The Significance of the 98th Amino Acid in GP2a for Porcine Reproductive and Respiratory Syndrome Virus Adaptation in Marc-145 Cells
Abstract
1. Introduction
2. Materials and Methods
2.1. Cell Culture and Viruses
2.2. Virus Isolation and Plaque Purification
2.3. Phylogenetic Analysis and Sequence Alignment
2.4. Full-Length PRRSV cDNA Clone Construction and Transfection
2.5. Immunofluorescence Assay
2.6. Western Blotting
2.7. Quantitative Real-Time PCR
2.8. Multistep Growth Curve and Viral Titers
2.9. Animal Experiment
2.10. Statistical Analysis
3. Results
3.1. The LYNA and GDST Strains Do Not Easily Infect Marc-145 Cells
3.2. Sequencing Reveals That the 98th Amino Acid of GP2a May Be a Vital Site That Can Affect PRRSV Adaptation to Marc-145 Cells
3.3. Identification of an Amino Acid Mutation at the 98th Position That Can Change the Cellular Tropism of PRRSV-2 towards Marc-145 Cells
3.4. The Mutation Does Not Impact the Pathogenicity of PRRSV-2
3.5. The Mutation Does Not Impact the Replication Ability of PRRSV-2 In Vivo
4. Discussion
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Wensvoort, G.; de Kluyver, E.P.; Pol, J.M.; Wagenaar, F.; Moormann, R.J.; Hulst, M.M.; Bloemraad, R.; den Besten, A.; Zetstra, T.; Terpstra, C. Lelystad virus, the cause of porcine epidemic abortion and respiratory syndrome: A review of mystery swine disease research at Lelystad. Vet. Microbiol. 1992, 33, 185–193. [Google Scholar] [CrossRef]
- Zhao, J.; Xu, Z.; Xu, T.; Zhou, Y.; Li, J.; Deng, H.; Li, F.; Xu, L.; Sun, X.; Zhu, L. Molecular Characterization of the Nsp2 and ORF5s of PRRSV Strains in Sichuan China during 2012–2020. Animals 2022, 12, 3309. [Google Scholar] [CrossRef]
- Ma, X.; Wang, P.; Zhang, R.; Zhao, Y.; Wu, Y.; Luo, C.; Zeshan, B.; Yang, Z.; Qiu, L.; Zhou, Y.; et al. A NADC30-like PRRSV causes serious intestinal infections and tropism in piglets. Vet. Microbiol. 2022, 268, 109397. [Google Scholar] [CrossRef] [PubMed]
- Oh, D.Y.; Xie, J.X.; Vanderheijden, N.; Nauwynck, H.J. Isolation and characterization of a new population of nasal surface macrophages and their susceptibility to PRRSV-1 subtype 1 (LV) and subtype 3 (Lena). Vet. Res. 2020, 51, 21. [Google Scholar] [CrossRef]
- Xie, C.; Ha, Z.; Nan, F.; Zhang, Y.; Zhang, H.; Li, J.; Zhang, P.; Han, J.; Zhang, H.; Zhuang, X.; et al. Characterization of porcine reproductive and respiratory syndrome virus (ORF5 RFLP 1-7-4 viruses) in northern China. Microb. Pathog. 2020, 140, 103941. [Google Scholar] [CrossRef]
- Brinton, M.A.; Gulyaeva, A.A.; Balasuriya, U.B.R.; Dunowska, M.; Faaberg, K.S.; Goldberg, T.; Leung, F.C.C.; Nauwynck, H.J.; Snijder, E.J.; Stadejek, T.; et al. ICTV Virus Taxonomy Profile: 2021. J. Gen. Virol. 2021, 102, 001696. [Google Scholar] [CrossRef] [PubMed]
- Song, H.; Quan, J.; Li, C.; Liang, W.; Zhang, L.; Wang, S.; Lu, H.; Yang, K.; Zhou, D.; Li, P.; et al. Signaling Lymphocytic Activation Molecule Family Member 1 Inhibits Porcine Reproductive and Respiratory Syndrome Virus Replication. Animals 2022, 12, 3542. [Google Scholar] [CrossRef] [PubMed]
