Detection of Foodborne Viruses in Dates Using ISO 15216 Methodology
Abstract
1. Introduction
2. Materials and Methods
2.1. Viruses
2.2. Dates Subsamples
2.3. Artificial Contamination (Inoculation)
2.4. Virus Elution and RNA Extraction
2.5. RT-qPCR
2.6. Crystal Digital RT PCR (RT-cdPCR)
2.7. Sequencing
2.8. Recovery Rate Calculation
2.9. Calculation of RT-qPCR Inhibition
2.10. Calculation of Limit of Detection (LOD)
2.11. Statistical Analyses
2.11.1. Competition
2.11.2. Robustness
2.11.3. Selectivity
3. Results
3.1. NoV and HAV Recovery Rates from Whole Medjool
3.2. Noroviruses and HAV LOD from Whole Medjool
3.3. Robustness
3.4. NoV and HAV Recovery Rates and LOD from Pitted Dates
4. Discussion
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Bosch, A.; Gkogka, E.; Le Guyader, F.S.; Loisy-Hamon, F.; Lee, A.; van Lieshout, L.; Marthi, B.; Myrmel, M.; Sansom, A.; Schultz, A.C.; et al. Foodborne viruses: Detection, risk assessment, and control options in food processing. Int. J. Food Microbiol. 2018, 285, 110–128. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Cook, N.; Bertrand, I.; Gantzer, C.; Pinto, R.M.; Bosch, A. Persistence of Hepatitis A Virus in Fresh Produce and Production Environments, and the Effect of Disinfection Procedures: A Review. Food Environ. Virol. 2018, 10, 253–262. [Google Scholar] [CrossRef] [Scilit]
- Moore, M.D.; Goulter, R.M.; Jaykus, L.A. Human norovirus as a foodborne pathogen: Challenges and developments. Annu. Rev. Food Sci. Technol. 2015, 6, 411–433. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Manuel, C.S.; Moore, M.D.; Jaykus, L.A. Predicting human norovirus infectivity—Recent advances and continued challenges. Food Microbiol 2018, 76, 337–345. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- CDC. Surveillance for Foodborne Disease Outbreaks, United States, 2017, Annual Report; Centers for Disease Control and Prevention (CDC); U.S. Department of Health and Human Services: Atlanta, GA, USA, 2019. Available online: https://stacks.cdc.gov/view/cdc/152191/cdc_152191_DS1.pdf (accessed on 24 November 2024).
- European Food Safety Authority; European Centre for Disease Prevention and Control. The European Union One Health 2021 Zoonoses Report. EFSA J. 2022, 20, e07666. [Google Scholar]
- Nasheri, N.; Vester, A.; Petronella, N. Foodborne viral outbreaks associated with frozen produce. Epidemiol. Infect. 2019, 147, e291. [Google Scholar] [CrossRef] [Scilit]
- Olaimat, A.N.; Taybeh, A.O.; Al-Nabulsi, A.; Al-Holy, M.; Hatmal, M.M.; Alzyoud, J.; Aolymat, I.; Abughoush, M.H.; Shahbaz, H.; Alzyoud, A.; et al. Common and Potential Emerging Foodborne Viruses: A Comprehensive Review. Life 2024, 14, 190. [Google Scholar] [CrossRef] [Scilit]
- Baert, L.; Debevere, J.; Uyttendaele, M. The efficacy of preservation methods to inactivate foodborne viruses. Int. J. Food Microbiol. 2009, 131, 83–94. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Cook, N.; Knight, A.; Richards, G.P. Persistence and Elimination of Human Norovirus in Food and on Food Contact Surfaces: A Critical Review. J. Food Prot. 2016, 79, 1273–1294. [Google Scholar] [CrossRef] [Scilit]
