCR5 and CXCR4 genes in our group of patients split by tropism type. A regular two-way ANOVA was performed. There was a significant difference in methylation level of the CXCR4 promoter region between patients with CXCR4 tropism type at week 24 and patients with CCR5 tropism type at week 0 (Figure 6).

4. Discussion

Genome DNA methylation is not uniformly distributed: both promoter and CpG islands are typically hypomethylated, whereas the extent of methylation in gene bodies is higher than that in intergenic regions. While early studies suggested that DNA methylation represses gene expression, a growing body of evidence has indicated that DNA methylation plays a dual role—both inhibitory and permissive—depending on the genomic region in which DNA methylation occurs [54].
The association between viral replication and CXCR4 and CCR5 expression levels suggests a possible direct effect of methylation of these genes on the progression of HIV-1 within human immune cells [17]. The activities of the CCR5 and CXCR4 receptor genes largely regulate the entry of HIV-1 into cells. The gene methylation of the promoter regions decreases the concentration of unintegrated HIV-1 in cells and could contribute to viral eradication [19], and the hypermethylation of CCR5 and CXCR4 promoters can reduce both the concentration of HIV-1 RNA inside cells and the risk of infecting resting CD4+ T-cells.
Methylation levels can be analyzed using various methods, such as pyrosequencing, which uses bisulfite-treated DNA. However, the Sanger method is more convenient when the required multiple targets are located more than 60–70 nucleotides apart as a well-read fragment for pyrosequencing is usually limited to about 50 nucleotides. We presented combinations of primers for pyrosequencing and Sanger sequencing methods in this study. In the case of Sanger sequencing, it will be sufficient to use either one or two pairs of primers to suppress the “noise” that arises during result generation.
We also compared these methods on designed primers for the detection of methylation levels in CCR5 and CXCR4 promoter regions. The results indicated no differences between the used methods for detection of CpG methylation. While some research groups prefer pyrosequencing as the optimal method, Sanger sequencing also yields satisfactory results [55].
In this study, we noticed differences in the methylation level between the observed CpGs in the CCR5 promoter region and hypomethylation of the CXCR4 promoter region. These findings indicate an interesting area for further research. When DNA methylation affects the promoter region, the transcription of the gene is usually suppressed, whereas actively expressed genes tend to have unmethylated promoters. In our data, we found that specific CpGs were more accessible to transcription factors, as identified via JASPAR CORE data [42], where these loci correspond to binding motifs for the transcription factors listed in Table 1 and Table 2. This suggests that differential methylation at these loci may influence gene expression through modulating the recruitment of these specific transcription factors.
For example, transcription factors predicted to bind in the CCR5 promoter region—such as REL, a member of the NF-κB/Rel family—play a critical role in the maintenance of HIV-1 latency, suggesting that methylation of these binding sites could influence the ability of HIV-1 to persist in a latent state [56]. Similarly, FOXD3 acts as a negative regulator of HIV-1 replication in mononuclear phagocytes through suppressing genes involved in viral replication, such as OTK18. The upregulation of FOXD3 during HIV infection could explain the restricted replication of the virus in certain immune cells like microglia [57].
Furthermore, Tfcp2l1 is a member of the Grainyhead-like transcription factor family, which regulates both cell cycle progression and the expression of HIV-1 genes [58]. Its binding motifs in the promoter regions of CXCR4 could play a role in controlling the expression of these coreceptors, thus impacting the entry of HIV-1 into host cells. Additionally, Nrf1 plays a crucial role in regulating CXCR4 promoter activity, and its involvement could lead to enhanced CXCR4 expression during immune activation, potentially contributing to increased HIV-1 replication and disease progression [59].
Although we observed some statistically significant differences in methylation levels between PLWH and non-HIV-infected controls, these results could be due to random variations, considering the small sample size in our study and other factors that may influence methylation levels, such as age, the status of other genes, and so on. Although we observed differences in methylation levels between the CCR5 and CXCR4 promoter regions, we could not clearly conclude whether these results are associated with a protective effect. We can only hypothesize that the activity of the CCR5 gene was reduced in the analyzed samples.
For confirmation of the obtained results, further investigation of the expression levels of these genes is necessary.
Epigenetic modification research focused on the chemokine receptor group could reveal the connections between HIV tropism and the methylation levels of CpGs in promoters, which could further uncover new pathways for the elimination of HIV. The eradication of HIV-1 in PLWH will be impossible without solving the problem of the persistence of the virus in its reservoirs.
Studying the differences in DNA methylation patterns between non-HIV-infected individuals and PLWH, as well as replicating the study’s findings and discovering new host gene methylation targets associated with HIV tropism and the response of the immune system to HIV infection, will not only allow for the development of new therapeutic approaches to determine effective ART tactics in naive patients but also the expansion of the fundamental understanding regarding the mechanisms underlying the host’s regulation of HIV infection.

