Molecular Dissection of Symptom Determinants in Tomato Leaf Curl New Delhi Virus in Zucchini Through Mechanical Transmission
Abstract
1. Introduction
2. Materials and Methods
2.1. Plant Material and Virus Inoculum Preparation
2.2. Sap Inoculation of Two ToLCNDV Isolates
2.3. Mutant Clone Construction
2.4. Virus Analysis by PCR and Quantitative PCR
2.5. Quantitative Real-Time PCR of Host Genes
3. Results
3.1. Comparison of Mechanical Transmissibility of Two ToLCNDV Isolates in Cucurbit Species
3.2. Effect of ToLCNDV DNA-B on the Symptom Appearance Through Sap Inoculation in Zucchini
3.3. Role of NSP in Different Symptom Adaptations of ToLCNDV Mechanical Transmissibility
3.4. Expression of Related Host Defense Genes Under ToLCNDV Mechanical Transmission
4. Discussion
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Jones, R.A. Global plant virus disease pandemics and epidemics. Plants 2021, 10, 233. [Google Scholar] [CrossRef] [PubMed]
- Singh, S.; Awasthi, L.P.; Jangre, A. Chapter 24—Transmission of plant viruses in fields through various vectors. In Applied Plant Virology; Awasthi, L.P., Ed.; Academic Press: Cambridge, MA, USA, 2020; pp. 313–334. [Google Scholar]
- Peters, D.; Matsumura, E.E.; van Vredendaal, P.; van der Vlugt, R.A. The plant virus transmissions database. J. Gen. Virol. 2024, 105, 001957. [Google Scholar] [CrossRef] [PubMed]
- Wege, C.; Pohl, D. Abutilon mosaic virus DNA B component supports mechanical virus transmission, but does not counteract begomoviral phloem limitation in transgenic plants. Virology 2007, 365, 173–186. [Google Scholar] [CrossRef]
- Ajlan, A.; Ghanem, G.; Abdulsalam, K. Tomato yellow leaf curl virus (TYLCV) in Saudi Arabia: Identification, partial characterization and virus-vector relationship. J. Biotechnol. 2007, 10, 179–192. [Google Scholar]
- Chatchawankanphanich, O.; Maxwell, D.P. Tomato leaf curl Karnataka virus from Bangalore, India, appears to be a recombinant begomovirus. Phytopathology 2002, 92, 637–645. [Google Scholar] [CrossRef]
- Garrido-Ramirez, E.R.; Sudarshana, M.R.; Gilbertson, R.L. Bean golden yellow mosaic virus from Chiapas, Mexico: Characterization, Pseudorecombination with Other Bean-Infecting Geminiviruses and Germ Plasm Screening. Phytopathology 2000, 90, 1224–1232. [Google Scholar] [CrossRef]
- Tsai, W.; Shih, S.; Kenyon, L.; Green, S.; Jan, F.J. Temporal distribution and pathogenicity of the predominant tomato—Infecting begomoviruses in Taiwan. Plant Pathol. 2011, 60, 787–799. [Google Scholar] [CrossRef]
- Usharani, K.S.; Surendranath, B.; Paul-Khurana, S.M.; Garg, I.D.; Malathi, V.G. Potato leaf curl—A new disease of potato in northern India caused by a strain of Tomato leaf curl New Delhi virus. Plant Pathol. 2004, 53, 235. [Google Scholar] [CrossRef]
- Juárez, M.; Tovar, R.; Fiallo-Olivé, E.; Aranda, M.; Gosálvez, B.; Castillo, P.; Moriones, E.; Navas-Castillo, J. First detection of Tomato leaf curl New Delhi virus infecting zucchini in Spain. Plant Dis. 2014, 98, 857. [Google Scholar] [CrossRef]
- Padidam, M.; Beachy, R.N.; Fauquet, C.M. Tomato leaf curl geminivirus from India has a bipartite genome and coat protein is not essential for infectivity. J. Gen. Virol. 1995, 76, 25–35. [Google Scholar] [CrossRef]
