Characterization of Caulimovirid-like Sequences from Upland Cotton (Gossypium hirsutum L.) Exhibiting Terminal Abortion in Georgia, USA
Abstract
1. Introduction
2. Materials and Methods
2.1. Sample Collection
2.2. Statistical Analysis
2.3. Seed and Seedling Assessment
2.4. Nucleic Acid Extraction (DNA, RNA, and TNA)
2.5. Nucleic Acid Treatment
2.6. Virus Detection
2.7. High-Throughput Sequencing and Analysis
3. Results
3.1. Symptomatology
3.2. Virus Detection
3.3. Small and Long Non-Coding RNA Analysis
3.4. Validation of HTS Results
3.5. BLAST, Phylogenetic Analysis, and In Silico Mining
3.6. Cotton Yield Components
3.7. Seed and Seedling Assay
4. Discussion
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Bellas, C.; Hackl, T.; Plakolb, M.-S.; Koslová, A.; Fischer, M.G.; Sommaruga, R. Large-Scale Invasion of Unicellular Eukaryotic Genomes by Integrating DNA Viruses. Proc. Natl. Acad. Sci. USA 2023, 120, e2300465120. [Google Scholar] [CrossRef] [Scilit]
- Veglia, A.J.; Bistolas, K.S.I.; Voolstra, C.R.; Hume, B.C.C.; Ruscheweyh, H.-J.; Planes, S.; Allemand, D.; Boissin, E.; Wincker, P.; Poulain, J.; et al. Endogenous Viral Elements Reveal Associations between a Non-Retroviral RNA Virus and Symbiotic Dinoflagellate Genomes. Commun. Biol. 2023, 6, 566. [Google Scholar] [CrossRef] [Scilit]
- Koslová, A.; Hackl, T.; Bade, F.; Sanchez Kasikovic, A.; Barenhoff, K.; Schimm, F.; Mersdorf, U.; Fischer, M.G. Endogenous Virophages are Active and Mitigate Giant Virus Infection in the Marine Protist Cafeteria burkhardae. Proc. Natl. Acad. Sci. USA 2024, 121, e2314606121. [Google Scholar] [CrossRef] [Scilit]
- Zhao, H.; Zhang, R.; Wu, J.; Meng, L.; Okazaki, Y.; Hikida, H.; Ogata, H. A 1.5-Mb Continuous Endogenous Viral Region in the Arbuscular Mycorrhizal Fungus Rhizophagus irregularis. Virus. Evol. 2023, 9, vead064. [Google Scholar] [CrossRef] [Scilit]
- Flynn, P.J.; Moreau, C.S. Assessing the Diversity of Endogenous Viruses throughout Ant Genomes. Front. Microbiol. 2019, 10, 1139. [Google Scholar] [CrossRef] [Scilit]
- Liu, S.; Coates, B.S.; Bonning, B.C. Endogenous Viral Elements Integrated into the Genome of the Soybean Aphid, Aphis glycines. Insect Biochem. Mol. Biol. 2020, 123, 103405. [Google Scholar] [CrossRef] [Scilit]
- Suzuki, Y.; Baidaliuk, A.; Miesen, P.; Frangeul, L.; Crist, A.B.; Merkling, S.H.; Fontaine, A.; Lequime, S.; Moltini-Conclois, I.; Blanc, H.; et al. Non-Retroviral Endogenous Viral Element Limits Cognate Virus Replication in Aedes aegypti Ovaries. Curr. Biol. 2020, 30, 3495–3506.e6. [Google Scholar] [CrossRef] [Scilit]
- Huang, H.-J.; Li, Y.-Y.; Ye, Z.-X.; Li, L.-L.; Hu, Q.-L.; He, Y.-J.; Qi, Y.-H.; Zhang, Y.; Li, T.; Lu, G.; et al. Co-Option of a Non-Retroviral Endogenous Viral Element in Planthoppers. Nat. Commun. 2023, 14, 7264. [Google Scholar] [CrossRef] [Scilit]
- Naville, M.; Volff, J.N. Endogenous Retroviruses in Fish Genomes: From Relics of Past Infections to Evolutionary Innovations? Front. Microbiol. 2016, 7, 1197. [Google Scholar] [CrossRef] [Scilit]
- Cui, J.; Zhao, W.; Huang, Z.; Jarvis, E.D.; Gilbert, M.T.P.; Walker, P.J.; Holmes, E.C.; Zhang, G. Low Frequency of Paleoviral Infiltration Across the Avian Phylogeny. Genome Biol. 2014, 15, 539. [Google Scholar] [CrossRef]
- Mason, A.S.; Lund, A.R.; Hocking, P.M.; Fulton, J.E.; Burt, D.W. Identification and Characterisation of Endogenous Avian Leukosis Virus Subgroup E (ALVE) Insertions in Chicken Whole Genome Sequencing Data. Mob. DNA 2020, 11, 22. [Google Scholar] [CrossRef] [Scilit]