- Oh, D.; De Spiegelaere, W.; Nauwynck, H.J. Selection and validation of reference genes for RT-qPCR normalization of porcine alveolar macrophages (PAMs) for PRRSV studies. Sci. Rep. 2023, 13, 8840. [Google Scholar] [CrossRef] [PubMed]
- Tang, X.; Wang, C.; Sun, W.; Wu, W.; Sun, S.; Wan, J.; Zhu, G.; Ma, N.; Ma, X.; Xu, R.; et al. Evaluating anti-viral effect of Tylvalosin tartrate on porcine reproductive and respiratory syndrome virus and analyzing the related gene regulation by transcriptomics. Virol. J. 2023, 20, 79. [Google Scholar] [CrossRef]
- Ling, X.Y.; Cao, Z.G.; Sun, P.P.; Zhang, H.; Sun, Y.G.; Zhong, J.; Yin, W.; Fan, K.H.; Zheng, X.Z.; Li, H.Q.; et al. Target Discovery of Matrine against PRRSV in Marc-145 Cells via Activity-Based Protein Profiling. Int. J. Mol. Sci. 2023, 24, 11526. [Google Scholar] [CrossRef]
- Tian, Z.J.; An, T.Q.; Zhou, Y.J.; Peng, J.M.; Hu, S.P.; Wei, T.C.; Jiang, Y.F.; Xiao, Y.; Tong, G.Z. An attenuated live vaccine based on highly pathogenic porcine reproductive and respiratory syndrome virus (HP-PRRSV) protects piglets against HP-PRRS. Vet. Microbiol. 2009, 138, 34–40. [Google Scholar] [CrossRef]
- Yim-Im, W.; Huang, H.Y.; Park, J.; Wang, C.; Calzada, G.; Gauger, P.; Harmon, K.; Main, R.; Zhang, J.Q. Comparison of ZMAC and MARC-145 Cell Lines for Improving Porcine Reproductive and Respiratory Syndrome Virus Isolation from Clinical Samples. J. Clin. Microbiol. 2021, 59, 10–1128. [Google Scholar] [CrossRef] [PubMed]
- Guo, H.; Gaowa, W.; Zhao, H.Z.; Liu, C.Y.; Hou, L.A.; Wen, Y.J.; Wang, F.X. Glycosylated protein 4-deficient PRRSV in complementing cell line shows low virus titer. Res. Vet. Sci. 2023, 158, 84–95. [Google Scholar] [CrossRef] [PubMed]
- Yuan, L.L.; Zhu, Z.B.; Fan, J.; Liu, P.R.; Li, Y.H.; Li, Q.; Sun, Z.; Yu, X.L.; Lee, H.S.; Tian, K.G.; et al. High Pathogenicity of a Chinese NADC34-like PRRSV on Pigs. Microbiol. Spectr. 2022, 10, e01541-22. [Google Scholar] [CrossRef]
- Tian, D.; Wei, Z.; Zevenhoven-Dobbe, J.C.; Liu, R.; Tong, G.; Snijder, E.J.; Yuan, S. Arterivirus minor envelope proteins are a major determinant of viral tropism in cell culture. J. Virol. 2012, 86, 3701–3712. [Google Scholar] [CrossRef] [PubMed]
- Verheije, M.H.; Kroese, M.V.; van der Linden, I.F.A.; de Boer-Luijtze, E.A.; van Rijn, P.A.; Pol, J.M.A.; Meulenberg, J.J.M.; Steverink, P.J.G.M. Safety and protective efficacy of porcine reproductive and respiratory syndrome recombinant virus vaccines in young pigs. Vaccine 2003, 21, 2556–2563. [Google Scholar] [CrossRef]
- Xie, J.; Trus, I.; Oh, D.; Kvisgaard, L.K.; Rappe, J.C.F.; Ruggli, N.; Vanderheijden, N.; Larsen, L.E.; Lefevre, F.; Nauwynck, H.J. A Triple Amino Acid Substitution at Position 88/94/95 in Glycoprotein GP2a of Type 1 Porcine Reproductive and Respiratory Syndrome Virus (PRRSV1) Is Responsible for Adaptation to MARC-145 Cells. Viruses 2019, 11, 36. [Google Scholar] [CrossRef] [PubMed]