- Panno, S.; Iacono, G.; Davino, M.; Marchione, S.; Zappardo, V.; Bella, P.; Tomassoli, L.; Accotto, G.; Davino, S. First report of Tomato leaf curl New Delhi virus affecting zucchini squash in an important horticultural area of southern Italy. New Dis. Rep. 2016, 33, 6. [Google Scholar] [CrossRef]
- Parrella, G.; Troiano, E.; Formisano, G.; Accotto, G.; Giorgini, M. First report of Tomato leaf curl New Delhi virus associated with severe mosaic of pumpkin in Italy. Plant Dis. 2018, 102, 459. [Google Scholar] [CrossRef]
- Radouane, N.; Tahiri, A.; El Ghadraoui, L.; Al Figuigui, J.; Lahlali, R. First report of Tomato leaf curl New Delhi virus in Morocco. New Dis. Rep. 2018, 37, 2. [Google Scholar] [CrossRef]
- Srivastava, K.; Hallan, V.; Raizada, R.; Chandra, G.; Singh, B.; Sane, P. Molecular cloning of Indian tomato leaf curl vims genome following a simple method of concentrating the supercoiled replicative form of viral DNA. J. Virol. Methods 1995, 51, 297–304. [Google Scholar] [CrossRef]
- Chang, H.-H.; Ku, H.-M.; Tsai, W.-S.; Chien, R.-C.; Jan, F.-J. Identification and characterization of a mechanical transmissible begomovirus causing leaf curl on oriental melon. Eur. J. Plant Pathol. 2010, 127, 219–228. [Google Scholar] [CrossRef]
- López, C.; Ferriol, M.; Picó, M.B. Mechanical transmission of Tomato leaf curl New Delhi virus to cucurbit germplasm: Selection of tolerance sources in Cucumis melo. Euphytica 2015, 204, 679–691. [Google Scholar] [CrossRef]
- Samretwanich, K.; Chiemsombat, P.; Kittipakorn, K.; Ikegami, M. Tomato Leaf Curl Geminivirus Associated with Cucumber Yellow Leaf Disease in Thailand. J. Phytopathol. 2000, 148, 615–617. [Google Scholar]
- Chang, H.H.; Gustian, D.; Chang, C.J.; Jan, F.J. Virus-virus interactions alter the mechanical transmissibility and host range of begomoviruses. Front. Plant Sci. 2023, 14, 1092998. [Google Scholar] [CrossRef]
- Lee, C.H.; Zheng, Y.X.; Chan, C.H.; Ku, H.M.; Chang, C.J.; Jan, F.J. A single amino acid substitution in the movement protein enables the mechanical transmission of a geminivirus. Mol. Plant Pathol. 2020, 21, 571–588. [Google Scholar] [CrossRef]
- Troiano, E.; Parrella, G. First report of tomato leaf curl New Delhi virus in Lagenaria siceraria var. longissima in Italy. Phytopathol. Mediterr. 2023, 62, 17–24. [Google Scholar] [CrossRef]
- Vo, T.T.; Lal, A.; Ho, P.T.; Troiano, E.; Parrella, G.; Kil, E.-J.; Lee, S. Different infectivity of Mediterranean and Southern Asian tomato leaf curl New Delhi virus isolates in cucurbit crops. Plants 2022, 11, 704. [Google Scholar] [CrossRef] [PubMed]
- Vo, T.T.B.; Troiano, E.; Lal, A.; Hoang, P.T.; Kil, E.-J.; Lee, S.; Parrella, G. ToLCNDV-ES infection in tomato is enhanced by TYLCV: Evidence from field survey and agroinoculation. Front. Microbiol. 2022, 13, 954460. [Google Scholar] [CrossRef] [PubMed]
- Li, J.; Wang, J.-c.; Ding, T.-b.; Chu, D. Synergistic Effects of a Tomato chlorosis virus and Tomato yellow leaf curl virus Mixed Infection on Host Tomato Plants and the Whitefly Vector. Front. Plant Sci. 2021, 12, 672400. [Google Scholar] [CrossRef]