- Bejarano, E.R.; Khashoggi, A.; Witty, M.; Lichtenstein, C. Integration of Multiple Repeats of Geminiviral DNA into the Nuclear Genome of Tobacco during Evolution. Proc. Natl. Acad. Sci. USA 1996, 93, 759–764. [Google Scholar] [CrossRef] [Scilit]
- Belyi, V.A.; Levine, A.J.; Skalka, A.M. Sequences from Ancestral Single-Stranded DNA Viruses in Vertebrate Genomes: The Parvoviridae and Circoviridae are more than 40 to 50 Million Years Old. J. Virol. 2010, 84, 12458–12462. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Katzourakis, A.; Gifford, R.J. Endogenous Viral Elements in Animal Genomes. PLoS Genet. 2010, 6, e1001191. [Google Scholar] [CrossRef] [Scilit]
- Weiss, R. Spontaneous Virus Production from “Non-Virus Producing” Rous Sarcoma Cells. Virol. J. 1967, 32, 719–723. [Google Scholar] [CrossRef] [Scilit]
- Stein, R.A.; DePaola, R.V. Human Endogenous Retroviruses: Our Genomic Fossils and Companions. Physiol. Genom. 2023, 55, 249–258. [Google Scholar] [CrossRef] [Scilit]
- Katoh, H.; Honda, T. Roles of Human Endogenous Retroviruses and Endogenous Virus-like Elements in Cancer Development and Innate Immunity. Biomolecules 2023, 13, 1706. [Google Scholar] [CrossRef] [Scilit]
- Skirmuntt, E.C.; Escalera-Zamudio, M.; Teeling, E.C.; Smith, A.; Katzourakis, A. The Potential Role of Endogenous Viral Elements in the Evolution of Bats as Reservoirs for Zoonotic Viruses. Annu. Rev. Virol. 2020, 7, 103–119. [Google Scholar] [CrossRef] [Scilit]
- Weiss, R.A. The Discovery of Endogenous Retroviruses. Retrovirology 2006, 3, 67. [Google Scholar] [CrossRef] [Scilit]
- Andrake, M.D.; Skalka, A.M. Retroviral Integrase: Then and Now. Annu. Rev. Virol. 2015, 2, 241–264. [Google Scholar] [CrossRef] [Scilit]
- Ashby, M.K.; Warry, A.; Bejarano, E.R.; Khashoggi, A.; Burrell, M.; Lichtenstein, C.P. Analysis of Multiple Copies of Geminiviral DNA in the Genome of Four Closely Related Nicotiana Species Suggest a Unique Integration Event. Plant Mol. Biol. 1997, 35, 313–321. [Google Scholar] [CrossRef] [Scilit]
- Jakowitsch, J.; Mette, M.F.; van der Winden, J.; Matzke, M.A.; Matzke, A.J.M. Integrated Pararetroviral Sequences Define a Unique Class of Dispersed Repetitive DNA in Plants. Proc. Natl. Acad. Sci. USA 1999, 96, 13241–13246. [Google Scholar] [CrossRef] [Scilit]
- Diop, S.I.; Geering, A.D.W.; Alfama-Depauw, F.; Loaec, M.; Teycheney, P.-Y.; Maumus, F. Tracheophyte Genomes Keep Track of the Deep Evolution of The Caulimoviridae. Sci. Rep. 2018, 8, 572. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Geering, A.D.W.; Maumus, F.; Copetti, D.; Choisne, N.; Zwickl, D.J.; Zytnicki, M.; McTaggart, A.R.; Scalabrin, S.; Vezzulli, S.; Wing, R.A.; et al. Endogenous Florendoviruses are Major Components of Plant Genomes and Hallmarks of Virus Evolution. Nat. Commun. 2014, 5, 5269. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Aboughanem-Sabanadzovic, N.; Allen, T.W.; Frelichowski, J.; Scheffler, J.; Sabanadzovic, S. Discovery and Analyses of Caulimovirid-like Sequences in Upland Cotton (Gossypium hirsutum). Viruses 2023, 15, 1643. [Google Scholar] [CrossRef] [Scilit]