Author Contributions

Conceptualization, A.E., M.V., S.S. and D.F.; methodology, A.E. and M.V.; validation, S.S., D.F. and A.S.; resources, A.K. and A.P.; writing—original draft preparation, A.E., S.S., M.V., D.F., A.K. and K.S.; writing—review and editing, A.E. and S.S.; visualization, S.S. and A.E.; supervision, V.A.; project administration, A.E.; funding acquisition, A.E. All authors have read and agreed to the published version of the manuscript.

Funding

This research was funded by Central Research Institute of Epidemiology, grant number 122053000056-2.

Institutional Review Board Statement

This study was conducted in accordance with the Declaration of Helsinki and was approved by the Ethics Committee of the CRIE, Federal Service for Surveillance on Consumer Rights Protection and Human Wellbeing, Russian Federation (protocol code No 117, 28 September 2021).

Informed Consent Statement

Informed consent was obtained from all subjects involved in this study.

Data Availability Statement

The original data presented in the study are openly available in FigShare at https://figshare.com/s/2fce38ebe705a8501770 (accessed on 1 March 2025).

Acknowledgments

The authors are grateful to K. Mironov, the Head of the Laboratory of Molecular Methods for Genetic Polymorphisms Research, Central Research Institute of Epidemiology (CRIE), D. Kireev, the Head of the Laboratory of Diagnostics and Molecular Epidemiology of HIV Infection (the above Institute) and the senior researcher of the said Laboratory I. Lapovok for consultations and support with reagents.

Conflicts of Interest

The authors declare no conflicts of interest.

Abbreviations

The following abbreviations are used in this manuscript:
HIVHuman immunodeficiency virus
ARTAntiretroviral therapy
CRIECentral Research Institute of Epidemiology
DNADeoxyribonucleic acid
PCRPolymerase chain reaction
ELISAEnzyme-Linked Immunosorbent Assay
UCSCUniversity of California, Santa Cruz
EPDEukaryotic Promoter Database
NCBINational Center for Biotechnology Information
ANOVAAnalysis of variance