- Nasheri, N.; Harlow, J.; Chen, A.; Corneau, N.; Bidawid, S. Survival and Inactivation by Advanced Oxidative Process of Foodborne Viruses in Model Low-Moisture Foods. Food Environ. Virol. 2021, 13, 107–116. [Google Scholar] [CrossRef] [Scilit]
- Sakon, N.; Sadamasu, K.; Shinkai, T.; Hamajima, Y.; Yoshitomi, H.; Matsushima, Y.; Takada, R.; Terasoma, F.; Nakamura, A.; Komano, J.; et al. Foodborne Outbreaks Caused by Human Norovirus GII.P17-GII.17-Contaminated Nori, Japan, 2017. Emerg. Infect. Dis. 2018, 24, 920–923. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Donnan, E.J.; Fielding, J.E.; Gregory, J.E.; Lalor, K.; Rowe, S.; Goldsmith, P.; Antoniou, M.; Fullerton, K.E.; Knope, K.; Copland, J.G.; et al. A multistate outbreak of hepatitis A associated with semidried tomatoes in Australia, 2009. Clin. Infect. Dis. 2012, 54, 775–781. [Google Scholar] [CrossRef] [Scilit]
- Rajiuddin, S.M.; Midgley, S.E.; Jensen, T.; Muller, L.; Schultz, A.C. Application of an Optimized Direct Lysis Method for Viral RNA Extraction Linking Contaminated Dates to Infection With Hepatitis A Virus. Front. Microbiol. 2020, 11, 516445. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Gassowski, M.; Michaelis, K.; Wenzel, J.J.; Faber, M.; Figoni, J.; Mouna, L.; Friesema, I.H.; Vennema, H.; Avellon, A.; Varela, C.; et al. Two concurrent outbreaks of hepatitis A highlight the risk of infection for non-immune travellers to Morocco, January to June 2018. Euro Surveill. 2018, 23, 1800329. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Whitworth, J. Dates from Iran linked to Hepatitis A outbreak for second time in 2 years. Food Safety News. 2019. Available online: https://www.foodsafetynews.com/2019/05/dates-from-iran-linked-to-hepatitis-a-outbreak-in-sweden/ (accessed on 27 August 2024).
- O’Neill, C.; Franklin, N.; Edwards, A.; Martin, T.; O’Keefe, J.; Jackson, K.; Pingault, N.; Glasgow, K. Hepatitis A outbreak in Australia linked to imported Medjool dates, June-September 2021. Commun. Dis. Intell. 2022, 46. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Garcia Vilaplana, T.; Leeman, D.; Balogun, K.; Ngui, S.L.; Phipps, E.; Khan, W.M.; Incident, T.; Balasegaram, S. Hepatitis A outbreak associated with consumption of dates, England and Wales, January 2021 to April 2021. Euro Surveill. 2021, 26, 2100432. [Google Scholar] [CrossRef] [Scilit]
- Food Standards Australia New Zealand Ready-to-Eat Dates and Hepatitis A Virus (HAV). Available online: https://www.foodstandards.gov.au/sites/default/files/2023-11/Imported%20food%20risk%20statement%20Dates%20and%20Hepatitis%20A%20.pdf (accessed on 20 September 2023).
- Barreveld, W. Date Palm Products; Food and Agriculture Organization of the United Nations: Rome, Italy, 1993. [Google Scholar]
- ISO 15216-1:2017; Microbiology of the Food Chain—Horizontal Method for Determination of Hepatitis A Virus and Norovirus Using Real-Time RT-PCR–Part 1: Method for Quantification. ISO: Geneva, Switzerland, 2017.