- Holmes, E.C. The Evolution of Endogenous Viral Elements. Cell Host Microbe 2011, 10, 368–377. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Pahalawatta, V.; Druffel, K.; Pappu, H. A New and Distinct Species in the Genus Caulimovirus Exists as an Endogenous Plant Pararetroviral Sequence in its Host, Dahlia variabilis. Virology 2008, 376, 253–257. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Gayral, P.; Iskra-Caruana, M.-L. Phylogeny of Banana Streak Virus Reveals Recent and Repetitive Endogenization in the Genome of Its Banana Host (Musa sp.). J. Mol. Evol. 2009, 69, 65–80. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Krupovic, M.; Blomberg, J.; Coffin, J.M.; Dasgupta, I.; Fan, H.; Geering, A.D.; Gifford, R.; Harrach, B.; Hull, R.; Johnson, W. Ortervirales: New Virus Order Unifying Five Families of Reverse-Transcribing Viruses. Virol. J. 2018, 92, e00515-18. [Google Scholar] [CrossRef] [Scilit]
- Teycheney, P.Y.; Geering, A.D.W.; Dasgupta, I.; Hull, R.; Kreuze, J.F.; Lockhart, B.; Muller, E.; Olszewski, N.; Pappu, H.; Pooggin, M.M.; et al. ICTV Virus Taxonomy Profile: Caulimoviridae. J. Gen. Virol. 2020, 101, 1025–1026. [Google Scholar] [CrossRef] [Scilit]
- Hull, R. Profiles of Families and Genera of Plant Viruses. In Plant Virology, 5th ed.; Elsevier: Waltham, MA, USA, 2014; p. 981. [Google Scholar]
- Pfeiffer, P.; Hohn, T. Involvement of Reverse Transcription in the Replication of Cauliflower Mosaic Virus: A Detailed Model and Test of Some Aspects. Cell 1983, 33, 781–789. [Google Scholar] [CrossRef] [Scilit]
- Schoelz, J.E. Caulimoviruses: General Features. In Encyclopedia of Virology, 3rd ed.; Mahy, B.W.J., Van Regenmortel, M.H.V., Eds.; Academic Press: Oxford, UK, 2008; pp. 457–464. [Google Scholar]
- Scholthof, H.B.; Gowda, S.; Wu, F.C.; Shepherd, R.J. The Full-Length Transcript of a Caulimovirus is a Polycistronic mRNA Whose Genes are Trans Activated by the Product of Gene VI. J. Virol. 1992, 66, 3131–3139. [Google Scholar] [CrossRef] [Scilit]
- Ndowora, T.; Dahal, G.; LaFleur, D.; Harper, G.; Hull, R.; Olszewski, N.E.; Lockhart, B. Evidence that Badnavirus Infection in Musa Can Originate from Integrated Pararetroviral Sequences. Virology 1999, 255, 214–220. [Google Scholar] [CrossRef] [Scilit]
- Harper, G.; Osuji, J.O.; Heslop-Harrison, J.S.; Hull, R. Integration of Banana Streak Badnavirus into the Musa Genome: Molecular and Cytogenetic Evidence. Virology 1999, 255, 207–213. [Google Scholar] [CrossRef] [Scilit]
- Chabannes, M.; Baurens, F.C.; Duroy, P.O.; Bocs, S.; Vernerey, M.S.; Rodier-Goud, M.; Barbe, V.; Gayral, P.; Iskra-Caruana, M.L. Three Infectious Viral Species Lying in Wait in the Banana Genome. J. Virol. 2013, 87, 8624–8637. [Google Scholar] [CrossRef] [Scilit]
- Saito, N.; Chen, S.; Kitajima, K.; Zhou, Z.; Koide, Y.; Encabo, J.R.; Diaz, M.G.Q.; Choi, I.R.; Koyanagi, K.O.; Kishima, Y. Phylogenetic Analysis of Endogenous Viral Elements in the Rice Genome Reveals Local Chromosomal Evolution in Oryza AA-Genome Species. Front. Plant Sci. 2023, 14, 1261705. [Google Scholar] [CrossRef] [Scilit]
- Chen, S.; Saito, N.; Encabo, J.R.; Yamada, K.; Choi, I.R.; Kishima, Y. Ancient Endogenous Pararetroviruses in Oryza Genomes Provide Insights into the Heterogeneity of Viral Gene Macroevolution. Genome Biol. Evol. 2018, 10, 2686–2696. [Google Scholar] [CrossRef] [Scilit]
- Muller, E.; Ullah, I.; Dunwell, J.M.; Daymond, A.J.; Richardson, M.; Allainguillaume, J.; Wetten, A. Identification and Distribution of Novel Badnaviral Sequences Integrated in the Genome of Cacao (Theobroma cacao). Sci. Rep. 2021, 11, 8270. [Google Scholar] [CrossRef] [Scilit]
