The Autonomous Fusion Activity of Human Cytomegalovirus Glycoprotein B Is Regulated by Its Carboxy-Terminal Domain
Abstract
1. Introduction
2. Materials and Methods
2.1. Oligonucleotides and Expression Constructs
2.2. Antibodies
2.3. Cell Culture
2.4. Dual Split Protein Cell Membrane Fusion Assay (DSP Assay)
2.5. cELISA
2.6. Indirect Immunofluorescence Analysis
2.7. Western Blotting
2.8. In Silico Analysis of CTD Sequence and Structure
2.9. Statistical Analysis
3. Results
3.1. Generation of Truncation Mutants within the HCMV gB CTD
3.2. Truncation of the CTD Results in Autonomously Fusion-Active gB Variants
3.3. Cellular Localization, Expression Level, and Cell Surface Exposure of the gB CTD Mutants
3.4. Blocking gB-Induced Cell–Cell Fusion by Anti-gB Antibodies
3.5. C-Terminal Determinants of Regulating gB-Induced Fusion
4. Discussion
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Manicklal, S.; Emery, V.C.; Lazzarotto, T.; Boppana, S.B.; Gupta, R.K. The “Silent” Global Burden of Congenital Cytomegalovirus. Clin. Microbiol. Rev. 2013, 26, 86–102. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Dreher, A.M.; Arora, N.; Fowler, K.B.; Novak, Z.; Britt, W.J.; Boppana, S.B.; Ross, S.A. Spectrum of Disease and Outcome in Children with Symptomatic Congenital Cytomegalovirus Infection. J. Pediatr. 2014, 164, 855–859. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Teira, P.; Battiwalla, M.; Ramanathan, M.; Barrett, A.J.; Ahn, K.W.; Chen, M.; Green, J.S.; Saad, A.; Antin, J.H.; Savani, B.N.; et al. Early cytomegalovirus reactivation remains associated with increased transplant-related mortality in the current era: A CIBMTR analysis. Blood 2016, 127, 2427–2438. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Ramanan, P.; Razonable, R.R. Cytomegalovirus Infections in Solid Organ Transplantation: A Review. Infect. Chemother. 2013, 45, 260. [Google Scholar] [CrossRef] [Scilit]
- Chou, S. Approach to drug-resistant cytomegalovirus in transplant recipients. Curr. Opin. Infect. Dis. 2015, 28, 293–299. [Google Scholar] [CrossRef] [Scilit]
- Arvin, A.M.; Fast, P.; Myers, M.; Plotkin, S.; Rabinovich, R. Vaccine development to prevent cytomegalovirus disease: Report from the National Vaccine Advisory Committee. Clin. Infect. Dis. 2004, 39, 233–239. [Google Scholar] [CrossRef] [Scilit]
- Navarro, D.; Paz, P.; Tugizov, S.; Topp, K.; La Vail, J.; Pereira, L. Glycoprotein B of human cytomegalovirus promotes virion penetration into cells, transmission of infection from cell to cell, and fusion of infected cells. Virology 1993, 197, 143–158. [Google Scholar] [CrossRef] [Scilit]
- Schoppel, K.; Kropff, B.; Schmidt, C.; Vornhagen, R.; Mach, M. The humoral immune response against human cytomegalovirus is characterized by a delayed synthesis of glycoprotein-specific antibodies. J. Infect. Dis. 1997, 175, 533–544. [Google Scholar] [CrossRef] [Scilit]
- Britt, W.J.; Vugler, L.; Butfiloski, E.J.; Stephens, E.B. Cell surface expression of human cytomegalovirus (HCMV) gp55-116 (gB): Use of HCMV-recombinant vaccinia virus-infected cells in analysis of the human neutralizing antibody response. J. Virol. 1990, 64, 1079–1085. [Google Scholar] [CrossRef] [Scilit]
- Marshall, G.S.; Rabalais, G.P.; Stout, G.G.; Waldeyer, S.L. Antibodies to recombinant-derived glycoprotein B after natural human cytomegalovirus infection correlate with neutralizing activity. J. Infect. Dis. 1992, 165, 381–384. [Google Scholar] [CrossRef] [Scilit]