References

  1. Cohen, M.S.; Chen, Y.Q.; McCauley, M.; Gamble, T.; Hosseinipour, M.C.; Kumarasamy, N.; Hakim, J.G.; Kumwenda, J.; Grinsztejn, B.; Pilotto, J.H.S.; et al. Prevention of HIV-1 Infection with Early Antiretroviral Therapy. N. Engl. J. Med. 2011, 365, 493–505. [Google Scholar] [CrossRef] [PubMed]
  2. Rodger, A.J.; Cambiano, V.; Bruun, T.; Vernazza, P.; Collins, S.; Degen, O.; Corbelli, G.M.; Estrada, V.; Geretti, A.M.; Beloukas, A.; et al. Risk of HIV Transmission through Condomless Sex in Serodifferent Gay Couples with the HIV-Positive Partner Taking Suppressive Antiretroviral Therapy (PARTNER): Final Results of a Multicentre, Prospective, Observational Study. Lancet 2019, 393, 2428–2438. [Google Scholar] [CrossRef] [PubMed]
  3. Lima, V.D.; Lourenço, L.; Yip, B.; Hogg, R.S.; Phillips, P.; Montaner, J.S.G. AIDS Incidence and AIDS-Related Mortality in British Columbia, Canada, between 1981 and 2013: A Retrospective Study. Lancet HIV 2015, 2, e92–e97. [Google Scholar] [CrossRef] [PubMed]
  4. Bradley, H.; Mattson, C.L.; Beer, L.; Huang, P.; Shouse, R.L. Increased Antiretroviral Therapy Prescription and HIV Viral Suppression among Persons Receiving Clinical Care for HIV Infection. Aids 2016, 30, 2117–2124. [Google Scholar] [CrossRef]
  5. Davey, R.T.; Bhat, N.; Yoder, C.; Chun, T.-W.; Metcalf, J.A.; Dewar, R.; Natarajan, V.; Lempicki, R.A.; Adelsberger, J.W.; Miller, K.D.; et al. HIV-1 and T Cell Dynamics after Interruption of Highly Active Antiretroviral Therapy (HAART) in Patients with a History of Sustained Viral Suppression. Proc. Natl. Acad. Sci. USA 1999, 96, 15109–15114. [Google Scholar] [CrossRef]
  6. Pan, X.; Baldauf, H.-M.; Keppler, O.T.; Fackler, O.T. Restrictions to HIV-1 Replication in Resting CD4+ T Lymphocytes. Cell Res. 2013, 23, 876–885. [Google Scholar] [CrossRef]
  7. Siliciano, J.D.; Siliciano, R.F. Recent Developments in the Search for a Cure for HIV-1 Infection: Targeting the Latent Reservoir for HIV-1. J. Allergy Clin. Immunol. 2014, 134, 12–19. [Google Scholar] [CrossRef]
  8. Bleul, C.C.; Wu, L.; Hoxie, J.A.; Springer, T.A.; Mackay, C.R. The HIV Coreceptors CXCR4 and CCR5 Are Differentially Expressed and Regulated on Human T Lymphocytes. Proc. Natl. Acad. Sci. USA 1997, 94, 1925–1930. [Google Scholar] [CrossRef]
  9. Dai, J.; Agosto, L.M.; Baytop, C.; Yu, J.J.; Pace, M.J.; Liszewski, M.K.; O’Doherty, U. Human Immunodeficiency Virus Integrates Directly into Naïve Resting CD4 + T Cells but Enters Naïve Cells Less Efficiently than Memory Cells. J. Virol. 2009, 83, 4528–4537. [Google Scholar] [CrossRef]
  10. Vicenzi, E.; Liò, P.; Poli, G. The Puzzling Role of CXCR4 in Human Immunodeficiency Virus Infection. Theranostics 2013, 3, 18–25. [Google Scholar] [CrossRef]
  11. Bermejo, M.; Martín-Serrano, J.; Oberlin, E.; Pedraza, M.-A.; Serrano, A.; Santiago, B.; Caruz, A.; Loetscher, P.; Baggiolini, M.; Arenzana-Seisdedos, F.; et al. Activation of Blood T Lymphocytes Down-Regulates CXCR4 Expression and Interferes with Propagation of X4 HIV Strains. Eur. J. Immunol. 1998, 28, 3192–3204. [Google Scholar] [CrossRef]
  12. Grande, F.; Occhiuzzi, M.; Rizzuti, B.; Ioele, G.; De Luca, M.; Tucci, P.; Svicher, V.; Aquaro, S.; Garofalo, A. CCR5/CXCR4 Dual Antagonism for the Improvement of HIV Infection Therapy. Molecules 2019, 24, 550. [Google Scholar] [CrossRef]