- Gong, Z.; Han, G.Z. Euphyllophyte Paleoviruses Illuminate Hidden Diversity and Macroevolutionary Mode of Caulimoviridae. J. Virol. 2018, 92, e02043-17. [Google Scholar] [CrossRef] [Scilit]
- Yu, H.; Wang, X.; Lu, Z.; Xu, Y.; Deng, X.; Xu, Q. Endogenous Pararetrovirus Sequences are Widely Present in Citrinae Genomes. Virus Res. 2019, 262, 48–53. [Google Scholar] [CrossRef] [Scilit]
- Schmidt, N.; Seibt, K.M.; Weber, B.; Schwarzacher, T.; Schmidt, T.; Heitkam, T. Broken, Silent, and in Hiding: Tamed Endogenous Pararetroviruses Escape Elimination from the Genome of Sugar Beet (Beta vulgaris). Ann. Bot. 2021, 128, 281–299. [Google Scholar] [CrossRef] [Scilit]
- de Tomás, C.; Vicient, C.M. Genome-Wide Identification of Reverse Transcriptase Domains of Recently Inserted Endogenous Plant Pararetrovirus (Caulimoviridae). Front. Plant Sci. 2022, 13, 1011565. [Google Scholar] [CrossRef] [Scilit]
- Mahmood, M.A.; Ahmed, N.; Hussain, A.; Naqvi, R.Z.; Amin, I.; Mansoor, S. Dominance of Cotton leaf curl Multan virus-Rajasthan Strain Associated with Third Epidemic of Cotton Leaf Curl Disease in Pakistan. Sci. Rep. 2024, 14, 13532. [Google Scholar] [CrossRef] [Scilit]
- Rageshwari, S.; Malathi, V.G.; Renukadevi, P.; Nakkeeran, S. Molecular Studies on Tobacco Streak Virus (TSV) Infecting Cotton in Tamil Nadu, India. 3 Biotech 2023, 13, 35. [Google Scholar] [CrossRef] [Scilit]
- Edula, S.R.; Bag, S.; Milner, H.; Kumar, M.; Suassuna, N.D.; Chee, P.W.; Kemerait, R.C.; Hand, L.C.; Snider, J.L.; Srinivasan, R.; et al. Cotton Leafroll Dwarf Disease: An Enigmatic Viral Disease in Cotton. Mol. Plant Pathol. 2023, 24, 513–526. [Google Scholar] [CrossRef] [Scilit]
- Culbreath, A.K.; Todd, J.W.; Demski, J.W. Productivity of Florunner Peanut Infected with Tomato Spotted Wilt Virus. Peanut Sci. 1992, 19, 11–14. [Google Scholar] [CrossRef] [Scilit]
- Gitaitis, R.D.; Dowler, C.C.; Chalfant, R.B. Epidemiology of Tomato Spotted Wilt in Pepper and Tomato in Southern Georgia. Plant Dis. 1998, 82, 752–756. [Google Scholar] [CrossRef] [Scilit]
- McDaniel, L.L.; Raid, R.N.; Elliott, C.L.; Tsai, J.H.; Nagata, R.T. Purification and Serological Characterization of a Tobacco Streak Virus Isolate Infecting Field-Grown Escarole and Lettuce. Plant Dis. 1992, 76, 966–971. [Google Scholar] [CrossRef] [Scilit]
- Sharman, M.; Persley, D.M.; Thomas, J.E. Distribution in Australia and Seed Transmission of Tobacco streak virus in Parthenium hysterophorus. Plant Dis. 2009, 93, 708–712. [Google Scholar] [CrossRef] [Scilit]
- Hosseini, S.; Habibi, M.K.; Mosahebi, G.; Motamedi, M.; Winter, S. First Report on The Occurrence of Tobacco Streak Virus in Sunflower in Iran. Plant Pathol. J. 2012, 94, 585–589. [Google Scholar]
- Daliyamol; Jailani, A.A.K.; Vemana, K.; Roy, A.; Krishnareddy, M.; Kobayashi, K.; Mandal, B. Complete Genome Sequence and Phylogenetic Relationships of Tobacco Streak Virus Causing Groundnut Stem Necrosis Disease in India. Virusdisease 2019, 30, 227–236. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Bag, S.; Tabassum, A.; Brock, J.; Dutta, B. First Report of Tobacco Streak Virus Infecting Summer Squash in Georgia, U.S.A. Plant Dis. 2019, 103, 1442. [Google Scholar] [CrossRef] [Scilit]
- Zambrana-Echevarría, C.; Roth, M.G.; Dasgupta, R.; German, T.L.; Groves, C.L.; Smith, D.L. Sensitive and Specific qPCR and Nested RT-PCR Assays for the Detection of Tobacco Streak Virus in Soybean. PhytoFrontiers 2021, 1, 291–300. [Google Scholar] [CrossRef] [Scilit]
