Characterization of Novel Luteoviruses in Canadian Highbush Blueberries Using High-Throughput Sequencing
Abstract
1. Introduction
2. Materials and Methods
2.1. Sample Collection
2.2. RNA Extraction from Blueberry Leaves
2.3. RNA-Seq Library Preparation and Data Analysis
2.4. Genome Structure and Phylogenetic Analysis
2.5. Validation by RT-PCR and Amplicon Sequencing
2.6. Confirmation of Genome Sequence of BlVN and BlVM-2
3. Results
3.1. Novel Blueberry Luteovirus and Phylogeny
3.2. Genome Structure of Blueberry Luteoviruses
3.3. Prevalence of Blueberry Luteoviruses in the Fraser Valley
3.4. BlVN and BlVM/M-2 Sequence Diversity
3.4.1. Amplicon Sequencing of Virus Coat Protein
3.4.2. Full-Length Genome Sequencing
4. Discussion
Supplementary Materials
Author Contributions
Funding
Data Availability Statement
Acknowledgments
Conflicts of Interest
Correction Statement
References
- Statistics Canada Canadian Blueberries, from Farm to Fork. Available online: https://www150.statcan.gc.ca/n1/pub/11-627-m/11-627-m2022060-eng.htm (accessed on 26 January 2024).
- Agriculture and Agri-Food Canada Statistical Overview of the Canadian Fruit Industry. 2023. Available online: https://agriculture.canada.ca/en/sector/horticulture/reports/statistical-overview-canadian-fruit-industry-2023 (accessed on 31 January 2025).
- Saad, N.; Olmstead, J.W.; Varsani, A.; Polston, J.E.; Jones, J.B.; Folimonova, S.Y.; Harmon, P.F. Discovery of Known and Novel Viruses in Wild and Cultivated Blueberry in Florida through Viral Metagenomic Approaches. Viruses 2021, 13, 1165. [Google Scholar] [CrossRef]
- Stainton, D.; Villamor, D.E.V.; Sierra Mejia, A.; Srivastava, A.; Mollov, D.; Martin, R.R.; Tzanetakis, I.E. Genomic Analyses of a Widespread Blueberry Virus in the United States. Virus Res. 2023, 333, 199143. [Google Scholar] [CrossRef]
- Lee, E.; Vansia, R.; Phelan, J.; Lofano, A.; Smith, A.; Wang, A.; Bilodeau, G.J.; Pernal, S.F.; Guarna, M.M.; Rott, M.; et al. Area Wide Monitoring of Plant and Honey Bee (Apis Mellifera) Viruses in Blueberry (Vaccinium Corymbosum) Agroecosystems Facilitated by Honey Bee Pollination. Viruses 2023, 15, 1209. [Google Scholar] [CrossRef]
- Villamor, D.E.V.; Mejia, A.S.; Martin, R.R.; Tzanetakis, I.E. Genomic Analysis and Development of Infectious Clone of a Novel Carlavirus Infecting Blueberry. Phytopathology® 2023, 113, 98–103. [Google Scholar] [CrossRef]
- Wegener, L.A.; Punja, Z.K.; Martin, R.R. First Report of Blueberry Scorch Virus in Cranberry in Canada and the United States. Plant Dis. 2004, 88, 427. [Google Scholar] [CrossRef] [PubMed]
- Martin, R.R.; Tzanetakis, I.E. High Risk Blueberry Viruses by Region in North America; Implications for Certification, Nurseries, and Fruit Production. Viruses 2018, 10, 342. [Google Scholar] [CrossRef] [PubMed]
- Bernardy, M.G.; Dubeau, C.R.; Braun, A.; Harlton, C.E.; Bunckle, A.; Lowery, D.T.; French, C.J.; Wegener, L.A. Molecular Characterization and Phylogenetic Analysis of Two Distinct Strains of Blueberry Scorch Virus from Western Canada. Can. J. Plant Pathol. 2005, 27, 581–591. [Google Scholar] [CrossRef]
- Wegener, L.A.; Punja, Z.K.; Martin, R.R.; Bernardy, M.G.; MacDonald, L. Epidemiology and Identification of Strains of Blueberry Scorch Virus on Highbush Blueberry in British Columbia, Canada. Can. J. Plant Pathol. 2006, 28, 250–262. [Google Scholar] [CrossRef]
- Topham, K.; Stockwell, V.; Grinstead, S.; Mollov, D. Genomic Characterization and Survey of a Second Luteovirus Infecting Blueberries. Virus Res. 2024, 350, 199480. [Google Scholar] [CrossRef] [PubMed]
- Isogai, M.; Yamamura, M.; Sakamoto, H.; Yaegashi, H.; Watanabe, M. Occurrence of Blueberry Virus L in Japan and Its Aphid Transmission and Pathogenicity in Highbush Blueberry. J. Gen. Plant Pathol. 2024, 90, 273–276. [Google Scholar] [CrossRef]
- Kidanemariam, D.; Abraham, A. Chapter 3—Luteoviruses. In Plant RNA Viruses; Gaur, R.K., Patil, B.L., Selvarajan, R., Eds.; Academic Press: Cambridge, MA, USA, 2023; pp. 57–77. ISBN 978-0-323-95339-9. [Google Scholar]
- Gray, S.; Gildow, F.E. Luteovirus-Aphid Interactions. Annu. Rev. Phytopathol. 2003, 41, 539–566. [Google Scholar] [CrossRef]
- Ali, M.; Anwar, S.; Shuja, M.N.; Tripathi, R.K.; Singh, J. The Genus Luteovirus from Infection to Disease. Eur. J. Plant Pathol. 2018, 151, 841–860. [Google Scholar] [CrossRef]
- ICTV Master Species Lists|International Committee on Taxonomy of Viruses (ICTV). Available online: https://ictv.global/msl (accessed on 18 January 2024).