  13. Schweighardt, B.; Roy, A.-M.; Meiklejohn, D.A.; Grace, E.J.; Moretto, W.J.; Heymann, J.J.; Nixon, D.F. R5 Human Immunodeficiency Virus Type 1 (HIV-1) Replicates More Efficiently in Primary CD4+ T-Cell Cultures Than X4 HIV-1. J. Virol. 2004, 78, 9164–9173. [Google Scholar] [CrossRef] [PubMed]
  14. Hunt, J.S.; Romanelli, F. Maraviroc, a CCR5 Coreceptor Antagonist That Blocks Entry of Human Immunodeficiency Virus Type 1. Pharmacotherapy 2009, 29, 295–304. [Google Scholar] [CrossRef]
  15. Archer, J.; Braverman, M.S.; Taillon, B.E.; Desany, B.; James, I.; Harrigan, P.R.; Lewis, M.; Robertson, D.L. Detection of Low-Frequency Pretherapy Chemokine (CXC Motif) Receptor 4 (CXCR4)-Using HIV-1 with Ultra-Deep Pyrosequencing. AIDS 2009, 23, 1209–1218. [Google Scholar] [CrossRef]
  16. Brumme, Z.L.; Goodrich, J.; Mayer, H.B.; Brumme, C.J.; Henrick, B.M.; Wynhoven, B.; Asselin, J.J.; Cheung, P.K.; Hogg, R.S.; Montaner, J.S.G.; et al. Molecular and Clinical Epidemiology of CXCR4-Using HIV-1 in a Large Population of Antiretroviral-Naive Individuals. J. Infect. Dis. 2005, 192, 466–474. [Google Scholar] [CrossRef]
  17. Ostrowski, M.A.; Justement, S.J.; Catanzaro, A.; Hallahan, C.A.; Ehler, L.A.; Mizell, S.B.; Kumar, P.N.; Mican, J.A.; Chun, T.W.; Fauci, A.S. Expression of Chemokine Receptors CXCR4 and CCR5 in HIV-1-Infected and Uninfected Individuals. J. Immunol. 1998, 161, 3195–3201. [Google Scholar] [CrossRef]
  18. Nazari, R.; Joshi, S. CCR5 as Target for HIV-1 Gene Therapy. Curr. Gene Ther. 2008, 8, 264–272. [Google Scholar] [CrossRef]
  19. Catano, G.; Chykarenko, Z.A.; Mangano, A.; Anaya, J.-M.; He, W.; Smith, A.; Bologna, R.; Sen, L.; Clark, R.A.; Lloyd, A.; et al. Concordance of CCR5 Genotypes That Influence Cell-Mediated Immunity and HIV-1 Disease Progression Rates. J. Infect. Dis. 2011, 203, 263–272. [Google Scholar] [CrossRef]
  20. Gornalusse, G.G.; Mummidi, S.; Gaitan, A.A.; Jimenez, F.; Ramsuran, V.; Picton, A.; Rogers, K.; Manoharan, M.S.; Avadhanam, N.; Murthy, K.K.; et al. Epigenetic Mechanisms, T-Cell Activation, and CCR5 Genetics Interact to Regulate T-Cell Expression of CCR5, the Major HIV-1 Coreceptor. Proc. Natl. Acad. Sci. USA 2015, 112, E4762–E4771. [Google Scholar] [CrossRef]
  21. Zhao, W.; Pahar, B.; Borda, J.T.; Alvarez, X.; Sestak, K. A Decline in CCL3-5 Chemokine Gene Expression during Primary Simian-Human Immunodeficiency Virus Infection. PLoS ONE 2007, 2, e726. [Google Scholar] [CrossRef] [PubMed]
  22. Ni, J.; Wang, D.; Wang, S. The CCR5-Delta32 Genetic Polymorphism and HIV-1 Infection Susceptibility: A Meta-Analysis. Open Med. 2018, 13, 467–474. [Google Scholar] [CrossRef] [PubMed]
  23. Lacal, I.; Ventura, R. Epigenetic Inheritance: Concepts, Mechanisms and Perspectives. Front. Mol. Neurosci. 2018, 11, 292. [Google Scholar] [CrossRef] [PubMed]
  24. Tseng, C.-C.; Wong, M.-C.; Liao, W.-T.; Chen, C.-J.; Lee, S.-C.; Yen, J.-H.; Chang, S.-J. Genetic Variants in Transcription Factor Binding Sites in Humans: Triggered by Natural Selection and Triggers of Diseases. Int. J. Mol. Sci. 2021, 22, 4187. [Google Scholar] [CrossRef]
  25. Jones, P.A.; Takai, D. The Role of DNA Methylation in Mammalian Epigenetics. Science 2001, 293, 1068–1070. [Google Scholar] [CrossRef]