- West-Ortiz, M.; Stuehler, D.; Pollock, E.; Wilson, J.R.; Preising, S.; Larrea-Sarmiento, A.; Alabi, O.; Fuchs, M.; Heck, M.; Olmedo-Velarde, A. Characterization of cotton virus A, a novel and distinct member of the genus Caulimovirus with endogenous viral elements in Gossypium spp. bioRxiv 2023. [Google Scholar] [CrossRef] [Scilit]
- Silva, T.F.; Romanel, E.A.; Andrade, R.R.; Farinelli, L.; Østerås, M.; Deluen, C.; Corrêa, R.L.; Schrago, C.E.; Vaslin, M.F. Profile of Small Interfering RNAs from Cotton Plants Infected with the Polerovirus Cotton leafroll dwarf virus. BMC Mol. Biol. 2011, 12, 40. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Kavalappara, S.R.; Bag, S.; Luckew, A.; McGregor, C.E. Small RNA Profiling of Cucurbit Yellow Stunting Disorder Virus from Susceptible and Tolerant Squash (Cucurbita pepo) Lines. Viruses 2023, 15, 788. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Pecman, A.; Kutnjak, D.; Gutiérrez-Aguirre, I.; Adams, I.; Fox, A.; Boonham, N.; Ravnikar, M. Next Generation Sequencing for Detection and Discovery of Plant Viruses and Viroids: Comparison of Two Approaches. Front. Microbiol. 2017, 8, 1998. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Goodstein, D.M.; Shu, S.; Howson, R.; Neupane, R.; Hayes, R.D.; Fazo, J.; Mitros, T.; Dirks, W.; Hellsten, U.; Putnam, N.; et al. Phytozome: A Comparative Platform for Green Plant Genomics. Nucleic Acids Res. 2012, 40, D1178–D1186. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Yu, J.; Jung, S.; Cheng, C.-H.; Lee, T.; Zheng, P.; Buble, K.; Crabb, J.; Humann, J.; Hough, H.; Jones, D. Cottongen: The Community Database for Cotton Genomics, Genetics, and Breeding Research. Plants 2021, 10, 2805. [Google Scholar] [CrossRef] [Scilit]
- Xin, M.; Cao, M.; Liu, W.; Ren, Y.; Lu, C.; Wang, X. The Genomic and Biological Characterization of Citrullus Lanatus Cryptic Virus Infecting Watermelon in China. Virus Res. 2017, 232, 106–112. [Google Scholar] [CrossRef] [Scilit]
- Adeleke, I.A.; Kavalappara, S.R.; McGregor, C.; Srinivasan, R.; Bag, S. Persistent, and Asymptomatic Viral Infections and Whitefly-Transmitted Viruses Impacting Cantaloupe and Watermelon in Georgia, USA. Viruses 2022, 14, 1310. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Sedhain, N.P.; Bag, S.; Morgan, K.; Carter, R.; Triana, P.; Whitaker, J.; Kemerait, R.C.; Roberts, P.M. Natural Host Range, Incidence on Overwintering Cotton and Diversity of Cotton Leafroll Dwarf Virus in Georgia USA. Crop Prot. 2021, 144, 105604. [Google Scholar] [CrossRef] [Scilit]
- Altschul, S.F.; Gish, W.; Miller, W.; Myers, E.W.; Lipman, D.J. Basic Local Alignment Search Tool. J. Mol. Biol. 1990, 215, 403–410. [Google Scholar] [CrossRef] [PubMed]
- Tamura, K.; Stecher, G.; Kumar, S. MEGA11: Molecular Evolutionary Genetics Analysis Version 11. Mol. Biol. Evol. 2021, 38, 3022–3027. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Randell, T.M.; Roberts, P.M.; Culpepper, A.S. Palmer Amaranth (Amaranthaceae) and At-Plant Insecticide Impacts on Tarnished Plant Bug (Hemiptera: Miridae) and Injury to Seedling Cotton Terminals. J. Entomol. Sci. 2021, 56, 487–503. [Google Scholar] [CrossRef] [Scilit]
- Shirley, A. Thrips Management in Cotton. Available online: https://site.extension.uga.edu/tattnall/2023/04/thrips-management-in-cotton (accessed on 4 June 2024).