- Pass, R.F.; Zhang, C.; Evans, A.; Simpson, T.; Andrews, W.; Huang, M.L.; Corey, L.; Hill, J.; Davis, E.; Flanigan, C.; et al. Vaccine prevention of maternal cytomegalovirus infection. N. Engl. J. Med. 2009, 360, 1191–1199. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Bernstein, D.I.; Munoz, F.M.; Callahan, S.T.; Rupp, R.; Wootton, S.H.; Edwards, K.M.; Turley, C.B.; Stanberry, L.R.; Patel, S.M.; Mcneal, M.M.; et al. Safety and efficacy of a cytomegalovirus glycoprotein B (gB) vaccine in adolescent girls: A randomized clinical trial. Vaccine 2016, 34, 313–319. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Griffiths, P.D.; Stanton, A.; McCarrell, E.; Smith, C.; Osman, M.; Harber, M.; Davenport, A.; Jones, G.; Wheeler, D.C.; OBeirne, J.; et al. Cytomegalovirus glycoprotein-B vaccine with MF59 adjuvant in transplant recipients: A phase 2 randomised placebo-controlled trial. Lancet 2011, 377, 1256–1263. [Google Scholar] [CrossRef] [Scilit]
- Nelson, C.S.; Huffman, T.; Jenks, J.A.; Cisneros de la Rosa, E.; Xie, G.; Vandergrift, N.; Pass, R.F.; Pollara, J.; Permar, S.R. HCMV glycoprotein B subunit vaccine efficacy mediated by nonneutralizing antibody effector functions. Proc. Natl. Acad. Sci. USA 2018, 115, 6267–6272. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Baraniak, I.; Kropff, B.; Ambrose, L.; McIntosh, M.; McLean, G.R.; Pichon, S.; Atkinson, C.; Milne, R.S.B.; Mach, M.; Griffiths, P.D.; et al. Protection from cytomegalovirus viremia following glycoprotein B vaccination is not dependent on neutralizing antibodies. Proc. Natl. Acad. Sci. USA 2018, 115, 6273–6278. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Cui, X.; Meza, B.P.; Adler, S.P.; McVoy, M.A. Cytomegalovirus vaccines fail to induce epithelial entry neutralizing antibodies comparable to natural infection. Vaccine 2008, 26, 5760–5766. [Google Scholar] [CrossRef] [Scilit]
- Cardin, R.D.; Bravo, F.J.; Pullum, D.A.; Orlinger, K.; Watson, E.M.; Aspoeck, A.; Fuhrmann, G.; Guirakhoo, F.; Monath, T.; Bernstein, D.I. Replication-defective lymphocytic choriomeningitis virus vectors expressing guinea pig cytomegalovirus gB and pp65 homologs are protective against congenital guinea pig cytomegalovirus infection. Vaccine 2016, 34, 1993–1999. [Google Scholar] [CrossRef] [Scilit]
- Schleiss, M.R.; Choi, K.Y.; Anderson, J.; Mash, J.G.; Wettendorff, M.; Mossman, S.; Van Damme, M. Glycoprotein B (gB) vaccines adjuvanted with AS01 or AS02 protect female guinea pigs against cytomegalovirus (CMV) viremia and offspring mortality in a CMV-challenge model. Vaccine 2014, 32, 2756–2762. [Google Scholar] [CrossRef] [Scilit]
- Chatterjee, A.; Harrison, C.J.; Britt, W.J.; Bewtra, C. Modification of maternal and congenital cytomegalovirus infection by anti-glycoprotein b antibody transfer in guinea pigs. J. Infect. Dis. 2001, 183, 1547–1553. [Google Scholar] [CrossRef] [Scilit]
- Kirchmeier, M.; Fluckiger, A.C.; Soare, C.; Bozic, J.; Ontsouka, B.; Ahmed, T.; Diress, A.; Pereira, L.; Schodel, F.; Plotkin, S.; et al. Enveloped virus-like particle expression of human cytomegalovirus glycoprotein B antigen induces antibodies with potent and broad neutralizing activity. Clin. Vaccine Immunol. 2014, 21, 174–180. [Google Scholar] [CrossRef] [Scilit]