- Raymond, P.; Paul, S.; Perron, A.; Deschenes, L. Norovirus Extraction from Frozen Raspberries Using Magnetic Silica Beads. Food Environ. Virol. 2021, 13, 248–258. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Raymond, P.; Paul, S.; Perron, A.; Deschenes, L.; Hara, K. Extraction of human noroviruses from leafy greens and fresh herbs using magnetic silica beads. Food Microbiol. 2021, 99, 103827. [Google Scholar] [CrossRef] [Scilit]
- Nasheri, N.; Harlow, J.; Chen, A.; Corneau, N.; Bidawid, S. Evaluation of Bead-Based Assays for the Isolation of Foodborne Viruses from Low-Moisture Foods. J. Food Prot. 2020, 83, 388–396. [Google Scholar] [CrossRef] [Scilit]
- Summa, M.; Maunula, L. Rapid Detection of Human Norovirus in Frozen Raspberries. Food Environ. Virol. 2018, 10, 51–60. [Google Scholar]
- Larocque, E.; Levesque, V.; Lambert, D. Crystal digital RT-PCR for the detection and quantification of norovirus and hepatitis A virus RNA in frozen raspberries. Int. J. Food Microbiol. 2022, 380, 109884. [Google Scholar] [CrossRef] [Scilit]
- Gonzalez-Hernandez, M.B.; Bragazzi Cunha, J.; Wobus, C.E. Plaque assay for murine norovirus. J. Vis. Exp. 2012, 66, e4297. [Google Scholar] [CrossRef] [Scilit]
- Raymond, P.; Paul, S.; Perron, A.; Bellehumeur, C.; Larocque, E.; Charest, H. Detection and Sequencing of Multiple Human Norovirus Genotypes from Imported Frozen Raspberries Linked to Outbreaks in the Province of Quebec, Canada, in 2017. Food Environ. Virol. 2022, 14, 40–58. [Google Scholar] [PubMed]
- Wilrich, C.; Wilrich, P.T. Estimation of the POD function and the LOD of a qualitative microbiological measurement method. J. AOAC Int. 2009, 92, 1763–1772. [Google Scholar] [CrossRef] [Scilit]
- Forootan, A.; Sjoback, R.; Bjorkman, J.; Sjogreen, B.; Linz, L.; Kubista, M. Methods to determine limit of detection and limit of quantification in quantitative real-time PCR (qPCR). Biomol. Detect. Quantif. 2017, 12, 1–6. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Tenge, V.R.; Hu, L.; Prasad, B.V.V.; Larson, G.; Atmar, R.L.; Estes, M.K.; Ramani, S. Glycan Recognition in Human Norovirus Infections. Viruses 2021, 13, 2066. [Google Scholar] [CrossRef] [Scilit]
- Teunis, P.F.M.; Le Guyader, F.S.; Liu, P.; Ollivier, J.; Moe, C.L. Noroviruses are highly infectious but there is strong variation in host susceptibility and virus pathogenicity. Epidemics 2020, 32, 100401. [Google Scholar] [CrossRef] [Scilit]
- Venter, J.M.; van Heerden, J.; Vivier, J.C.; Grabow, W.O.; Taylor, M.B. Hepatitis A virus in surface water in South Africa: What are the risks? J. Water Health 2007, 5, 229–240. [Google Scholar] [CrossRef] [Scilit]