- Camp Hand, G.H.; Kemerait, B.; Liu, Y.; Perry, C.; Hall, D.; Mallard, J.; Porter, W.; Roberts, P.; Smith, A.; Virk, S.; et al. Georgia Cotton Production Guide 2023; University of Georgia Extension: Athens, GA, USA, 2023; p. 161. [Google Scholar]
- Kennedy, G.G. Thrips Infestation Predictor for Cotton: An Online Tool for Informed Thrips Management. Available online: https://www.planthealthexchange.org/cotton/Pages/GROW-COT-04-17-103.aspx (accessed on 19 June 2024).
- Cook, D.; Herbert, A.; Akin, D.S.; Reed, J. Biology, Crop Injury, and Management of Thrips (Thysanoptera: Thripidae) Infesting Cotton Seedlings in the United States. J. Integr. Pest Manag. 2011, 2, B1–B9. [Google Scholar] [CrossRef] [Scilit]
- Roberts, P.M.; Toews, M. Commercial Insect and Weed Control in Cotton; University of Georgia Extension: Athens, GA, USA, 2023. [Google Scholar]
- Lockhart, B.E.; Menke, J.; Dahal, G.; Olszewski, N.E. Characterization and Genomic Analysis of Tobacco Vein Clearing Virus, A Plant Pararetrovirus that is Transmitted Vertically and Related to Sequences Integrated in the Host Genome. J. Gen. Virol. 2000, 81, 1579–1585. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Richert-Pöggeler, K.R.; Shepherd, R.J. Petunia Vein-Clearing Virus: A Plant Pararetrovirus with the Core Sequences for an Integrase Function. Virology 1997, 236, 137–146. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Richert-Pöggeler, K.R.; Noreen, F.; Schwarzacher, T.; Harper, G.; Hohn, T. Induction of Infectious Petunia Vein Clearing (Pararetro) Virus from Endogenous Provirus in Petunia. EMBO J. 2003, 22, 4836–4845. [Google Scholar] [CrossRef] [Scilit]
- Harper, G.; Richert-Pöggeler, K.R.; Hohn, T.; Hull, R. Detection of Petunia Vein-Clearing Virus: Model for the Detection of DNA Viruses in Plants with Homologous Endogenous Pararetrovirus Sequences. J. Virol. Methods 2003, 107, 177–184. [Google Scholar] [CrossRef] [Scilit]
- Eid, S.; Pappu, H.R. Expression of Endogenous Para-Retroviral Genes and Molecular Analysis of the Integration Events in its Plant Host Dahlia variabilis. Virus Genes 2014, 48, 153–159. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Squires, J.; Gillespie, T.; Schoelz, J.E.; Palukaitis, P. Excision and Episomal Replication of Cauliflower Mosaic Virus Integrated into a Plant Genome. Plant Physiol. 2011, 155, 1908–1919. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Wang, Y.; Folimonova, S.Y. Long Noncoding RNAs in Plant-Pathogen Interactions. Phytopathology 2023, 113, 1380–1386. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Mattick, J.S.; Amaral, P.P.; Carninci, P.; Carpenter, S.; Chang, H.Y.; Chen, L.-L.; Chen, R.; Dean, C.; Dinger, M.E.; Fitzgerald, K.A.; et al. Long non-coding RNAs: Definitions, Functions, Challenges and Recommendations. Nat. Rev. Mol. Cell Biol. 2023, 24, 430–447. [Google Scholar] [CrossRef] [Scilit]
- Nizamani, M.M.; Zhang, Q.; Muhae-Ud-Din, G.; Wang, Y. High-throughput Sequencing in Plant Disease Management: A Comprehensive Review of Benefits, Challenges, and Future Perspectives. Phytopathol. Res. 2023, 5, 44. [Google Scholar] [CrossRef] [Scilit]
