Dufulin Impacts Plant Defense Against Tomato Yellow Leaf Curl Virus Infecting Tomato
Abstract
:1. Introduction
2. Materials and Methods
2.1. Field Control Effect of Dufulin on TYLCV
2.2. TYLCV Infection Rates in Tomato Plants of Disease Symptoms on the Field
2.3. TYLCV Titer from the Field Experiment with TAS-ELISA
2.4. Effects of Dufulin on SAR-Related Gene Expression and Tomato Leaves’ Nutrition
2.5. Data Analysis
3. Results
3.1. TYLCV Infection Rates in Tomato Plants
3.2. Field Control Effect of Dufulin and TYLCV Titer in Tomato Plants
3.3. Change in PI II and NPR1 Gene Expression in Tomato Plants
3.4. Change in Chlorophyll and Nitrogen Content in Tomato Plants
4. Discussion
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Ghanim, M.; Morin, S.; Zeidan, M.; Czosnek, H. Evidence for transovarial transmission of tomato yellow leaf curl virus by its vector, the whitefly Bemisia tabaci. Virology 1998, 240, 295–303. [Google Scholar] [CrossRef]
- Moriones, E.; Navas-Castillo, J. Tomato yellow leaf curl virus, an emerging virus complex causing epidemics worldwide. Virus Res. 2000, 71, 123–134. [Google Scholar] [CrossRef]
- Shalev, A.H.; Sobol, I.; Ghanim, M.; Liu, S.S.; Czosnek, H. The whitefly Bemisia tabaci knottin-1 gene is implicated in regulating the quantity of tomato yellow leaf curl virus ingested and transmitted by the insect. Viruses 2016, 8, 205. [Google Scholar] [CrossRef] [PubMed]
- Papayiannis, L.C.; Katis, N.I.; Idris, A.M.; Brown, J.K. Identification of weed hosts of tomato yellow leaf curl virus in Cyprus. Plant Dis. 2011, 95, 120–125. [Google Scholar] [CrossRef]
- Xie, Y.; Jiao, X.; Zhou, X.; Liu, H.; Ni, Y.; Wu, J. Highly sensitive serological methods for detecting tomato yellow leaf curl virus in tomato plants and whiteflies. Virol J. 2013, 10, 142. [Google Scholar] [CrossRef] [PubMed]
- Morilla, G.; Janssen, D.; García-Andrés, S.; Moriones, E.; Cuadrado, I.M.; Bejarano, E.R. Pepper (Capsicum annuum) is a dead-end host for tomato yellow leaf curl virus. Phytopathology 2005, 95, 1089–1097. [Google Scholar] [CrossRef] [PubMed]
- Navas-Castillo, J.; Sánchez-Campos, S.; Díaz, J.A.; Sáez-Alonso, E.; Moriones, E. Tomato yellow leaf curl virus-Is causes a novel disease of common bean and severe epidemics in tomato in Spain. Plant Dis. 1999, 83, 29–32. [Google Scholar] [CrossRef]
- Anfoka, G.; Haj Ahmad, F.; Abhary, M.; Hussein, A. Detection and molecular characterization of viruses associated with tomato yellow leaf curl disease in cucurbit crops in Jordan. Plant Pathol. 2009, 58, 754–762. [Google Scholar] [CrossRef]
- Prasad, A.; Sharma, N.; Hari-Gowthem, G.; Muthamilarasan, M.; Prasad, M. Tomato yellow leaf curl virus: Impact, challenges, and management. Trends Plant Sci. 2020, 25, 897–911. [Google Scholar] [CrossRef]
- Camara, M.; Mbaye, A.A.; Noba, K.; Samb, P.I.; Diao, S.; Cilas, C. Field screening of tomato genotypes for resistance to tomato yellow leaf curl virus (TYLCV) disease in Senegal. Crop Prot. 2013, 44, 59–65. [Google Scholar] [CrossRef]