- Livak, K.J.; Schmittgen, T.D. Analysis of relative gene expression data using real-time quantitative PCR and the 2−ΔΔCT method. Methods 2001, 25, 402–408. [Google Scholar] [CrossRef]
- Román, B.; Gómez, P.; Picó, B.; López, C.; Janssen, D. Candidate gene analysis of tomato leaf curl New Delhi virus resistance in Cucumis melo. Sci. Hortic. 2019, 243, 12–20. [Google Scholar] [CrossRef]
- Sharma, N.; Prasad, M. An insight into plant—Tomato leaf curl New Delhi virus interaction. Nucleus 2017, 60, 335–348. [Google Scholar] [CrossRef]
- Vo, T.T.B.; Cho, W.K.; Jo, Y.; Lal, A.; Nattanong, B.; Qureshi, M.A.; Tabssum, M.; Troiano, E.; Parrella, G.; Kil, E.-J.; et al. Transcriptional Analysis of the Differences Between ToLCNDV-India and ToLCNDV-ES Leading to Contrary Symptom Development in Cucumber. Int. J. Mol. Sci. 2023, 24, 2181. [Google Scholar] [CrossRef]
- Weigel, K.; Pohl, J.O.; Wege, C.; Jeske, H. A population genetics perspective on geminivirus infection. J. Virol. 2015, 89, 11926–11934. [Google Scholar] [CrossRef]
- Xiao, Y.-X.; Li, D.; Wu, Y.-J.; Liu, S.-S.; Pan, L.-L. Constant ratio between the genomic components of bipartite begomoviruses during infection and transmission. Virol. J. 2023, 20, 186. [Google Scholar] [CrossRef]
- Gafni, Y.; Epel, B.L. The role of host and viral proteins in intra- and inter-cellular trafficking of geminiviruses. Physiol. Mol. Plant Pathol. 2002, 60, 231–241. [Google Scholar] [CrossRef]
- Hou, Y.-M.; Sanders, R.; Ursin, V.M.; Gilbertson, R.L. Transgenic plants expressing geminivirus movement proteins: Abnormal phenotypes and delayed infection by Tomato mottle virus in transgenic tomatoes expressing the Bean dwarf mosaic virus BV1 or BC1 proteins. Mol. Plant-Microbe Interact. 2000, 13, 297–308. [Google Scholar] [CrossRef] [PubMed][Green Version]
- Ingham, D.J.; Pascal, E.; Lazarowitz, S.G. Both bipartite geminivirus movement proteins define viral host range, but only BL1 determines viral pathogenicity. Virology 1995, 207, 191–204. [Google Scholar] [CrossRef] [PubMed]
- Hussain, M.; Mansoor, S.; Iram, S.; Fatima, A.N.; Zafar, Y. The nuclear shuttle protein of Tomato leaf curl New Delhi virus is a pathogenicity determinant. J. Virol. 2005, 79, 4434–4439. [Google Scholar] [CrossRef]
- Zhou, Y.-C.; Garrido-Ramirez, E.R.; Sudarshana, M.R.; Yendluri, S.; Gilbertson, R.L. The N-terminus of the Begomovirus Nuclear Shuttle Protein (BV1) Determines Virulence or Avirulence in Phaseolus vulgaris. Mol. Plant-Microbe Interact. 2007, 20, 1523–1534. [Google Scholar] [CrossRef]
- Mandal, A.; Sarkar, D.; Kundu, S.; Kundu, P. Mechanism of regulation of tomato TRN1 gene expression in late infection with tomato leaf curl New Delhi virus (ToLCNDV). Plant Sci. 2015, 241, 221–237. [Google Scholar] [CrossRef]
- Martins, L.G.C.; Raimundo, G.A.S.; Ribeiro, N.G.A.; Silva, J.C.F.; Euclydes, N.C.; Loriato, V.A.P.; Duarte, C.E.M.; Fontes, E.P.B. A Begomovirus Nuclear Shuttle Protein-Interacting Immune Hub: Hijacking Host Transport Activities and Suppressing Incompatible Functions. Front. Plant Sci. 2020, 11, 398. [Google Scholar] [CrossRef]