- Zhang, H.L.; Tang, Y.D.; Liu, C.X.; Xiang, L.R.; Zhang, W.L.; Leng, C.L.; Wang, Q.; An, T.Q.; Peng, J.M.; Tian, Z.J.; et al. Adaptions of field PRRSVs in Marc-145 cells were determined by variations in the minor envelope proteins GP2a-GP3. Vet. Microbiol. 2018, 222, 46–54. [Google Scholar] [CrossRef]
- Deng, H.; Xin, N.; Zeng, F.; Wen, F.; Yi, H.; Ma, C.; Huang, S.; Zhang, G.; Chen, Y. A novel amino acid site of N protein could affect the PRRSV-2 replication by regulating the viral RNA transcription. BMC Vet. Res. 2022, 18, 171. [Google Scholar] [CrossRef]
- Bai, W.J.; Wang, Z.J.; Sun, P.; Zhang, J.; Bao, H.F.; Cao, Y.M.; Chang, Y.Y.; Liu, Z.X.; Li, D.; Lu, Z.J. The molecular characteristic analysis of PRRSV GSWW/2015 strain and its pathogenicity to pigs. BMC Vet. Res. 2018, 14, 240. [Google Scholar] [CrossRef]
- Chen, Y.; He, S.; Sun, L.; Luo, Y.; Sun, Y.; Xie, J.; Zhou, P.; Su, S.; Zhang, G. Genetic variation, pathogenicity, and immunogenicity of highly pathogenic porcine reproductive and respiratory syndrome virus strain XH-GD at different passage levels. Arch. Virol. 2016, 161, 77–86. [Google Scholar] [CrossRef] [PubMed]
- Subramanian, B.; Gao, S.; Lercher, M.J.; Hu, S.; Chen, W.H. Evolview v3: A webserver for visualization, annotation, and management of phylogenetic trees. Nucleic Acids Res. 2019, 47, W270–W275. [Google Scholar] [CrossRef] [PubMed]
- Yu, Z.Q.; Yi, H.Y.; Ma, J.; Wei, Y.F.; Cai, M.K.; Li, Q.; Qin, C.X.; Chen, Y.J.; Han, X.L.; Zhong, R.T.; et al. Ginsenoside Rg1 Suppresses Type 2 PRRSV Infection via NF-kappaB Signaling Pathway In Vitro, and Provides Partial Protection against HP-PRRSV in Piglet. Viruses 2019, 11, 1045. [Google Scholar] [CrossRef] [PubMed]
- Zhao, K.; Gao, J.C.; Xiong, J.Y.; Guo, J.C.; Yang, Y.B.; Jiang, C.G.; Tang, Y.D.; Tian, Z.J.; Cai, X.H.; Tong, G.Z.; et al. Two Residues in NSP9 Contribute to the Enhanced Replication and Pathogenicity of Highly Pathogenic Porcine Reproductive and Respiratory Syndrome Virus. J. Virol. 2018, 92, e02209-17. [Google Scholar] [CrossRef] [PubMed]
- Zhang, H.W.; Xia, M.Q.; Wang, W.; Ju, D.C.; Cao, L.; Wu, B.; Wang, X.; Wu, Y.; Song, N.; Hu, J.X.; et al. An Attenuated Highly Pathogenic Chinese PRRS Viral Vaccine Confers Cross Protection to Pigs against Challenge with the Emerging PRRSV NADC30-Like Strain. Virol. Sin. 2018, 33, 153–161. [Google Scholar] [CrossRef]
- Wang, X.; Zhang, K.; Mo, Q.; Chen, G.; Lv, J.; Huang, J.; Pang, Y.; Wang, H.; Liu, W.; Huang, K.; et al. The Emergence and Pathogenesis of Recombinant Viruses Associated with NADC34-like Strains and the Predominant Circulating Strains of Porcine Reproductive and Respiratory Syndrome Virus in Southern China. Viruses 2022, 14, 1695. [Google Scholar] [CrossRef]
- Zhou, H.Y.; Ji, C.Y.; Fan, H.; Han, N.; Li, X.F.; Wu, A.; Qin, C.F. Convergent evolution of SARS-CoV-2 in human and animals. Protein Cell. 2021, 12, 832–835. [Google Scholar] [CrossRef] [PubMed]
- Ruedas, J.B.; Arnold, C.E.; Palacios, G.; Connor, J.H. Growth-Adaptive Mutations in the Ebola Virus Makona Glycoprotein Alter Different Steps in the Virus Entry Pathway. J. Virol. 2018, 92, e00820-18. [Google Scholar] [CrossRef] [PubMed]