- González-Pérez, E.; Chiquito-Almanza, E.; Villalobos-Reyes, S.; Canul-Ku, J.; Anaya-López, J.L. Diagnosis and Characterization of Plant Viruses Using HTS to Support Virus Management and Tomato Breeding. Viruses 2024, 16, 888. [Google Scholar] [CrossRef] [Scilit]
- Ghoshal, B.; Sanfaçon, H. Symptom Recovery in Virus-Infected Plants: Revisiting the Role of RNA Silencing Mechanisms. Virology 2015, 479–480, 167–179. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Schepetilnikov, M.; Ryabova, L. Cauliflower Mosaic Virus (CaMV) Upregulates Translation Reinitiation of its Pregenomic Polycistronic 35S RNA via Interaction with the Cell’s Translation Machinery. In Plant Virus–Host Interaction; Gaur, R.K., Hohn, T., Sharma, P., Eds.; Academic Press: Boston, MA, USA, 2014; pp. 325–343. [Google Scholar]
- Pahalawatta, V.; Druffel, K.; Pappu, H.R. Seed Transmission of Dahlia mosaic virus in Dahlia pinnata. Plant Dis. 2007, 91, 88–91. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Mette, M.F.; Kanno, T.; Aufsatz, W.; Jakowitsch, J.; van der Winden, J.; Matzke, M.A.; Matzke, A.J. Endogenous Viral Sequences and their Potential Contribution to Heritable Virus Resistance in Plants. EMBO J. 2002, 21, 461–469. [Google Scholar] [CrossRef] [Scilit]
- Bertsch, C.; Beuve, M.; Dolja, V.V.; Wirth, M.; Pelsy, F.; Herrbach, E.; Lemaire, O. Retention of the Virus-Derived Sequences In the Nuclear Genome of Grapevine as a Potential Pathway to Virus Resistance. Biol. Direct 2009, 4, 21. [Google Scholar] [CrossRef] [Scilit]
- Aswad, A.; Katzourakis, A. Paleovirology and Virally Derived Immunity. Trends Ecol. Evol. 2012, 27, 627–636. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Valli, A.A.; Gonzalo-Magro, I.; Sanchez, D.H. Rearranged Endogenized Plant Pararetroviruses as Evidence of Heritable RNA-based Immunity. Mol. Biol. Evol. 2023, 40, msac240. [Google Scholar] [CrossRef] [Scilit] [PubMed]






| S. No | Oligo | Virus | Gene Targeted | Primer Sequence | References |
|---|---|---|---|---|---|
| 1 | Caulimo MP-F | EVEs | Movement protein | GGACGACTCGAAGGAAACTTAGG | [56] |
| 2 | Caulimo MP-R | EVEs | Movement protein | ACTAGAAGGGTGCTCTACTGGTA | [56] |
| 3 | SB26-F | CLRDV | Partial Capsid protein | CTCAATGGTCTTATTGGAGTTCA | [47] |
| 4 | SB26-R | CLRDV | Partial Capsid protein | TTCCTCCCATTCTTGGTGATTCC | [47] |
| 5 | SB11-F | CLRDV | Capsid protein | AGGTTTTCTGGTAGCAGTACCAATATCAACGTTA | [64] |
| 6 | SB11-R | CLRDV | Capsid protein | TATCTTGCATTGTGGATTTCCCTCATAA | [64] |
| 7 | SB 28-F | CLRDV | P0 protein | CACTTGAGACATAACTCGCTT | [64] |
| 8 | SB 28-R | CLRDV | P0 protein | GCGGTGAGGAGACCATACTCA | [64] |
| 9 | SB162F | TSV | Capsid protein | TCAGCCTGACTGTTGGGTTGT | [54] |
| 10 | SB162R | TSV | Capsid protein | AGCTATGCATGTTGTTCATAGG | [54] |
| 11 | SB164F | TSV | Movement protein | ACGATTTCCAACTTTGAATTCCTACAA | [54] |
| 12 | SB164R | TSV | Movement protein | ATCTATCTCTAGAATTCATCAACTTAATACT | [54] |
| (A) | ||||||||||||
| Sample ID | Total lncRNA Reads | Reads Match to CotV-A | Consensus seq | Coverage% with CotV-A | Nucleotide % Identity | Reads Match to eCPRVE | Coverage % with eCPRVE | Nucleotide % Identity | Reads Matching CLRDV | Coverage % with CLRDV | Reads Matching with TSV | Coverage % with TSV |
| S2 | 78,686,152 | 73,027 (0.09) | 7484 | 100 | 99.55 | 47,584 (0.06) | 100 | 99.84 | 0 | - | 0 | - |