| Experiment | IC | Agro-Inoculation | Mechanical Transmission | ||
|---|---|---|---|---|---|
| Infectivity | Symptom | Infectivity | Symptom | ||
| Subgenome swapped | AESBES | 9/9 | Severe leaf curl, yellow mosaic, stunting | 11/12 | Severe leaf curl, yellow mosaic, stunting |
| AInBIn | 8/9 | Severe leaf curl, yellow mosaic, stunting | 8/12 | No symptoms | |
| AESBIn | 8/9 | Severe leaf curl, yellow mosaic, stunting | 8/12 | No symptoms | |
| AInBES | 9/9 | Severe leaf curl, yellow mosaic, stunting | 10/12 | Severe leaf curl, yellow mosaic, stunting | |
| Chimeric | ESBIRIn | 6/9 | Leaf curl, mosaic, mild stunting | 5/9 | No symptoms |
| ESBV1In | 7/9 | Leaf curl, mosaic, mild stunting | 4/9 | Mild mosaic | |
| ESBC1In | 7/9 | Leaf curl, mosaic, mild stunting | 6/9 | No symptoms | |
| InBV1ES | 7/9 | Leaf curl, mosaic, mild stunting | 5/9 | No symptoms | |
| Target Gene | Primer Sequence (5′-3′) | Target Size | Gene Location |
|---|---|---|---|
| 26S proteasome subunit 6A homolog | F: AACCCTGAAGATGACGCAGA | 100 bp | chr11: 7268831 .. 7273953 (+) |
| R: TAGTCTGGCGAGTGGATGTC | |||
| Pathogenesis-related protein | F: TGTTTCGTTCCTCTCTCGCT | 166 bp | chr15: 5346921 .. 5347412 (+) |
| R: GAGTGCACCAATCGACAGTC | |||
| Actin–related protein | F: ATCATCAGACTTGGCCACCA | 126 bp | chr 8: 2026365 .. 2036546 (−) |
| R: CTACAGCAACAGCATCGACC | |||
| Tornado 1 | F: TCTGCAGCAACCAACAACTC | 197 bp | chr2: 5147191 .. 5151428 (−) |
| R: TCACAGCTTCCACAAATGCC | |||
| 4-Coumarate-CoA ligase-like protein | F: TCTGCAGCAACCAACAACTC | 181 bp | chr9: 4145298 .. 4149751 (−) |
| R: TCACAGCTTCCACAAATGCC | |||
| NSP-interacting kinase 1 (NIK1) | F: CATTTGCTCATCTGGGTCGG | 195 bp | chr9: 1462093 .. 1466184 (−) |
| R: CGTTGCCTCCACCAAATGAA |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2025 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Vo, T.T.B.; Kil, E.-J.; Tabassum, M.; Nattanong, B.; Qureshi, M.A.; Im, H.-J.; Parrella, G.; Lee, T.-K.; Lee, S. Molecular Dissection of Symptom Determinants in Tomato Leaf Curl New Delhi Virus in Zucchini Through Mechanical Transmission. Viruses 2025, 17, 294. https://doi.org/10.3390/v17030294
Vo TTB, Kil E-J, Tabassum M, Nattanong B, Qureshi MA, Im H-J, Parrella G, Lee T-K, Lee S. Molecular Dissection of Symptom Determinants in Tomato Leaf Curl New Delhi Virus in Zucchini Through Mechanical Transmission. Viruses. 2025; 17(3):294. https://doi.org/10.3390/v17030294
Chicago/Turabian StyleVo, Thuy T. B., Eui-Joon Kil, Marjia Tabassum, Bupi Nattanong, Muhammad Amir Qureshi, Hyo-Jin Im, Giuseppe Parrella, Taek-Kyun Lee, and Sukchan Lee. 2025. "Molecular Dissection of Symptom Determinants in Tomato Leaf Curl New Delhi Virus in Zucchini Through Mechanical Transmission" Viruses 17, no. 3: 294. https://doi.org/10.3390/v17030294
APA StyleVo, T. T. B., Kil, E.-J., Tabassum, M., Nattanong, B., Qureshi, M. A., Im, H.-J., Parrella, G., Lee, T.-K., & Lee, S. (2025). Molecular Dissection of Symptom Determinants in Tomato Leaf Curl New Delhi Virus in Zucchini Through Mechanical Transmission. Viruses, 17(3), 294. https://doi.org/10.3390/v17030294