- El-Sappah, A.H.; Qi, S.; Soaud, S.A.; Huang, Q.; Saleh, A.M.; Abourehab, M.A.S.; Wan, L.; Cheng, G.; Liu, J.; Ihtisham, M.; et al. Natural resistance of tomato plants to tomato yellow leaf curl virus. Front. Plant Sci. 2022, 13, 1081549. [Google Scholar] [CrossRef] [PubMed]
- Abdallat, A.M.A.; Debei, H.S.A.; Asmar, H.; Misbeh, S.; Quraan, A.; Kvarnheden, A. An efficient in vitro-inoculation method for tomato yellow leaf curl virus. Virol. J. 2010, 7, 84. [Google Scholar] [CrossRef]
- Ong, S.N.; Taheri, S.; Othman, R.Y.; Teo, C.H. Viral disease of tomato crops (Solanum Lycopesicum L.): An overview. J. Plant Dis. Prot. 2020, 127, 725–739. [Google Scholar] [CrossRef]
- Loha, K.M.; Lamoree, M.; Weiss, J.M.; De Boer, J. Import, disposal, and health impacts of pesticides in the East Africa Rift (EAR) zone: A review on management and policy analysis. Crop Prot. 2018, 112, 322–331. [Google Scholar] [CrossRef]
- Xu, Y.; Yan, K.; Song, B.; Xu, G.; Yang, S.; Xue, W.; Hu, D.; Lu, P.; Ouyang, G.; Jin, L.; et al. Synthesis and antiviral bioactivities of α-aminophosphonates containing alkoxyethyl moieties. Molecules 2006, 11, 666–676. [Google Scholar] [CrossRef]
- Hu, D.Y.; Wan, Q.Q.; Yang, S.; Song, B.A.; Bhadury, P.S.; Jin, L.H.; Yan, K.; Liu, F.; Chen, Z.; Xue, W. Synthesis and antiviral activities of amide derivatives containing the α-aminophosphonate moiety. J. Agric. Food Chem. 2008, 56, 998–1001. [Google Scholar] [CrossRef]
- Long, N.; Cai, X.J.; Song, B.A.; Yang, S.; Chen, Z.; Bhadury, P.S.; Hu, D.Y.; Jin, L.H.; Xue, W. Synthesis and antiviral activities of cyanoacrylate derivatives containing an α-aminophosphonate moiety. J. Agric. Food Chem. 2008, 56, 5242–5246. [Google Scholar] [CrossRef] [PubMed]
- Qian, X.; Lee, P.W.; Cao, S. China: Forward to the green pesticides via a basic research program. J. Agric. Food Chem. 2010, 58, 2613–2623. [Google Scholar] [CrossRef] [PubMed]
- Song, B.; Jin, L.; Yang, S.; Bhadury, P.S. Environment-Friendly Antiviral Agents for Plants; Springer: Berlin/Heidelberg, Germany, 2010; ISBN 978-3-642-03691-0. [Google Scholar]
- Yu, D.; Wang, Z.; Liu, J.; Lv, M.; Liu, J.; Li, X.; Chen, Z.; Jin, L.; Hu, D.; Yang, S.; et al. Screening anti-southern rice black-streaked dwarf virus drugs based on S7-1 gene expression in rice suspension cells. J. Agric. Food Chem. 2013, 61, 8049–8055. [Google Scholar] [CrossRef]
- Li, X.; Liu, J.; Yang, X.; Ding, Y.; Wu, J.; Hu, D.; Song, B. Studies of binding interactions between dufulin and southern rice black-streaked dwarf virus P9-1. Bioorg. Med. Chem. 2015, 23, 3629–3637. [Google Scholar] [CrossRef]
- Wang, D.; Xie, X.; Gao, D.; Chen, K.; Chen, Z.; Jin, L.; Li, X.; Song, B. Dufulin intervenes the viroplasmic proteins as the mechanism of action against southern rice black-streaked dwarf virus. J. Agric. Food Chem. 2019, 67, 11380–11387. [Google Scholar] [CrossRef] [PubMed]