| S3 | 57,242,296 | 29,794 (0.05) | 7481 | 99.99 | 99.45 | 19,663 (0.03) | 100 | 99.72 | 0 | - | 0 | - |
| S4 | 83,642,364 | 33,534 (0.04) | 7481 | 99.99 | 99.44 | 20,928 (0.02) | 100 | 99.72 | 0 | - | 0 | - |
| S5 | 83,991,624 | 43,588 (0.05) | 7482 | 100 | 99.49 | 26,587 (0.03) | 100 | 99.77 | 0 | - | 0 | - |
| (B) | ||||||||||||
| Sample ID | Total sRNA reads | % sRNA reads match with CotV-A | Coverage % with CotV-A | % sRNA reads match with eCPRVE | Coverage % with eCPRVE | % sRNA reads match with CLRDV | Coverage % with CLRDV | % sRNA reads match with TSV | Coverage % with TSV | |||
| S2 | 22,664,462 | 1462 (0.006) | - | 1300 (0.005) | - | 539 (0.002) | - | 330 (0.001) | - | |||
| S3 | 19,209,722 | 985 (0.005) | - | 873 (0.004) | - | 395 (0.002) | - | 237 (0.001) | - | |||
| S4 | 22,718,020 | 2138 (0.009) | - | 1833 (0.008) | - | 944 (0.004) | - | 663 (0.002) | - | |||
| S5 | 26,555,305 | 2169 (0.008) | - | 1904 (0.007) | - | 893 (0.003) | - | 643 (0.002) | - | |||
| Cotton Sample-Type | Number of Samples Tested (n) | a Number of Samples (n) Positive in PCR/RT-PCR/qPCR | ||
|---|---|---|---|---|
| EVEs | CLRDV | TSV | ||
| Commercial field samples | ||||
| Symptomatic (L1&2) | 46 | 32 (70%) | ND | ND |
| Asymptomatic (L1&2) | 8 | 8 (100%) | ND | ND |
| Experimental plot | ||||
| Symptomatic | 40 | 37 (93%) | 1 (2.5%) | NT |
| Asymptomatic | 40 | 39 (98%) | 1 (2.5%) | NT |
| Induced | 20 | 19 (95%) | ND | |
| Seed assessment (Greenhouse conditions) | ||||
| Seeds | 40 | 38 (95%) | NT | NT |
| Seedlings | 40 | 30 (75%) | NT | NT |
| Variety | Treatment | Seedcotton Yield (g plant−1) | Boll Density plant−1 |
|---|---|---|---|
| DG3615 | Asymptomatic | 51.97 a | 9.85 a |
| Symptomatic | 43.53 a | 8.5 a | |
| p value | 0.4139 | 0.4933 | |
| DGH959 | Asymptomatic | 60.57 a | 12.3 a |
| Symptomatic | 57.36 a | 11.3 a | |
| Induced terminal abortion | 56.55 a | 10.95 a | |
| p value | 0.8866 | 0.7028 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Edula, S.R.; Hand, L.C.; Roberts, P.M.; Beasley, E.; Snider, J.L.; Kemerait, R.C.; Chee, P.W.; Bag, S. Characterization of Caulimovirid-like Sequences from Upland Cotton (Gossypium hirsutum L.) Exhibiting Terminal Abortion in Georgia, USA. Viruses 2024, 16, 1111. https://doi.org/10.3390/v16071111
Edula SR, Hand LC, Roberts PM, Beasley E, Snider JL, Kemerait RC, Chee PW, Bag S. Characterization of Caulimovirid-like Sequences from Upland Cotton (Gossypium hirsutum L.) Exhibiting Terminal Abortion in Georgia, USA. Viruses. 2024; 16(7):1111. https://doi.org/10.3390/v16071111
Chicago/Turabian StyleEdula, Surendra R., Lavesta C. Hand, Phillip M. Roberts, Edward Beasley, John L. Snider, Robert C. Kemerait, Peng W. Chee, and Sudeep Bag. 2024. "Characterization of Caulimovirid-like Sequences from Upland Cotton (Gossypium hirsutum L.) Exhibiting Terminal Abortion in Georgia, USA" Viruses 16, no. 7: 1111. https://doi.org/10.3390/v16071111
APA StyleEdula, S. R., Hand, L. C., Roberts, P. M., Beasley, E., Snider, J. L., Kemerait, R. C., Chee, P. W., & Bag, S. (2024). Characterization of Caulimovirid-like Sequences from Upland Cotton (Gossypium hirsutum L.) Exhibiting Terminal Abortion in Georgia, USA. Viruses, 16(7), 1111. https://doi.org/10.3390/v16071111