- Zhou, L.; Wang, Z.C.; Ding, Y.P.; Ge, X.N.; Guo, X.; Yang, H.C. NADC30-like Strain of Porcine Reproductive and Respiratory Syndrome Virus, China. Emerg. Infect. Dis. 2015, 21, 2256–2257. [Google Scholar] [CrossRef]
- Liu, J.K.; Zhou, X.; Zhai, J.Q.; Li, B.; Wei, C.H.; Dai, A.L.; Yang, X.Y.; Luo, M.L. Genetic diversity and evolutionary characteristics of type 2 porcine reproductive and respiratory syndrome virus in southeastern China from 2009 to 2014. Arch. Virol. 2017, 162, 2603–2615. [Google Scholar] [CrossRef]
- Chen, J.; Yu, L.; Zhou, Y.; Yang, S.; Bai, Y.; Wang, Q.; Peng, J.; An, T.; Gao, F.; Li, L.; et al. Nonstructural Protein 2 Is Critical to Infection Efficiency of Highly Pathogenic Porcine Reproductive and Respiratory Syndrome Virus on PAMs and Influence Virulence In Vivo. Viruses 2022, 14, 2613. [Google Scholar] [CrossRef] [PubMed]
- Li, Y.; Jiao, D.; Jing, Y.; He, Y.; Han, W.; Li, Z.; Ma, Z.; Feng, Y.; Xiao, S. Genetic characterization and pathogenicity of a novel recombinant PRRSV from lineage 1, 8 and 3 in China failed to infect MARC-145 cells. Microb. Pathog. 2022, 165, 105469. [Google Scholar] [CrossRef] [PubMed]
- Chaudhari, J.; Leme, R.A.; Durazo-Martinez, K.; Sillman, S.; Workman, A.M.; Vu, H.L.X. A Single Amino Acid Substitution in Porcine Reproductive and Respiratory Syndrome Virus Glycoprotein 2 Significantly Impairs Its Infectivity in Macrophages. Viruses 2022, 14, 2822. [Google Scholar] [CrossRef] [PubMed]
- Zhu, J.; He, X.; Bernard, D.; Shen, J.; Su, Y.; Wolek, A.; Issacs, B.; Mishra, N.; Tian, X.; Garmendia, A.; et al. Identification of New Compounds against PRRSV Infection by Directly Targeting CD163. J. Virol. 2023, 97, e0005423. [Google Scholar] [CrossRef] [PubMed]
- Arjin, C.; Tateing, S.; Potapohn, N.; Arunorat, J.; Pringproa, K.; Lumsangkul, C.; Seel-Audom, M.; Ruksiriwanich, W.; Sringarm, K. Brazilin from Caesalpinia sappan inhibits viral infection against PRRSV via CD163(DeltaSRCR5) MARC-145 cells: An in silico and in vitro studies. Sci. Rep. 2022, 12, 21595. [Google Scholar] [CrossRef] [PubMed]
- Shi, C.; Liu, Y.; Ding, Y.; Zhang, Y.; Zhang, J. PRRSV receptors and their roles in virus infection. Arch. Microbiol. 2015, 197, 503–512. [Google Scholar] [CrossRef]
- Wu, X.; Qi, J.; Cong, X.; Chen, L.; Hu, Y.; Yoo, D.; Wang, G.; Tian, F.; Li, F.; Sun, W.; et al. Establishment and Characterization of a High and Stable Porcine CD163-Expressing MARC-145 Cell Line. Biomed. Res. Int. 2018, 2018, 4315861. [Google Scholar] [CrossRef]









| Name | Primer Sequence (5′-3′) | Product Size (bp) |
|---|---|---|
| XH-D-F | CAACTTGAAGGCCGCCATTTTACCT | 783 |
| XH-98Phe-R | GACACCTTATGGTGCCAAAACACCCCCAAAG | |
| XH-98Phe-F | GCGTCAACACCCTTTGGGGGTGTTTTGG | 3455 |
| XH-D-R | GCGAATTGGGGATCGAGGTACCCAGAA | |
| LYNA-D-F | GCTTACCTCCATCCAGGG | 875 |
| NA-98Phe-R | TATGGTGCCAAAACATCCCCAAG | |
| NA-98Phe-F | CCCTTGGGGATGTTTTGGCACCATAGG | 3519 |