- Li, Y.; Lu, P.; Hu, D.; Bhadury, P.S.; Zhang, Y.; Zhang, K. Determination of dufulin residue in vegetables, rice, and tobacco using liquid chromatography with tandem mass spectrometry. J. AOAC Int. 2015, 98, 1739–1744. [Google Scholar] [CrossRef]
- Li, J.; Lu, P.; Hu, D.; Wang, S.; Zhang, Q.; Yu, Y.; Zeng, S. Stereoselective bioaccumulation of water and soil-associated dufulin enantiomers in Tubifex. J. Agric. Food Chem. 2017, 65, 8569–8577. [Google Scholar] [CrossRef] [PubMed]
- Chen, Z.; Zeng, M.; Song, B.; Hou, C.; Hu, D.; Li, X.; Wang, Z.; Fan, H.; Bi, L.; Liu, J.; et al. Dufulin activates HrBP1 to produce antiviral responses in tobacco. PLoS ONE 2012, 7, e37944. [Google Scholar] [CrossRef] [PubMed]
- Johnson, R.; Narvaez, J.; An, G.; Ryan, C. Expression of proteinase inhibitors I and II in transgenic tobacco plants: Effects on natural defense against Manduca sexta larvae. Proc. Natl. Acad. Sci. USA 1989, 86, 9871–9875. [Google Scholar] [CrossRef]
- Thaler, J.S.; Fidantsef, A.L.; Duffey, S.S.; Bostock, R.M. Trade-offs in plant defense against pathogens and herbivores: A field demonstration of chemical elicitors of induced resistance. J. Chem. Ecol. 1999, 25, 1597–1609. [Google Scholar] [CrossRef]
- Uquillas, C.; Letelier, I.; Blanco, F.; Jordana, X.; Holuigue, L. NPR1-independent activation of immediate early salicylic acid-responsive genes in Arabidopsis. MPMI 2004, 17, 34–42. [Google Scholar] [CrossRef]
- Backer, R.; Naidoo, S.; Van Den Berg, N. The nonexpressor of pathogenesis-related genes 1 (NPR1) and related family: Mechanistic insights in plant disease resistance. Front. Plant Sci. 2019, 10, 102. [Google Scholar] [CrossRef] [PubMed]
- Picó, B.; Díez, J.; Nuez, F. Evaluation of whitefly-mediated inoculation techniques to screen Lycopersicon esculentum and wild relatives for resistance to tomato yellow leaf curl virus. Euphytica 1998, 101, 259–271. [Google Scholar] [CrossRef]
- Lapidot, M.; Friedmann, M. Breeding for resistance to whitefly-transmitted geminiviruses. Ann. appl. Biol. 2002, 140, 109–127. [Google Scholar] [CrossRef]
- Wu, J.; Meng, C.; Shang, H.; Rong, S.; Zhang, C.; Hong, J.; Zhou, X. Monoclonal antibody-based triple antibody sandwich-enzyme-linked immunosorbent assay and immunocapture reverse transcription-polymerase chain reaction for odontoglossum ringspot virus detection. J. Virol. Methods 2011, 171, 40–45. [Google Scholar] [CrossRef] [PubMed]
- Wu, J.; Shang, H.; Xie, Y.; Shen, Q.; Zhou, X. Monoclonal antibodies against the whitefly-transmitted tomato yellow leaf curl virus and their application in virus detection. J. Integr. Agric. 2012, 11, 263–268. [Google Scholar] [CrossRef]
- Ning, W.; Shi, X.; Liu, B.; Pan, H.; Wei, W.; Zeng, Y.; Sun, X.; Xie, W.; Wang, S.; Wu, Q.; et al. Transmission of tomato yellow leaf curl virus by Bemisia tabaci as affected by whitefly sex and biotype. Sci. Rep. 2015, 5, 10744. [Google Scholar] [CrossRef]