- Cui, X.; Cao, Z.; Wang, S.; Lee, R.B.; Wang, X.; Murata, H.; Adler, S.P.; McVoy, M.A.; Snapper, C.M. Novel trimeric human cytomegalovirus glycoprotein B elicits a high-titer neutralizing antibody response. Vaccine 2018, 36, 5580–5590. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Liu, Y.; Heim, K.P.; Che, Y.; Chi, X.; Qiu, X.; Han, S.; Dormitzer, P.R.; Yang, X. Prefusion structure of human cytomegalovirus glycoprotein B and structural basis for membrane fusion. Sci. Adv. 2021, 7, eabf3178. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Vanarsdall, A.L.; Ryckman, B.J.; Chase, M.C.; Johnson, D.C. Human cytomegalovirus glycoproteins gB and gH/gL mediate epithelial cell-cell fusion when expressed either in cis or in trans. J. Virol. 2008, 82, 11837–11850. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Gonzalez-Del Pino, G.L.; Heldwein, E.E. Well Put Together-A Guide to Accessorizing with the Herpesvirus gH/gL Complexes. Viruses 2022, 14, 296. [Google Scholar] [CrossRef] [Scilit]
- Zhong, L.; Zhang, W.; Krummenacher, C.; Chen, Y.; Zheng, Q.; Zhao, Q.; Zeng, M.-S.; Xia, N.; Zeng, Y.-X.; Xu, M.; et al. Targeting herpesvirus entry complex and fusogen glycoproteins with prophylactic and therapeutic agents. Trends Microbiol. 2023, 31, 788–804. [Google Scholar] [CrossRef] [Scilit]
- Baquero, E.; Albertini, A.A.V.; Gaudin, Y. Recent mechanistic and structural insights on class III viral fusion glycoproteins. Curr. Opin. Struct. Biol. 2015, 33, 52–60. [Google Scholar] [CrossRef] [Scilit]
- Burke, H.G.; Heldwein, E.E. Crystal Structure of the Human Cytomegalovirus Glycoprotein B. PLoS Pathog. 2015, 11, e1005227. [Google Scholar] [CrossRef] [Scilit]
- Sharma, S.; Wisner, T.W.; Johnson, D.C.; Heldwein, E.E. HCMV gB shares structural and functional properties with gB proteins from other herpesviruses. Virology 2013, 435, 239–249. [Google Scholar] [CrossRef] [Scilit]
- Kniess, N.; Mach, M.; Fay, J.; Britt, W.J. Distribution of linear antigenic sites on glycoprotein gp55 of human cytomegalovirus. J. Virol. 1991, 65, 138–146. [Google Scholar] [CrossRef] [Scilit]
- Potzsch, S.; Spindler, N.; Wiegers, A.K.; Fisch, T.; Rucker, P.; Sticht, H.; Grieb, N.; Baroti, T.; Weisel, F.; Stamminger, T.; et al. B cell repertoire analysis identifies new antigenic domains on glycoprotein B of human cytomegalovirus which are target of neutralizing antibodies. PLoS Pathog. 2011, 7, e1002172. [Google Scholar] [CrossRef] [Scilit]
- Gomes, A.C.; Baraniak, I.A.; Lankina, A.; Moulder, Z.; Holenya, P.; Atkinson, C.; Tang, G.; Mahungu, T.; Kern, F.; Griffiths, P.D.; et al. The cytomegalovirus gB/MF59 vaccine can-didate induces antibodies against an anti-genic domain controlling cell-to-cell spread. Nat. Commun. 2023, 14, 1041. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Reuter, N.; Kropff, B.; Schneiderbanger, J.K.; Alt, M.; Krawczyk, A.; Sinzger, C.; Winkler, T.H.; Britt, W.J.; Mach, M.; Thomas, M. Cell Fusion Induced by a Fusion-Active Form of Human Cytomegalovirus Glycoprotein B (gB) Is Inhibited by Antibodies Directed at Antigenic Domain 5 in the Ectodomain of gB. J. Virol. 2020, 94. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Vanarsdall, A.L.; Johnson, D.C. Human cytomegalovirus entry into cells. Curr. Opin. Virol. 2012, 2, 37–42. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Reuter, N.; Chen, X.; Kropff, B.; Peter, A.S.; Britt, W.J.; Mach, M.; Überla, K.; Thomas, M. SARS-CoV-2 Spike Protein Is Capable of Inducing Cell-Cell Fusions Independent from Its Receptor ACE2 and This Activity Can Be Impaired by Furin Inhibitors or a Subset of Monoclonal Antibodies. Viruses 2023, 15, 1500. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Meyer, H.; Masuho, Y.; Mach, M. The gp116 of the gp58/116 complex of human cytomegalovirus represents the amino-terminal part of the precursor molecule and contains a neutralizing epitope. J. Gen. Virol. 1990, 71, 2443–2450. [Google Scholar] [CrossRef] [Scilit]
- Wiegers, A.K.; Sticht, H.; Winkler, T.H.; Britt, W.; Mach, M. Identification of a neutralizing epitope within antigenic domain 5 of glycoprotein B of human cytomegalovirus. J. Virol. 2014, 89. [Google Scholar] [CrossRef] [Scilit]
- Spindler, N.; Diestel, U.; Stump, J.D.; Wiegers, A.K.; Winkler, T.H.; Sticht, H.; Mach, M.; Muller, Y.A. Structural Basis for the Recognition of Human Cytomegalovirus Glycoprotein B by a Neutralizing Human Antibody. PLoS Pathog. 2014, 10, e1004377. [Google Scholar] [CrossRef] [Scilit]
- Wagner, B.; Kropff, B.; Kalbacher, H.; Britt, W.; Sundqvist, V.A.; Ostberg, L.; Mach, M. A continuous sequence of more than 70 amino acids is essential for antibody binding to the dominant antigenic site of glycoprotein gp58 of human cytomegalovirus. J. Virol. 1992, 66, 5290–5297. [Google Scholar] [CrossRef] [Scilit]
- Britt, W.J.; Vugler’, L.G. Oligomerization of the human cytomegalovirus major envelope glycoprotein complex gB (gp55-116). J. Virol. 1992, 66, 6747–6754. [Google Scholar] [CrossRef] [Scilit]
- Schoppel, K.; Hassfurther, E.; Britt, W.; Ohlin, M.; Borrebaeck, C.A.; Mach, M. Antibodies specific for the antigenic domain 1 of glycoprotein B (gpUL55) of human cytomegalovirus bind to different substructures. Virology 1996, 216, 133–145. [Google Scholar] [CrossRef] [Scilit]
- Urban, M.; Britt, W.; Mach, M. The dominant linear neutralizing antibody-binding site of glycoprotein gp86 of human cytomegalovirus is strain specific. J. Virol. 1992, 66, 1303–1311. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Madeira, F.; Madhusoodanan, N.; Lee, J.; Eusebi, A.; Niewielska, A.; Tivey, A.R.N.; Lopez, R.; Butcher, S. The EMBL-EBI Job Dispatcher sequence analysis tools framework in 2024. Nucleic Acids Res. 2024, 52, W521–W525. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Waterhouse, A.M.; Procter, J.B.; Martin, D.M.A.; Clamp, M.; Barton, G.J. Jalview Version 2—A multiple sequence alignment editor and analysis workbench. Bioinformatics 2009, 25, 1189–1191. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Jumper, J.; Evans, R.; Pritzel, A.; Green, T.; Figurnov, M.; Ronneberger, O.; Tunyasuvunakool, K.; Bates, R.; Žídek, A.; Potapenko, A.; et al. Highly accurate protein structure prediction with AlphaFold. Nature 2021, 596, 583. [Google Scholar] [CrossRef] [Scilit]
- Kumar, M.; Michael, S.; Alvarado-Valverde, J.; Mészáros, B.; Sámano-Sánchez, H.; Zeke, A.; Dobson, L.; Lazar, T.; Örd, M.; Nagpal, A.; et al. The Eukaryotic Linear Motif resource: 2022 release. Nucleic Acids Res. 2022, 50, D497–D508. [Google Scholar] [CrossRef] [Scilit]
- Drozdetskiy, A.; Cole, C.; Procter, J.; Barton, G.J. JPred4: A protein secondary structure prediction server. Nucleic Acids Res. 2015, 43, W389–W394. [Google Scholar] [CrossRef] [Scilit]