  26. Issa, J.-P.J. Methylation and Prognosis: Of Molecular Clocks and Hypermethylator Phenotypes. Clin. Cancer Res. 2003, 9, 2879–2881. [Google Scholar]
  27. Novik, K.L.; Nimmrich, I.; Genc, B.; Maier, S.; Piepenbrock, C.; Olek, A.; Beck, S. Epigenomics: Genome-Wide Study of Methylation Phenomena. Curr. Issues Mol. Biol. 2002, 4, 111–128. [Google Scholar] [CrossRef]
  28. Garinis, G.A.; Patrinos, G.P.; Spanakis, N.E.; Menounos, P.G. DNA Hypermethylation: When Tumour Suppressor Genes Go Silent. Hum. Genet. 2002, 111, 115–127. [Google Scholar] [CrossRef]
  29. Zou, H.-Z.; Yu, B.-M.; Wang, Z.-W.; Sun, J.-Y.; Cang, H.; Gao, F.; Li, D.H.; Zhao, R.; Feng, G.-G.; Yi, J. Detection of Aberrant P16 Methylation in the Serum of Colorectal Cancer Patients. Clin. Cancer Res. 2002, 8, 188–191. [Google Scholar]
  30. Blazkova, J.; Trejbalova, K.; Gondois-Rey, F.; Halfon, P.; Philibert, P.; Guiguen, A.; Verdin, E.; Olive, D.; Van Lint, C.; Hejnar, J.; et al. CpG Methylation Controls Reactivation of HIV from Latency. PLoS Pathog. 2009, 5, e1000554. [Google Scholar] [CrossRef]
  31. Corbeau, P.; Reynes, J. CCR5 Antagonism in HIV Infection: Ways, Effects, and Side Effects. Aids 2009, 23, 1931–1943. [Google Scholar] [CrossRef] [PubMed]
  32. Claireaux, M.; Robinot, R.; Kervevan, J.; Patgaonkar, M.; Staropoli, I.; Brelot, A.; Nouël, A.; Gellenoncourt, S.; Tang, X.; Héry, M.; et al. Low CCR5 Expression Protects HIV-Specific CD4+ T Cells of Elite Controllers from Viral Entry. Nat. Commun. 2022, 13, 521. [Google Scholar] [CrossRef] [PubMed]
  33. Lan, X.; Cheng, K.; Chandel, N.; Lederman, R.; Jhaveri, A.; Husain, M.; Malhotra, A.; Singhal, P.C. High Glucose Enhances HIV Entry into T Cells through Upregulation of CXCR4. J. Leukoc. Biol. 2013, 94, 769–777. [Google Scholar] [CrossRef] [PubMed]
  34. WHO. WHO Guidelines Approved by the Guidelines Review Committee//Global Recommendations on Physical Activity for Health; WHO: Geneva, Switzerland, 2010. [Google Scholar]
  35. Consolidated Guidelines on HIV Testing Services for a Changing Epidemic. Available online: https://www.who.int/publications/i/item/who-cds-hiv-19.31 (accessed on 1 March 2025).
  36. Copy Number Calculator for Realtime PCR|Science Primer. Available online: http://scienceprimer.com/copy-number-calculator-for-realtime-pcr (accessed on 1 February 2024).
  37. Rother, K.I.; Silke, J.; Georgiev, O.; Schaffner, W.; Matsuo, K. Influence of DNA Sequence and Methylation Status on Bisulfite Conversion of Cytosine Residues. Anal. Biochem. 1995, 231, 263–265. [Google Scholar] [CrossRef]
  38. University of California Santa Cruz (UCSC). Available online: http://genome.ucsc.edu/ (accessed on 1 March 2025).
  39. Mummidi, S.; Adams, L.M.; VanCompernolle, S.E.; Kalkonde, M.; Camargo, J.F.; Kulkarni, H.; Bellinger, A.S.; Bonello, G.; Tagoh, H.; Ahuja, S.S.; et al. Production of Specific mRNA Transcripts, Usage of an Alternate Promoter, and Octamer-Binding Transcription Factors Influence the Surface Expression Levels of the HIV Coreceptor CCR5 on Primary T Cells. J. Immunol. 2007, 178, 5668–5681. [Google Scholar] [CrossRef]
  40. The Eukaryotic Promoter Database. Available online: https://epd.expasy.org/epd/ (accessed on 4 October 2024).
  41. GEO Accession Viewer. Available online: https://www.ncbi.nlm.nih.gov/geo/query/acc.cgi?acc=GPL13534 (accessed on 1 February 2024).