- Domier, L.L.; D’Arcy, C.J. Luteoviruses. In Encyclopedia of Virology, 3rd ed.; Mahy, B.W.J., Van Regenmortel, M.H.V., Eds.; Academic Press: Oxford, UK, 2008; pp. 231–238. ISBN 978-0-12-374410-4. [Google Scholar]
- Bag, S.; Al Rwahnih, M.; Li, A.; Gonzalez, A.; Rowhani, A.; Uyemoto, J.K.; Sudarshana, M.R. Detection of a New Luteovirus in Imported Nectarine Trees: A Case Study to Propose Adoption of Metagenomics in Post-Entry Quarantine. Phytopathology® 2015, 105, 840–846. [Google Scholar] [CrossRef]
- Lenz, O.; Sarkisová, T.; Koloniuk, I.; Fránová, J.; Přibylová, J.; Špak, J. Red Clover-Associated Luteovirus—a Newly Classifiable Member of the Genus Luteovirus with an Enamo-like P5 Protein. Arch. Virol. 2018, 163, 3439–3442. [Google Scholar] [CrossRef] [PubMed]
- Shen, P.; Tian, X.; Zhang, S.; Ren, F.; Li, P.; Yu, Y.; Li, R.; Zhou, C.; Cao, M. Molecular Characterization of a Novel Luteovirus Infecting Apple by Next-Generation Sequencing. Arch. Virol. 2018, 163, 761–765. [Google Scholar] [CrossRef]
- Miller, W.A.; Liu, S.; Beckett, R. Barley Yellow Dwarf Virus: Luteoviridae or Tombusviridae? Mol. Plant Pathol. 2002, 3, 177–183. [Google Scholar] [CrossRef]
- Barry, J.K.; Miller, W.A. A −1 Ribosomal Frameshift Element That Requires Base Pairing across Four Kilobases Suggests a Mechanism of Regulating Ribosome and Replicase Traffic on a Viral RNA. Proc. Natl. Acad. Sci. USA 2002, 99, 11133–11138. [Google Scholar] [CrossRef] [PubMed]
- Rajakani, R.; Narnoliya, L.; Sangwan, N.S.; Sangwan, R.S.; Gupta, V. Activated Charcoal-Mediated RNA Extraction Method for Azadirachta Indica and Plants Highly Rich in Polyphenolics, Polysaccharides and Other Complex Secondary Compounds. BMC Res. Notes 2013, 6, 125. [Google Scholar] [CrossRef] [PubMed]
- Aranda, P.S.; LaJoie, D.M.; Jorcyk, C.L. Bleach Gel: A Simple Agarose Gel for Analyzing RNA Quality. Electrophoresis 2012, 33, 366–369. [Google Scholar] [CrossRef]
- Bolger, A.M.; Lohse, M.; Usadel, B. Trimmomatic: A Flexible Trimmer for Illumina Sequence Data. Bioinformatics 2014, 30, 2114–2120. [Google Scholar] [CrossRef]
- Prjibelski, A.; Antipov, D.; Meleshko, D.; Lapidus, A.; Korobeynikov, A. Using SPAdes De Novo Assembler. Curr. Protoc. Bioinforma. 2020, 70, e102. [Google Scholar] [CrossRef]
- Patro, R.; Duggal, G.; Love, M.I.; Irizarry, R.A.; Kingsford, C. Salmon: Fast and Bias-Aware Quantification of Transcript Expression Using Dual-Phase Inference. Nat. Methods 2017, 14, 417. [Google Scholar] [CrossRef]
- Kumar, S.; Stecher, G.; Suleski, M.; Sanderford, M.; Sharma, S.; Tamura, K. MEGA12: Molecular Evolutionary Genetic Analysis Version 12 for Adaptive and Green Computing. Mol. Biol. Evol. 2024, 41, msae263. [Google Scholar] [CrossRef]
- Sanger, F.; Nicklen, S.; Coulson, A.R. DNA Sequencing with Chain-Terminating Inhibitors. Proc. Natl. Acad. Sci. USA 1977, 74, 5463. [Google Scholar] [CrossRef]
- Muhire, B.M.; Varsani, A.; Martin, D.P. SDT: A Virus Classification Tool Based on Pairwise Sequence Alignment and Identity Calculation. PLoS ONE 2014, 9, e108277. [Google Scholar] [CrossRef]
- Tisza, M.J.; Buck, C.B. A Catalog of Tens of Thousands of Viruses from Human Metagenomes Reveals Hidden Associations with Chronic Diseases. Proc. Natl. Acad. Sci. USA 2021, 118, e2023202118. [Google Scholar] [CrossRef] [PubMed]
- ICTV. ICTV 9th Report, International Committee on Taxonomy of Viruses. Available online: https://ictv.global/report_9th (accessed on 28 February 2024).