- Cooper, R.S.; Georgieva, E.R.; Borbat, P.P.; Freed, J.H.; Heldwein, E.E. Structural basis for membrane anchoring and fusion regulation of the herpes simplex virus fusogen gB. Nat. Struct. Mol. Biol. 2018, 25, 416–424. [Google Scholar] [CrossRef] [Scilit]
- Sinzger, C.; Bissinger, A.L.; Viebahn, R.; Oettle, H.; Radke, C.; Schmidt, C.A.; Jahn, G. Hepatocytes are Permissive for Human Cytomegalovirus Infection in Human Liver Cell Culture and In Vivo. J. Infect. Dis. 1999, 180, 976–986. [Google Scholar] [CrossRef] [Scilit]
- Diosi, P.; Babusceac, L.; Gherman, D. Cytophagia in Cell Cultures Infected with Cytomegalovirus. J. Infect. Dis. 1972, 125, 669–671. [Google Scholar] [CrossRef] [Scilit]
- Booth, J.C.; Beesley, J.E.; Stern, H. Syncytium formation caused by human cytomegalovirus in human embryonic lung fibroblasts. Arch. Virol. 1978, 57, 143–152. [Google Scholar] [CrossRef] [Scilit]
- Figueroa, M.E.; Geder, L.; Rapp, F. Infection of human amnion cells with cytomegalovirus. J. Med. Virol. 1978, 2, 369–375. [Google Scholar] [CrossRef] [Scilit]
- Adelman, J.W.; Rosas-Rogers, S.; Schumacher, M.L.; Mokry, R.L.; Terhune, S.S.; Ebert, A.D.; Shenk, T. Human cytomegalovirus induces significant structural and functional changes in terminally differentiated human cortical neurons. mBio 2023, 14, e02251-23. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Aguiar, A.; Galinato, M.; Silva, B.; Toth, B.; McVoy, M.A.; Hertel, L.; Oliver, S. Human Cytomegalovirus Replication and Infection-Induced Syncytia Formation in Labial, Foreskin, and Fetal Lung Fibroblasts. Viruses 2021, 13, 2355. [Google Scholar] [CrossRef] [Scilit]
- Galitska, G.; Biolatti, M.; De Andrea, M.; Leone, A.; Coscia, A.; Bertolotti, L.; Ala, U.; Bertino, E.; Dell’oste, V.; Landolfo, S. Biological relevance of Cytomegalovirus genetic variability in congenitally and postnatally infected children. J. Clin. Virol. 2018, 108, 132–140. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Waldman, W.J.; Sneddon, J.M.; Stephens, R.E.; Roberts, W.H. Enhanced Endothelial Cytopathogenicity Induced by a Cytomegalovirus Strain Propagated in Endothelial Cells. J. Med. Virol. 1989, 28, 223–230. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Gerna, G.; Lilleri, D. Human cytomegalovirus (HCMV) infection/re-infection: Development of a protective HCMV vaccine. New Microbiol. 2019, 42, 1–20. [Google Scholar]
- Schleiss, M.R.; Permar, S.R.; Plotkin, S.A. Progress toward Development of a Vaccine against Congenital Cytomegalovirus Infection. Clin. Vaccine Immunol. 2017, 24. [Google Scholar] [CrossRef] [Scilit]
- Diamond, D.J.; La Rosa, C.; Chiuppesi, F.; Contreras, H.; Dadwal, S.; Wussow, F.; Bautista, S.; Nakamura, R.; Zaia, J.A. A fifty-year odyssey: Prospects for a cytomegalovirus vaccine in transplant and congenital infection. Expert Rev. Vaccines 2018, 17, 889–911. [Google Scholar] [CrossRef] [Scilit]
- Nelson, C.S.; Vera Cruz, D.; Su, M.; Xie, G.; Vandergrift, N.; Pass, R.F.; Forman, M.; Diener-West, M.; Koelle, K.; Arav-Boger, R.; et al. Intrahost Dynamics of Human Cytomegalovirus Variants Acquired by Seronegative Glycoprotein B Vaccinees. J. Virol. 2018, 93. [Google Scholar] [CrossRef] [Scilit]
- Klupp, B.G.; Nixdorf, R.; Mettenleiter, T.C. Pseudorabies virus glycoprotein M inhibits membrane fusion. J. Virol. 2000, 74, 6760–6768. [Google Scholar] [CrossRef] [Scilit]