- Rajiuddin, S.M.; Jensen, T.; Hansen, T.B.; Schultz, A.C. An Optimised Direct Lysis Method for Viral RNA Extraction and Detection of Foodborne Viruses on Fruits and Vegetables. Food Environ. Virol. 2020, 12, 226–239. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Boxman, I.L.A.; Molin, R.; Persson, S.; Jureus, A.; Jansen, C.C.C.; Sosef, N.P.; Le Guyader, S.F.; Ollivier, J.; Summa, M.; Hautaniemi, M.; et al. An international inter-laboratory study to compare digital PCR with ISO standardized qPCR assays for the detection of norovirus GI and GII in oyster tissue. Food Microbiol. 2024, 120, 104478. [Google Scholar] [CrossRef] [Scilit]
- Camilleri, E.; Blundell, R.; Cuschieri, A. Deciphering the anti-constipation characteristics of palm dates (Phoenix dactylifera): A review. Int. J. Food Prop. 2023, 26, 65–80. [Google Scholar] [CrossRef] [Scilit]
- de Graaf, M.; van Beek, J.; Koopmans, M.P. Human norovirus transmission and evolution in a changing world. Nat. Rev. Microbiol. 2016, 14, 421–433. [Google Scholar] [CrossRef] [Scilit]
- Ekundayo, T.C.; Igere, B.E.; Oluwafemi, Y.D.; Iwu, C.D.; Olaniyi, O.O. Human norovirus contamination in water sources: A systematic review and meta-analysis. Environ. Pollut. 2021, 291, 118164. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Wales, S.Q.; Pandiscia, A.; Kulka, M.; Sanchez, G.; Randazzo, W. Challenges for estimating human norovirus infectivity by viability RT-qPCR as compared to replication in human intestinal enteroids. Int. J. Food Microbiol. 2024, 411, 110507. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Guevremont, E.; Brassard, J.; Houde, A.; Simard, C.; Trottier, Y.L. Development of an extraction and concentration procedure and comparison of RT-PCR primer systems for the detection of hepatitis A virus and norovirus GII in green onions. J. Virol. Methods 2006, 134, 130–135. [Google Scholar]
- Houde, A.; Guevremont, E.; Poitras, E.; Leblanc, D.; Ward, P.; Simard, C.; Trottier, Y.L. Comparative evaluation of new TaqMan real-time assays for the detection of hepatitis A virus. J. Virol. Methods 2007, 140, 80–89. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- da Silva, A.K.; Le Saux, J.C.; Parnaudeau, S.; Pommepuy, M.; Elimelech, M.; Le Guyader, F.S. Evaluation of removal of noroviruses during wastewater treatment, using real-time reverse transcription-PCR: different behaviors of genogroups I and II. Appl. Environ. Microbiol. 2007, 73, 7891–7897. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Svraka, S.; Duizer, E.; Vennema, H.; de Bruin, E.; van der Veer, B.; Dorresteijn, B.; Koopmans, M. Etiological role of viruses in outbreaks of acute gastroenteritis in The Netherlands from 1994 through 2005. J. Clin. Microbiol. 2007, 45, 1389–1394. [Google Scholar] [PubMed]
- Hoehne, M.; Schreier, E. Detection of Norovirus genogroup I and II by multiplex real-time RT- PCR using a 3'-minor groove binder-DNA probe. BMC Infect. Dis. 2006, 6, 69. [Google Scholar] [CrossRef] [Scilit]
- Loisy, F.; Atmar, R.L.; Guillon, P.; Le Cann, P.; Pommepuy, M.; Le Guyader, F.S. Real-time RT-PCR for norovirus screening in shellfish. J. Virol. Methods 2005, 123, 1–7. [Google Scholar] [CrossRef] [Scilit]