- Habili, N.; Symons, R.H. Evolutionary Relationship between Luteoviruses and Other RNA Plant Viruses Based on Sequence Motifs in Their Putative RNA Polymerases and Nucleic Acid Helicases. Nucleic Acids Res. 1989, 17, 9543–9555. [Google Scholar] [CrossRef]
- Koonin, E.V. The Phylogeny of RNA-Dependent RNA Polymerases of Positive-Strand RNA Viruses. J. Gen. Virol. 1991, 72, 2197–2206. [Google Scholar] [CrossRef] [PubMed]
- Olson, N.D.; Lund, S.P.; Colman, R.E.; Foster, J.T.; Sahl, J.W.; Schupp, J.M.; Keim, P.; Morrow, J.B.; Salit, M.L.; Zook, J.M. Best Practices for Evaluating Single Nucleotide Variant Calling Methods for Microbial Genomics. Front. Genet. 2015, 6, 235. [Google Scholar] [CrossRef] [PubMed]
- Zhang, X.-S.; Holt, J.; Colvin, J. Synergism between Plant Viruses: A Mathematical Analysis of the Epidemiological Implications. Plant Pathol. 2001, 50, 732–746. [Google Scholar] [CrossRef]
- Sánchez-Tovar, M.R.; Rivera-Bustamante, R.F.; Saavedra-Trejo, D.L.; Guevara-González, R.G.; Torres-Pacheco, I. Mixed Plant Viral Infections: Complementation, Interference and Their Effects, a Review. Agronomy 2025, 15, 620. [Google Scholar] [CrossRef]




| Primer | Sequence | Target | Ta (°C) | Band Size (bp) |
|---|---|---|---|---|
| LutCDNA | GGTAGTCGAGCTGGCATTAGT | For cDNA synthesis | ||
| LutF2 | AATCCACCAGGGCCTTTAC | Detect BlVN and BlVM/M-2 | 57 | 238 |
| LutR1 | GTCGAGCTGGCATTAGTGA | |||
| VcActin_C | CATCAAAGCATCGGTGAGATCC | For cDNA synthesis | ||
| VcActin_F | AGGCTAACCGTGAGAAGATGAC | Control | 57 | 128 |
| VcActin_R | AGAGTCCAGCACGATTCCAG | |||
| Lu3543 R | CCAAAAACGGGGAGAAGG | For cDNA synthesis | ||
| Lu2598 F | CCCGTGGTGTAAAGAGATTG | Full coat protein amplification | 63 * | 850 |
| Lu3447 R | CAACATTGAGCCTTTTCACG |
| Target | Location | Primer | Sequence | Tm |
|---|---|---|---|---|
| BlVN | Coat protein CDS | Lu3103 F | TTGCCAAGAGCTTCACCAGGA | 60 |
| Lu3202 R | TTGCCTGCGTACAACATCCA | |||
| BlVM/M-2 | Coat protein CDS | LuM2918 F | GCCAACGATAAAGGTGACATCCGGTT | 64.7 |
| LuM3054 R | TCGAGCTGGCATTAGTCACGTACG | |||
| BlVN and BlVM/M-2 | 3′UTR | Lu4472 F | AGTTCGAAACTCGGGGTTTGTCAAGC | 63.4 |
| Lu5034 R | ACGATCGTAGATACTGCATCCCCA |
| Blueberry Luteovirus | ORFs | % Nucleotide Sequence Similarity/Identity | ||
|---|---|---|---|---|
| Blueberry Virus L | Blueberry Virus M | Blueberry Virus M-2 | ||
| Blueberry virus N | Genome | 64.2 | 84.3 | 84.3 |
| ORF1 | 66.9 | 81.6 | 82.0 | |
| ORF2 | 77.3 | 90.8 | 90.8 | |
| ORF1-2 | 73.2 | 87.2 | 87.3 | |
| ORF3 (CP) | 62.4 | 82.0 | 82.3 | |
| ORF3-5 | 62.4 | 84.0 | 84.0 | |
| ORF5 | 62.4 | 85.2 | 85.0 | |
| Blueberry virus M-2 | Genome | 63.6 | 96.8 | |