- Livak, K.J.; Schmittgen, T.D. Analysis of relative gene expression data using real-time quantitative PCR and the 2−ΔΔCT method. Methods 2001, 25, 402–408. [Google Scholar] [CrossRef] [PubMed]
- Mascia, T.; Santovito, E.; Gallitelli, D.; Cillo, F. Evaluation of reference genes for quantitative reverse-transcription polymerase chain reaction normalization in infected tomato plants. Mol. Plant Pathol. 2010, 11, 805–816. [Google Scholar] [CrossRef] [PubMed]
- Chen, H.; Zhou, X.; Song, B. Toxicokinetics, tissue distribution, and excretion of dufulin racemate and its R (S)-enantiomers in rats. J. Agric. Food Chem. 2018, 66, 7265–7274. [Google Scholar] [CrossRef] [PubMed]
- Mou, Z.; Fan, W.; Dong, X. Inducers of plant systemic acquired resistance regulate NPR1 function through redox changes. Cell 2003, 113, 935–944. [Google Scholar] [CrossRef] [PubMed]
- Tada, Y.; Spoel, S.H.; Pajerowska-Mukhtar, K.; Mou, Z.; Song, J.; Wang, C.; Zuo, J.; Dong, X. Plant immunity requires conformational charges [corrected] of NPR1 via S-nitrosylation and thioredoxins. Science 2008, 321, 952–956. [Google Scholar] [CrossRef] [PubMed]
- Cao, H.; Li, X.; Dong, X. Generation of broad-spectrum disease resistance by overexpression of an essential regulatory gene in systemic acquired resistance. Proc. Natl. Acad. Sci. USA 1998, 95, 6531–6536. [Google Scholar] [CrossRef]
- Zhao, S.; Li, M.; Ren, X.; Wang, C.; Sun, X.; Sun, M.; Yu, X.; Wang, X. Enhancement of broad-spectrum disease resistance in wheat through key genes involved in systemic acquired resistance. Front. Plant Sci. 2024, 15, 1355178. [Google Scholar] [CrossRef]
- Aoki, K.; Yano, K.; Suzuki, A.; Kawamura, S.; Sakurai, N.; Suda, K.; Kurabayashi, A.; Suzuki, T.; Tsugane, T.; Watanabe, M.; et al. Large-scale analysis of full-length cDNAs from the tomato (Solanum lycopersicum) cultivar Micro-Tom, a reference system for the Solanaceae genomics. BMC Genom. 2010, 11, 210. [Google Scholar] [CrossRef] [PubMed]
- Farmer, E.E.; Johnson, R.R.; Ryan, C.A. Regulation of expression of proteinase inhibitor genes by methyl jasmonate and jasmonic acid. Plant Physiol. 1992, 98, 995–1002. [Google Scholar] [CrossRef]
- Zhang, H.; Xie, X.; Xu, Y.; Wu, N. Isolation and functional assessment of a tomato proteinase inhibitor II gene. Plant Physiol. Biochem. 2004, 42, 437–444. [Google Scholar] [CrossRef] [PubMed]
- Zarate, S.I.; Kempema, L.A.; Walling, L.L. Silverleaf whitefly induces salicylic acid defenses and suppresses effectual jasmonic acid defenses. Plant Physiol. 2007, 143, 866–875. [Google Scholar] [CrossRef] [PubMed]
- Oirdi, M.E.; Rahman, T.A.E.; Rigano, L.; Hadrami, A.E.; Rodriguez, M.C.; Daayf, F.; Vojnov, A.; Bouarab, K. Botrytis cinerea manipulates the antagonistic effects between immune pathways to promote disease development in tomato. Plant Cell 2011, 23, 2405–2421. [Google Scholar] [CrossRef]
- Vleesschauwer, D.D.; Xu, J.; Höfte, M. Making sense of hormone-mediated defense networking: From rice to Arabidopsis. Front. Plant Sci. 2014, 5, 611. [Google Scholar] [CrossRef] [PubMed]