- Kageyama, T.; Kojima, S.; Shinohara, M.; Uchida, K.; Fukushi, S.; Hoshino, F.B.; Takeda, N.; Katayama, K. Broadly reactive and highly sensitive assay for Norwalk-like viruses based on real-time quantitative reverse transcription-PCR. J. Clin. Microbiol. 2003, 41, 1548–1557. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Baert, L.; Wobus, C.E.; Van Coillie, E.; Thackray, L.B.; Debevere, J.; Uyttendaele, M. Detection of murine norovirus 1 by using plaque assay, transfection assay, and real-time reverse transcription-PCR before and after heat exposure. Appl. Environ. Microbiol. 2008, 74, 543–546. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Raymond, P.; Paul, S.; Guy, R.A. Impact of Capsid and Genomic Integrity Tests on Norovirus Extraction Recovery Rates. Foods 2023, 12, 826. [Google Scholar] [CrossRef] [Scilit]




| Extraction Method | Inoculum Average (gEq per 25 g) | Recovery Average ± sd (%) | Inhibition Average ± sd (%) |
|---|---|---|---|
| ISO15216-modA (soft fruit + eGENE-UP) | 2.6 × 103 | 10 ± 4 | nd |
| 2.3 × 104 | 10 ± 1 | −2 ± 34 | |
| 3.3 × 105 | 8 ± 2 | 16 ± 11 | |
| ISO15216-modB (vegetable + eGENE-UP) | 3.9 × 103 | 39 ± 11 | −70 ± 65 |
| 4.0 × 104 | 39 ± 11 | −13 ± 13 | |
| 4.4 × 105 | 27 ± 9 | −6 ± 5 | |
| ISO15216-modC (vegetable + RNeasy) | 2.6 × 101 | 38 ± 16 | nd |
| 1.6 × 102 | 38 ± 23 | nd | |
| 1.8 × 103 | 44 ± 4 | −7 ± 46 |
| Virus | Inoculum Average ± sd (103 gEq per 25 g) | Recovery Average ± sd (%) |
|---|---|---|
| HuNoV GI | 2.32 ± 0.04 | 65 ± 13 *1 |
| HuNoV GII | 7.0 ± 0.3 | 36 ± 9 |
| HAV | 2.4 ± 0.2 | 70 ± 1 |
| Virus | Detection Methodology | LOD50 gEq per 25 g (CI95%) | LOD95 gEq per 25 g (CI95%) |
|---|---|---|---|
| MNV | RT-qPCR | 5 (2–15) | 22 (7–66) |
| RT-cdPCR | 7 (2–31) | 30 (7–133) | |
| GI | RT-qPCR | 34 (17–68) | 148 (75–294) |
| RT-cdPCR | 134 (52–345) | 579 (225–1491) | |
| GII | RT-qPCR | 42 (20–91) | 184 (86–393) |
| RT-cdPCR | 26 (10–67) | 113 (44–290) | |
| HAV | RT-qPCR | 14 (7–29) | 61 (30–124) |
| RT-cdPCR | 101 (38–268) | 438 (165–1160) |
| Subsample | Varieties | MSRS Genotype | MSRS (% Homology) | 5′-3′ Sequences |
|---|---|---|---|---|
| CFIA-FVR-020 | Reference | GII.4 | MT754281.1 | TCTGAGCACGTGGGAGGGCGATCGCAATCTGGCTCCCAGTTT |
| CFIA-FVR-022 | Reference | GI.5 | OL345567 | GACCTCGGATTGTGGACAGGAGATCGCAATCTCCTGCCCGAATTC |
| P-Sayer/Iran/H1-248 | Sayer | GII | >1000 sequences | CTTGAGCACGTGGGAGGGCGATCGCAATCTGGCTCCCAATTT |
| P-Sayer/Iran/H3-300 | Sayer | GII | >1000 sequences | CTTGAGCACGTGGGAGGGCGATCGCAATCTGGCTCCCAATTT |
| P-Uns/Unk/L-308 | Medjool | GI.8 | MT372476 (97.8%) | GACTTAGGTTTGTGGACAGGAGATCGCGATCTCTTGCCCGATTAT |
| P-Uns/Palestine/P-358 | na | GI.6 | MK789655 (97.8%) | GACCTTGGCTTGTGGACAGGAGATCGCAATCTTCTGCCCGAATTC |
| P-Uns/Iran/M2-359 | na | GI.3 | MY492069 (97.8%) | GATATGAGTTTGTGGACAGGGGACCGCGATCTCCTGCCCGATTAT |
| Type | Varieties | Country of Origin | HuNoV GI | HuNoV GII | ||
|---|---|---|---|---|---|---|