- Tang, J.; Frascaroli, G.; Zhou, X.; Knickmann, J.; Brune, W.; Oliver, S. Cell Fusion and Syncytium Formation in Betaherpesvirus Infection. Viruses 2021, 13, 1973. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Fan, Z.; Grantham, M.L.; Smith, M.S.; Anderson, E.S.; Cardelli, J.A.; Muggeridge, M.I. Truncation of Herpes Simplex Virus Type 2 Glycoprotein B Increases Its Cell Surface Expression and Activity in Cell-Cell Fusion, but These Properties Are Unrelated. J. Virol. 2002, 76, 9271–9283. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Haan, K.M.; Lee, S.K.; Longnecker, R. Different Functional Domains in the Cytoplasmic Tail of Glycoprotein B Are Involved in Epstein-Barr Virus-Induced Membrane Fusion. Virology 2001, 290, 106–114. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Pertel, P.E. Human Herpesvirus 8 Glycoprotein B (gB), gH, and gL Can Mediate Cell Fusion. J. Virol. 2002, 76, 4390–4400. [Google Scholar] [CrossRef] [Scilit]
- Yang, E.; Arvin, A.M.; Oliver, S.L. The Glycoprotein B Cytoplasmic Domain Lysine Cluster Is Critical for Varicella-Zoster Virus Cell-Cell Fusion Regulation and Infection. J. Virol. 2016, 91, e01707-16. [Google Scholar] [CrossRef] [Scilit]
- Oliver, S.L.; Brady, J.J.; Sommer, M.H.; Reichelt, M.; Sung, P.; Blau, H.M.; Arvin, A.M. An immunoreceptor tyrosine-based inhibition motif in varicella-zoster virus glycoprotein B regulates cell fusion and skin pathogenesis. Proc. Natl. Acad. Sci. USA 2013, 110, 1911–1916. [Google Scholar] [CrossRef] [Scilit]
- Reschke, M.; Reis, B.; Noding, K.; Rohsiepe, D.; Richter, A.; Mockenhaupt, T.; Garten, W.; Radsak, K. Constitutive expression of human cytomegalovirus glycoprotein B (gpUL55) with mutagenized carboxy-terminal hydrophobic domains. J. Gen Virol. 1995, 76 Pt 1, 113–122. [Google Scholar] [CrossRef] [Scilit]
- Silverman, J.L.; Greene, N.G.; King, D.S.; Heldwein, E.E. Membrane Requirement for Folding of the Herpes Simplex Virus 1 gB Cytodomain Suggests a Unique Mechanism of Fusion Regulation. J. Virol. 2012, 86, 8171–8184. [Google Scholar] [CrossRef] [Scilit]
- Koshizuka, T.; Kondo, H.; Kato, H.; Takahashi, K. Human cytomegalovirus UL42 protein inhibits the degradation of glycoprotein B through inhibition of Nedd4 family ubiquitin E3 ligases. Microbiol. Immunol. 2021, 65, 472–480. [Google Scholar] [CrossRef] [Scilit]
- Chen, J.; Zhang, X.; Jardetzky, T.S.; Longnecker, R. The Epstein-Barr Virus (EBV) Glycoprotein B Cytoplasmic C-Terminal Tail Domain Regulates the Energy Requirement for EBV-Induced Membrane Fusion. J. Virol. 2014, 88, 11686–11695. [Google Scholar] [CrossRef] [Scilit]
- Vanarsdall, A.L.; Howard, P.W.; Wisner, T.W.; Johnson, D.C. Human Cytomegalovirus gH/gL Forms a Stable Complex with the Fusion Protein gB in Virions. PLoS Pathog. 2016, 12, e1005564. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Pataki, Z.; Viveros, A.R.; Heldwein, E.E. Herpes Simplex Virus 1 Entry Glycoproteins Form Complexes before and during Membrane Fusion. mBio 2022, 13, e02039-22. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Pataki, Z.; Sanders, E.K.; Heldwein, E.E. A surface pocket in the cytoplasmic domain of the herpes simplex virus fusogen gB controls membrane fusion. PLoS Pathog. 2022, 18, e1010435. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Boppana, S.B.; Britt, W.J. Recent Approaches and Strategies in the Generation of Anti-human Cytomegalovirus Vaccines. Methods Mol. Biol. 2021, 2244, 403–463. [Google Scholar] [CrossRef] [Scilit]