- Caarls, L.; Pieterse, C.M.J.; Van Wees, S.C.M. How salicylic acid takes transcriptional control over jasmonic acid signaling. Front. Plant Sci. 2015, 6, 170. [Google Scholar] [CrossRef]
- Zhang, P.J.; He, Y.C.; Zhao, C.; Ye, Z.H.; Yu, X.P. Jasmonic acid-dependent defenses play a key role in defending tomato against Bemisia tabaci nymphs, but not adults. Front. Plant Sci. 2018, 9, 1065. [Google Scholar] [CrossRef] [PubMed]
- Cui, H.; Sun, Y.; Chen, F.; Zhang, Y.; Ge, F. Elevated O3 and TYLCV infection reduce the suitability of tomato as a host for the whitefly Bemisia tabaci. Int. J. Mol. Sci. 2016, 17, 1964. [Google Scholar] [CrossRef]
- Marc, S. Chlorophyll content of tomato yellow leaf curl virus-infected tomatoes in relation to virus resistance. Phytoparasitica 1975, 3, 141–144. [Google Scholar] [CrossRef]
- Menesatti, P.; Antonucci, F.; Pallottino, F.; Roccuzzo, G.; Allegra, M.; Stagno, F.; Intrigliolo, F. Estimation of plant nutritional status by Vis-NIR spectrophotometric analysis on orange leaves [Citrus sinensis (L) Osbeck cv. Tarocco]. Biosyst. Eng. 2010, 105, 448–454. [Google Scholar] [CrossRef]
- Fiorentini, M.; Zenobi, S.; Giorgini, E.; Basili, D.; Conti, C.; Pro, C.; Monaci, E.; Orsini, R. Nitrogen and chlorophyll status determination in durum wheat as influenced by fertilization and soil management: Preliminary results. PLoS ONE 2019, 14, e0225126. [Google Scholar] [CrossRef]
Names | GenBank Accession No. | Primer Sequence (5′-3′) * |
---|---|---|
TYLCV | KY499720.1 | F: GTTCACGGATTTCGTTGTATG |
R: AGAGGGACTGGCAAAGCAACA | ||
ACT | BT013707 | F: AGGCAGGATTTGCTGGTGATGATGCT |
R: ATACGCATCCTTCTGTCCCATTCCGA | ||
UBI | X58253 | F: TCGTAAGGAGTGCCCTAATGCTGA |
R: CAATCGCCTCCAGCCTTGTTGTAA | ||
PI II | K03291.1 | F: CCTATTCAAGATGTCCCCGTTC |
R: GGGCAATCCAGAAGATGG | ||
NPR1 | AY640378.1 | F: ATATAGAATTCCTGCTCCAAAGGATCGGTTA |
R: ATATACTCGAGCAGACAAGTCATCAGCATCCA |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Huang, L.; Tang, Y.; Wang, S.; Chen, J.; Du, J.; Yan, S.; Zhang, D.; Shi, X.; Liu, Y.; Li, F. Dufulin Impacts Plant Defense Against Tomato Yellow Leaf Curl Virus Infecting Tomato. Viruses 2025, 17, 53. https://doi.org/10.3390/v17010053
Huang L, Tang Y, Wang S, Chen J, Du J, Yan S, Zhang D, Shi X, Liu Y, Li F. Dufulin Impacts Plant Defense Against Tomato Yellow Leaf Curl Virus Infecting Tomato. Viruses. 2025; 17(1):53. https://doi.org/10.3390/v17010053
Chicago/Turabian StyleHuang, Liping, Yingying Tang, Shuaixin Wang, Jianbin Chen, Jiao Du, Shuo Yan, Deyong Zhang, Xiaobin Shi, Yong Liu, and Fan Li. 2025. "Dufulin Impacts Plant Defense Against Tomato Yellow Leaf Curl Virus Infecting Tomato" Viruses 17, no. 1: 53. https://doi.org/10.3390/v17010053
APA StyleHuang, L., Tang, Y., Wang, S., Chen, J., Du, J., Yan, S., Zhang, D., Shi, X., Liu, Y., & Li, F. (2025). Dufulin Impacts Plant Defense Against Tomato Yellow Leaf Curl Virus Infecting Tomato. Viruses, 17(1), 53. https://doi.org/10.3390/v17010053