| Inoculum Average gEq per 25 g | Recovery Rate Average ± sd (%) | Inoculum Average gEq per 25 g | Recovery Average ± sd (%) | |||
| Whole | Bahri | Jordan | 6 × 104 | 27 ± 2 | 4 × 103 | 24 ± 2 |
| Whole | Mazafati | Iran | 6 × 104 | 23 ± 2 | 4 × 103 | 16 ± 5 |
| Whole | Deglet Nour | Algeria | 3 × 104 | 16 ± 24 | 4 × 103 | 11 ± 15 |
| Whole | Khudari | Saudi Arabia | 3 × 104 | 8 ± 3 | 4 × 103 | 6 ± 7 |
| Whole | Zaghoul | Egypt | 1 × 104 | 28 ± 1 | 1 × 104 | 23 ± 3 |
| Pitted | Unspecified *1 | Algeria | 1 × 104 | 1.1 ± 0.2 | 1 × 104 | 1.0 ± 1.1 |
| Pitted | Sayer *2 | Iran | 8 × 103 | 11 ± 3 | 1 × 103 | Inconclusive |
| Pitted | Unspecified *2 | USA/Algeria | 3 × 103 | 4 ± 2 | 2 × 103 | Inconclusive |
| Subsample | Lot | Target Name | CT | Estimated Target RNA Concentration (gEq per g) |
|---|---|---|---|---|
| P-Sayer/Iran/H1-248 *1 | Lot1 box 1 | HuNoVGII | 34.8 | 7.3 |
| P-Sayer/Iran/H1-249 | Lot1 box 1 | HuNoVGII | 35.3 | 5.4 |
| P-Sayer/Iran/H1-250 | Lot1 box 1 | HuNoVGII | 36.6 | 2.2 |
| P-Sayer/Iran/H1-290 | Lot1 box 2 | HuNoVGII | 38.2 | 0.8 |
| P-Sayer/Iran/H1-291 | Lot1 box 2 | HuNoVGII | 35.8 | 3.9 |
| P-Sayer/Iran/H1-292 | Lot1 box 2 | HuNoVGII | 35.8 | 3.8 |
| P-Sayer/Iran/H1-293 | Lot1 box 3 | HuNoVGII | 37.8 | 1.0 |
| P-Sayer/Iran/H1-294 | Lot1 box 3 | HuNoVGII | 37.1 | 1.6 |
| P-Sayer/Iran/H1-295 | Lot1 box 3 | HuNoVGII | 36.6 | 2.3 |
| P-Sayer/Iran/H2-296 | Lot2 | HuNoVGII | 34.4 | 9.8 |
| P-Sayer/Iran/H2-297 | Lot2 | HuNoVGII | 34.6 | 8.7 |
| P-Sayer/Iran/H2-298 | Lot2B | HuNoVGII | 35.9 | 3.5 |
| P-Sayer/Iran/H3-299 | Lot3 | HuNoVGII | 35.6 | 4.4 |
| P-Sayer/Iran/H3-300 *1 | Lot3 | HuNoVGII | 34.2 | 11.0 |
| HuNoV GI | HuNoV GII | HAV | |||
|---|---|---|---|---|---|
| Inoculum Average gEq per 25 g | Recovery Average ± sd (%) | Inoculum Average gEq per 25 g | Recovery Average ± sd (%) | Inoculum Average gEq per 25 g | Recovery Average ± sd (%) |
| 8.9 × 101 | 15 ± 14 (3/5) | 1.0 × 103 | 10 ± 9 | 8.8 × 101 | 23 ± 11 (4/5) |
| 2.9 × 102 | 10 ± 6 | 1.1 × 103 | 2 ± 2 (2/5) | 8.3 × 100 | nd (0/5) |
| 6.8 × 102 | 11 ± 11 | 1.8 × 103 | 10 ± 10 | 1.64 × 102 | 24 ± 19 |
| 2.7 × 103 | 7 ± 3 | 1.1 × 104 | 6 ± 2 | 2.7 × 102 | 7 ± 1 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2025 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Raymond, P.; Blain, R.; Nasheri, N. Detection of Foodborne Viruses in Dates Using ISO 15216 Methodology. Viruses 2025, 17, 174. https://doi.org/10.3390/v17020174
Raymond P, Blain R, Nasheri N. Detection of Foodborne Viruses in Dates Using ISO 15216 Methodology. Viruses. 2025; 17(2):174. https://doi.org/10.3390/v17020174
Chicago/Turabian StyleRaymond, Philippe, Roxanne Blain, and Neda Nasheri. 2025. "Detection of Foodborne Viruses in Dates Using ISO 15216 Methodology" Viruses 17, no. 2: 174. https://doi.org/10.3390/v17020174
APA StyleRaymond, P., Blain, R., & Nasheri, N. (2025). Detection of Foodborne Viruses in Dates Using ISO 15216 Methodology. Viruses, 17(2), 174. https://doi.org/10.3390/v17020174