  42. National Center for Biotechnology Information. Available online: https://www.ncbi.nlm.nih.gov/ (accessed on 1 February 2024).
  43. Hattori, N.; Liu, Y.-Y.; Ushijima, T. DNA Methylation Analysis. In Inflammation and Cancer; Jenkins, B.J., Ed.; Springer: New York, NY, USA, 2023; Volume 2691, pp. 165–183. ISBN 978-1-07-163330-4. [Google Scholar]
  44. Scientific Image and Illustration Software|BioRender. Available online: https://www.biorender.com/ (accessed on 3 February 2024).
  45. OligoAnalyzer Tool—Primer Analysis and Tm Calculator|IDT. Available online: https://www.idtdna.com/pages/tools/oligoanalyzer (accessed on 1 February 2024).
  46. Kristensen, L.S.; Mikeska, T.; Krypuy, M.; Dobrovic, A. Sensitive Melting Analysis after Real Time-Methylation Specific PCR (SMART-MSP): High-Throughput and Probe-Free Quantitative DNA Methylation Detection. Nucleic Acids Res. 2008, 36, e42. [Google Scholar] [CrossRef]
  47. Rand, K.; Qu, W.; Ho, T.; Clark, S.J.; Molloy, P. Conversion-Specific Detection of DNA Methylation Using Real-Time Polymerase Chain Reaction (ConLight-MSP) to Avoid False Positives. Methods 2002, 27, 114–120. [Google Scholar] [CrossRef]
  48. Geno2pheno Coreceptor. Available online: https://coreceptor.geno2pheno.org/ (accessed on 1 March 2025).
  49. Parrish, R.R.; Day, J.J.; Lubin, F.D. Direct Bisulfite Sequencing for Examination of DNA Methylation with Gene and Nucleotide Resolution from Brain Tissues. Curr. Protoc. Neurosci. 2012, 60, 7–24. [Google Scholar] [CrossRef]
  50. Esman, A.; Salamaikina, S.; Vinokurov, M.; Saleeva, D.; Kirichenko, A.; Sikamov, K.; Syrkina, A.; Pokrovskaya, A.; Akimkin, V.G. DTG 3TC HIV EPI study.xlsx. figshare. Dataset. Available online: https://figshare.com/articles/dataset/DTG_3TC_HIV_EPI_study_xlsx/25239601/1?file=49645956 (accessed on 1 March 2025).
  51. R: The R Project for Statistical Computing. Available online: https://www.r-project.org/ (accessed on 6 February 2024).
  52. Wickham, H. Ggplot2 Elegant Graphics for Data Analysis; Use R!; Springer International Publishing: Cham, Switzerland, 2016; ISBN 978-3-319-24275-0. [Google Scholar]
  53. Poulin, M.; Zhou, J.Y.; Yan, L.; Shioda, T. Pyrosequencing Methylation Analysis. In Cancer Epigenetics for Precision Medicine; Dumitrescu, R.G., Verma, M., Eds.; Springer: New York, NY, USA, 2018; Volume 1856, pp. 283–296. ISBN 978-1-4939-8750-4. [Google Scholar]
  54. Jones, P.A. Functions of DNA Methylation: Islands, Start Sites, Gene Bodies and Beyond. Nat. Rev. Genet. 2012, 13, 484–492. [Google Scholar] [CrossRef]
  55. Reed, K.; Poulin, M.L.; Yan, L.; Parissenti, A.M. Comparison of Bisulfite Sequencing PCR with Pyrosequencing for Measuring Differences in DNA Methylation. Anal. Biochem. 2010, 397, 96–106. [Google Scholar] [CrossRef]
  56. Dalecki, A.G.; Greer, B.D.; Duverger, A.; Strange, E.L.; Carlin, E.; Wagner, F.; Shi, B.; Lowman, K.E.; Perez, M.; Tidwell, C.; et al. Host T Cell Dedifferentiation Effects Drive HIV-1 Latency Stability. J. Virol. 2022, 96, e01974-21. [Google Scholar] [CrossRef] [PubMed]
  57. Buescher, J.L.; Martinez, L.B.; Sato, S.; Okuyama, S.; Ikezu, T. YY1 and FoxD3 Regulate Antiretroviral Zinc Finger Protein OTK18 Promoter Activation Induced by HIV-1 Infection. J. Neuroimmune Pharmacol. 2009, 4, 103–115. [Google Scholar] [CrossRef] [PubMed]