| ORF1 | 66.4 | 93.4 | ||
| ORF2 | 76.8 | 96.6 | ||
| ORF1-2 | 72.7 | 95.3 | ||
| ORF3 (CP) | 61.7 | 96.8 | ||
| ORF3-5 | 62.1 | 98.2 | ||
| % amino acid sequence similarity | ||||
| ORF1 | 66.7 | 87.7 | 88.3 | |
| Blueberry virus N | ORF1-2 | 77.6 | 92.8 | 93.0 |
| ORF3 (CP) | 58.9 | 82.8 | 82.8 | |
| ORF3-5 | 57.7 | 83.8 | 84.4 | |
| ORF1 | 67.0 | 97.0 | ||
| Blueberry virus M-2 | ORF1-2 | 76.8 | 98.5 | |
| ORF3 (CP) | 60.5 | 98.6 | ||
| ORF3-5 | 59.0 | 98.6 | ||
| Nearest City | Plant Type | Number of Plants Tested | Luteovirus Positives | % Positives |
|---|---|---|---|---|
| Abbotsford | Diseased | 46 | 40 | 87 |
| Aldergrove | Diseased | 3 | 3 | 100 |
| Chilliwack | Diseased | 20 | 20 | 100 |
| Delta | Diseased | 39 | 35 | 89.7 |
| Langley | Diseased | 28 | 27 | 96.4 |
| Maple Ridge | Diseased | 7 | 6 | 85.7 |
| Pitt Meadows | Diseased | 40 | 34 | 85 |
| Surrey | Diseased | 30 | 29 | 96.7 |
| Commercial fields | Healthy | 14 | 7 | 50 |
| Nursery varieties | Healthy | 14 | 4 | 28.6 |
| Nearest City | Number of Plants Tested | BlVN, BlVM/M-2 Positives | BlVL Positives |
|---|---|---|---|
| Abbotsford | 64 | 60 | 63 |
| Aldergrove | 2 | 2 | 2 |
| Chilliwack | 32 | 29 | 30 |
| Delta | 8 | 6 | 8 |
| Langley | 10 | 10 | 9 |
| Mission | 6 | 5 | 5 |
| Pitt Meadows | 2 | 1 | 2 |
| Vancouver Island | 10 | 9 | 10 |
| Surrey | 19 | 16 | 17 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2025 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Kannangara, S.; Gilewski, A.; Rodriguez Lopez, J.; de Villiers, G.; Ellis, M.; Ellis, P.; Gerbrandt, E.; Mattsson, J. Characterization of Novel Luteoviruses in Canadian Highbush Blueberries Using High-Throughput Sequencing. Viruses 2025, 17, 1286. https://doi.org/10.3390/v17101286
Kannangara S, Gilewski A, Rodriguez Lopez J, de Villiers G, Ellis M, Ellis P, Gerbrandt E, Mattsson J. Characterization of Novel Luteoviruses in Canadian Highbush Blueberries Using High-Throughput Sequencing. Viruses. 2025; 17(10):1286. https://doi.org/10.3390/v17101286
Chicago/Turabian StyleKannangara, Sachithrani, Adam Gilewski, Juan Rodriguez Lopez, Gertruida de Villiers, Meghan Ellis, Peter Ellis, Eric Gerbrandt, and Jim Mattsson. 2025. "Characterization of Novel Luteoviruses in Canadian Highbush Blueberries Using High-Throughput Sequencing" Viruses 17, no. 10: 1286. https://doi.org/10.3390/v17101286
APA StyleKannangara, S., Gilewski, A., Rodriguez Lopez, J., de Villiers, G., Ellis, M., Ellis, P., Gerbrandt, E., & Mattsson, J. (2025). Characterization of Novel Luteoviruses in Canadian Highbush Blueberries Using High-Throughput Sequencing. Viruses, 17(10), 1286. https://doi.org/10.3390/v17101286