| LYNA-D-R | GGCGATTAAGTTGGGTAACG | |
| LYNA-A-F | TACACCGGTAACGTCATGACGTATAGGTGTTGGC | 2185 |
| LYNA-A-R | AACAACCACTCCAACTCCAG | |
| LYNA-B-F | CCTCCGCGGTGCAGCAAGTCCTGAAG | 5130 |
| Name | Primer Sequence (5′-3′) | Product Size (bp) |
|---|---|---|
| RTNsp9-F | CCCTCCATGCCAAACTACCAC | 194 |
| RTNsp9-R | TTGTCTTCTTTGGGTCCGTCT | |
| GAPDH-F | CTGCCGCCTGGAGAAACCT | 250 |
| GAPDH-R | GCTGTAGCCAAATTCATTGTCG | |
| qNsp9-F | CCTGCAATTGTCCGCTGGTTTG | 146 |
| qNsp9-R | GACGACAGGCCACCTCTCTTAG | |
| Probe-Nsp9 | FAM-ACTGCTGCCACGATTTACTGGTCACGCAGT-BHQ1 |
| Virus Name | GenBank Accession No. | 98th Animo Acid of GP2a | Able to Adapt to Marc-145 Cells | |
|---|---|---|---|---|
| 1 | XH-GD | EU624117.1 | L a | Y c |
| 2 | JX2006 | EU880432.2 | L | Y |
| 3 | HUB1 | EF075945.1 | L | Y |
| 4 | JXA1 | EF112445.1 | L | Y |
| 5 | NT1 | KP179402.1 | L | Y |
| 6 | 11SH-GD | JX235365.1 | L | Y |
| 7 | 10QY-GD | JX215552.1 | L | Y |
| 8 | 10HD-GD | JX215553.1 | L | Y |
| 9 | 10SS-GD | JX192638.1 | L | Y |
| 10 | Henan-A13 | KJ819935.1 | F b | N d |
| 11 | Henan-A14 | KJ819936.1 | F | N |
| 12 | HLJA1 | KT351739.1 | F | N |
| 13 | MY-376 | KJ609517.1 | F | N |
| 14 | HeNan-A9 | KJ546412.1 | F | N |
| 15 | HB-1/3.9 | EU360130.1 | L | Y |
| 16 | HB-1(sh)/2002 | AY150312.1 | L | Y |
| 17 | Henan-A12 | KJ819934.1 | F | N |
| 18 | MY-486 | KJ609516.1 | F | N |
| 19 | CH-1a | AY032626.1 | L | Y |
| 20 | HB-2(sh)/2002 | AY262352.1 | L | Y |
| 21 | GDST-P1 | - | F | N |
| 22 | GDSTF35 | - | F | N |
| 23 | GDST-P10 | - | L | Y |
| 23 | YNHZ1138 | - | F | N |
| 24 | GDSTBS1 | - | F | N |
| 25 | LYNA-P10 | - | L | Y |
| 26 | LYNA-P1 | - | F | N |
| 27 | TJZH-1607 | MH651748.1 | F | N |
| 28 | CHsx1401 | KP861625.1 | F | N |
| 29 | LYNA-N | - | F | N |
| 30 | GDTSFeb14-N | - | F | N |
| 31 | SD99-1606-N | MH651745.1 | F | N |
| 32 | HZ1-3 | - | F | N |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Chen, Y.; Huo, Z.; Jiang, Q.; Qiu, Z.; Shao, Z.; Ma, C.; Zhang, G.; Li, Q. The Significance of the 98th Amino Acid in GP2a for Porcine Reproductive and Respiratory Syndrome Virus Adaptation in Marc-145 Cells. Viruses 2024, 16, 711. https://doi.org/10.3390/v16050711
Chen Y, Huo Z, Jiang Q, Qiu Z, Shao Z, Ma C, Zhang G, Li Q. The Significance of the 98th Amino Acid in GP2a for Porcine Reproductive and Respiratory Syndrome Virus Adaptation in Marc-145 Cells. Viruses. 2024; 16(5):711. https://doi.org/10.3390/v16050711
Chicago/Turabian StyleChen, Yao, Zhantang Huo, Qi Jiang, Zhiheng Qiu, Zheng Shao, Chunquan Ma, Guihong Zhang, and Qi Li. 2024. "The Significance of the 98th Amino Acid in GP2a for Porcine Reproductive and Respiratory Syndrome Virus Adaptation in Marc-145 Cells" Viruses 16, no. 5: 711. https://doi.org/10.3390/v16050711
APA StyleChen, Y., Huo, Z., Jiang, Q., Qiu, Z., Shao, Z., Ma, C., Zhang, G., & Li, Q. (2024). The Significance of the 98th Amino Acid in GP2a for Porcine Reproductive and Respiratory Syndrome Virus Adaptation in Marc-145 Cells. Viruses, 16(5), 711. https://doi.org/10.3390/v16050711