  58. Taracha, A.; Kotarba, G.; Wilanowski, T. Neglected Functions of TFCP2/TFCP2L1/UBP1 Transcription Factors May Offer Valuable Insights into Their Mechanisms of Action. Int. J. Mol. Sci. 2018, 19, 2852. [Google Scholar] [CrossRef] [PubMed]
  59. Moriuchi, M.; Moriuchi, H.; Turner, W.; Fauci, A.S. Cloning and Analysis of the Promoter Region of CXCR4, a Coreceptor for HIV-1 Entry. J. Immunol. 1997, 159, 4322–4329. [Google Scholar] [CrossRef] [PubMed]
Viruses 17 00465 g002
Figure 2. (a) CD4+ T-cell counts per mm3 and (b) HIV-1 viral reservoir size in samples collected from PLWH at baseline (week 0) and after ART (weeks 24 and 48). Created in BioRender.com [44].
Figure 2. (a) CD4+ T-cell counts per mm3 and (b) HIV-1 viral reservoir size in samples collected from PLWH at baseline (week 0) and after ART (weeks 24 and 48). Created in BioRender.com [44].
Viruses 17 00465 g002
Viruses 17 00465 g003
Figure 3. An example CXCR4 promoter region sequence.
Figure 3. An example CXCR4 promoter region sequence.
Viruses 17 00465 g003
Viruses 17 00465 g004
Figure 4. The average methylation level in CCR5 and CXCR4 promoter regions in samples collected from PLWH, assessed at baseline (week 0), week 24, and week 48, compared to non-HIV-infected individuals. Created in BioRender.com [44].
Figure 4. The average methylation level in CCR5 and CXCR4 promoter regions in samples collected from PLWH, assessed at baseline (week 0), week 24, and week 48, compared to non-HIV-infected individuals. Created in BioRender.com [44].
Viruses 17 00465 g004
Viruses 17 00465 g005
Figure 5. Methylation percentage for each separate CpG locus in (a) CCR5 and (b) CXCR4 promoter regions compared between the groups of this study: samples collected from non-HIV-infected individuals and PLWH, assessed at baseline (week 0), week 24, and week 48. * Methylation level comparison between PLWH at baseline (week 0) and week 48. ** Methylation level comparison between PLWH at baseline (week 0) and week 24. Created in BioRender.com [44].
Figure 5. Methylation percentage for each separate CpG locus in (a) CCR5 and (b) CXCR4 promoter regions compared between the groups of this study: samples collected from non-HIV-infected individuals and PLWH, assessed at baseline (week 0), week 24, and week 48. * Methylation level comparison between PLWH at baseline (week 0) and week 48. ** Methylation level comparison between PLWH at baseline (week 0) and week 24. Created in BioRender.com [44].
Viruses 17 00465 g005
Viruses 17 00465 g006
Figure 6. The average methylation level in (a) CCR5 and (b) CXCR4 promoter regions in samples collected from PLWH, assessed at baseline (week 0), week 24, and week 48, split by tropism type (HIV sequence analysis). Created in BioRender.com [44]. ** p < 0.01.
Figure 6. The average methylation level in (a) CCR5 and (b) CXCR4 promoter regions in samples collected from PLWH, assessed at baseline (week 0), week 24, and week 48, split by tropism type (HIV sequence analysis). Created in BioRender.com [44]. ** p < 0.01.
Viruses 17 00465 g006
Table 1. CpG coordinates and predicted transcription factors located in the CCR5 gene.
Table 1. CpG coordinates and predicted transcription factors located in the CCR5 gene.
CCR5 (GRCh37.p13) Chr 3—NC_000003.12
cg22984586 *CpG 1CpG 2CpG 3CpG 4cg07616471 *