- Langley, J.M.; Gantt, S.; Halperin, S.A.; Ward, B.; McNeil, S.; Ye, L.; Cai, Y.; Smith, B.; Anderson, D.E.; Mitoma, F.D. An enveloped virus-like particle alum-adjuvanted cytomegalovirus vaccine is safe and immunogenic: A first-in-humans Canadian Immunization Research Network (CIRN) study. Vaccine 2024, 42, 713–722. [Google Scholar] [CrossRef] [Scilit]
- Wu, K.; Hou, Y.J.; Makrinos, D.; Liu, R.; Zhu, A.; Koch, M.; Yu, W.-H.; Paila, Y.D.; Chandramouli, S.; Panther, L.; et al. Characterization of humoral and cellular immunologic responses to an mRNA-based human cytomegalovirus vaccine from a phase 1 trial of healthy adults. J. Virol. 2024, 98, e01603-23. [Google Scholar] [CrossRef] [Scilit]
- John, S.; Yuzhakov, O.; Woods, A.; Deterling, J.; Hassett, K.; Shaw, C.A.; Ciaramella, G. Multi-antigenic human cytomegalovirus mRNA vaccines that elicit potent humoral and cell-mediated immunity. Vaccine 2018, 36, 1689–1699. [Google Scholar] [CrossRef] [Scilit]
- Ishikawa, H.; Meng, F.; Kondo, N.; Iwamoto, A.; Matsuda, Z. Generation of a dual-functional split-reporter protein for monitoring membrane fusion using self-associating split GFP. Protein Eng. Des. Sel. 2012, 25, 813–820. [Google Scholar] [CrossRef] [Scilit]






| Primer No. | Name | Sequence |
|---|---|---|
| 0–77 | 5EcoR1-AD169gBcoopt | GCATGAATTCAACTCCTACAAGCAGCGCG |
| 0–78 | 3Xho-AD169gBcoopt899STOP | GCATCTCGAGTCAGTCCTTCAGGTGCCGGTAGCC |
| 0–79 | 3Xho-AD169gBcoopt891STOP | GCATCTCGAGTCACTTTCTGTGCCGCAGCCGGTCC |
| 0–80 | 3Xho-AD169gBcoopt885STOP | GCATCTCGAGTCAGTCCAGCAGGTTGGGCTTCTGGCCC |
| 0–81 | 3Xho-AD169gBcoopt869STOP | GCATCTCGAGTCAATCCAGGCTGTCGGTGCCATTCTG |
| 0–82 | 3Xho-AD169gBcoopt838STOP | GCATCTCGAGTCAGGGTGGGGCGGCTGTAGAGGCATC |
| 0–83 | 3Xho-AD169gBcoopt820STOP | GCATCTCGAGTCAGCTGTTGTACACGGACTCTTCGTAGC |
| 0–84 | 3Xho-AD169gBcoopt807STOP | GCATCTCGAGTCACAGGGAGGTATCCTTGGTGCTGC |
| 0–85 | 3Xho-AD169gBcoopt787STOP | GCATCTCGAGTCAAGGGAACAGGTTCTGCAGGGGCTG |
| 0–86 | 3Xho-AD169gBcoopt772STOP | GCATCTCGAGTCAGGTGTAGATCAGGTATGTGATGATCACG |
| 5–94 | 5ADgBcoop S812A+Y813A | GCAGGCCCCACCCGCCGCCGAAGAGTCCGTGTA |
| 5–95 | 3ADgBcoop S812A+Y813A | TACACGGACTCTTCGGCGGCGGGTGGGGCCTGC |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Reuter, N.; Kropff, B.; Chen, X.; Britt, W.J.; Sticht, H.; Mach, M.; Thomas, M. The Autonomous Fusion Activity of Human Cytomegalovirus Glycoprotein B Is Regulated by Its Carboxy-Terminal Domain. Viruses 2024, 16, 1482. https://doi.org/10.3390/v16091482
Reuter N, Kropff B, Chen X, Britt WJ, Sticht H, Mach M, Thomas M. The Autonomous Fusion Activity of Human Cytomegalovirus Glycoprotein B Is Regulated by Its Carboxy-Terminal Domain. Viruses. 2024; 16(9):1482. https://doi.org/10.3390/v16091482
Chicago/Turabian StyleReuter, Nina, Barbara Kropff, Xiaohan Chen, William J. Britt, Heinrich Sticht, Michael Mach, and Marco Thomas. 2024. "The Autonomous Fusion Activity of Human Cytomegalovirus Glycoprotein B Is Regulated by Its Carboxy-Terminal Domain" Viruses 16, no. 9: 1482. https://doi.org/10.3390/v16091482
APA StyleReuter, N., Kropff, B., Chen, X., Britt, W. J., Sticht, H., Mach, M., & Thomas, M. (2024). The Autonomous Fusion Activity of Human Cytomegalovirus Glycoprotein B Is Regulated by Its Carboxy-Terminal Domain. Viruses, 16(9), 1482. https://doi.org/10.3390/v16091482