464115414641224846412333464124544641247846413711
JASPAR CORE-predicted transcription factors
REL, FOXD3, FOXF2 – – ZNF784
* CpG identifiers according to the GEO Access Viewer.
Table 2. CpG coordinates and predicted transcription factors located in the CXCR4 gene.
Table 2. CpG coordinates and predicted transcription factors located in the CXCR4 gene.
CXCR4 (GRCh37.p13) Chr 2—NC_000002.12
cg25982140 *CpG 1CpG 2CpG 3CpG 4CpG 5CpG 6CpG 7CpG 8cg12311057 *
136875681136875732136875734136875738136875756136875761136875765136875767136875770136875897
JASPAR CORE-predicted transcription factors
ERF::NHLH1, Tfcp2l1ERF::NHLH1, Tfcp2l1ERF::NHLH1, Tfcp2l1FOXE1——Nrf1Nrf1
* CpG identifiers according to the GEO Access Viewer.
Table 3. Oligonucleotides used in this study.
Table 3. Oligonucleotides used in this study.
GenePrimersP/S5′-Sequence-3′Amplicon SizeDispensation Order for Pyrosequencing
CCR5CCR5-FpPTATGATTGATTTGTATAGTTTATTTGGTTAFp + Rp
121		–
CCR5-RpPbiotin-CTCATCTCAAAAACTAACTAAC
CCR5-F1pPGTAGTGGGATGAGTAGAGAATAF1p + Rp
331		–
CCR5-S2PGAAGAATTGTTTTTTGATTTTTTT–YGTTTTTAATATAT
CCR5-S3PGGTTAGAAGAGTTGAGATATT–YGTTTTTTTATAAGAAATTTTTTTYGGTAAG
CCR5-FsSGTGGGTTTTTGATTAGATGAATGTAFs + Rs
517		–
CCR5-RsSCCAAACTATAACCCTTTCCTTATCTT
CXCR4CXCR4-FpPGTG GTT ATT GGA GTA TTT AGG TFp + Rp
168		–
CXCR4-RpPbiotin-TCT ACC CCT CTC CCC CA
CXCR4-SPGTTAATAAATTGAAGTTTTTGGT–YGYGGTYGGATTTTTATAAAAATAYGTTTYGAGYGYGGYGTAT
CXCR4-FsSATGATAAAGTAGGTTGAAATTGGATTTFs + Rs
376		–
CXCR4-RsSTCCCTCAAACTTAAAAAATACCTCTA
P/S—pyrosequencing/Sanger; F—forward primer; R—reverse primer; S—sequencing primer; Y—C/T.
Table 4. Methylation level differences in PLWH with respect to baseline values.
Table 4. Methylation level differences in PLWH with respect to baseline values.
Week 0Week 24Week 48p-ValCI 95%
CCR5 (CpG 1)71.2466.8858.240.0059 *2.3473–23.6527
CXCR4 (CpG 3)4.751.532.120.0013 **0.8614–5.5798
0.0169 *0.2731–4.9916
* Methylation level comparison between PLWH at baseline (week 0) and week 48. ** Methylation level comparison between PLWH at baseline (week 0) and week 24.
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Esman, A.; Salamaikina, S.; Kirichenko, A.; Vinokurov, M.; Fomina, D.; Sikamov, K.; Syrkina, A.; Pokrovskaya, A.; Akimkin, V. Promoter Methylation of HIV Coreceptor-Related Genes CCR5 and CXCR4: Original Research. Viruses 2025, 17, 465. https://doi.org/10.3390/v17040465

AMA Style

Esman A, Salamaikina S, Kirichenko A, Vinokurov M, Fomina D, Sikamov K, Syrkina A, Pokrovskaya A, Akimkin V. Promoter Methylation of HIV Coreceptor-Related Genes CCR5 and CXCR4: Original Research. Viruses. 2025; 17(4):465. https://doi.org/10.3390/v17040465

Chicago/Turabian Style

Esman, Anna, Svetlana Salamaikina, Alina Kirichenko, Michael Vinokurov, Darya Fomina, Kirill Sikamov, Arina Syrkina, Anastasia Pokrovskaya, and Vasily Akimkin. 2025. "Promoter Methylation of HIV Coreceptor-Related Genes CCR5 and CXCR4: Original Research" Viruses 17, no. 4: 465. https://doi.org/10.3390/v17040465

APA Style

Esman, A., Salamaikina, S., Kirichenko, A., Vinokurov, M., Fomina, D., Sikamov, K., Syrkina, A., Pokrovskaya, A., & Akimkin, V. (2025). Promoter Methylation of HIV Coreceptor-Related Genes CCR5 and CXCR4: Original Research. Viruses, 17(4), 465. https://doi.org/10.3390/v17040465

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop