Application of CRISPR/Cas9 for Rapid Genome Editing of Pseudorabies Virus and Bovine Herpesvirus-1
Abstract
:1. Introduction
2. Materials and Methods
2.1. Cell Lines and Viruses
2.2. Construction of Recombinant Plasmid and Guide RNAs
2.3. Cell Transfection
2.4. Generation of Virus Mutants
2.5. Plaque Purification
2.6. Identification of Recombinant Viruses by PCR
2.7. Growth Kinetics of Recombinant Viruses
2.8. Virus Infectivity in Mice
2.9. Detection of Virus-Specific Antibodies
2.10. Statistical Analysis
3. Results
3.1. Identification and Validation of TK Promotor and PRV Rescue from Genomic DNA
3.2. Construction of Recombinant Viruses Using CRISPR/Cas9 System
3.3. Growth Kinetics of the Recombinant Viruses
3.4. Evaluation of Virus Attenuation
4. Discussion
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Tyler, S.D.; Peters, G.A.; Severini, A. Complete Genome Sequence of Cercopithecine Herpesvirus 2 (SA8) and Comparison with Other Simplexviruses. Virology 2005, 331, 429–440. [Google Scholar] [CrossRef] [PubMed]
- Davison, A.J. Herpesviruses: General Features; Mahy, B.W.J., Van Regenmortel, M.H.V., Eds.; Academic Press: Oxford, UK, 2008; pp. 430–436. ISBN 978-0-12-374410-4. [Google Scholar]
- Maclachlan, N.J.; Dubovi, E.J. Fenner’s Veterinary Virology: Fourth Edition; Academic Press: Oxford, UK, 2010; ISBN 9780123751584. [Google Scholar]
- Bo, Z.; Miao, Y.; Xi, R.; Gao, X.; Miao, D.; Chen, H.; Jung, Y.S.; Qian, Y.; Dai, J. Emergence of a Novel Pathogenic Recombinant Virus from Bartha Vaccine and Variant Pseudorabies Virus in China. Transbound. Emerg. Dis. 2021, 68, 1454–1464. [Google Scholar] [CrossRef]
- Tan, L.; Yao, J.; Lei, L.; Xu, K.; Liao, F.; Yang, S.; Yang, L.; Shu, X.; Duan, D.; Wang, A. Emergence of a Novel Recombinant Pseudorabies Virus Derived From the Field Virus and Its Attenuated Vaccine in China. Front. Vet. Sci. 2022, 9, 872002. [Google Scholar] [CrossRef] [PubMed]
- Kumar, N.; Chander, Y.; Riyesh, T.; Khandelwal, N.; Kumar, R.; Kumar, H.; Tripathi, B.N.; Barua, S. Isolation and Characterization of Bovine Herpes Virus 5 (BoHV5) from Cattle in India. PLoS ONE 2020, 15, e0232093. [Google Scholar] [CrossRef]
- Heming, J.D.; Conway, J.F.; Homa, F.L. Cell Biology of Herpes Viruses; Springer: Cham, Switzerland, 2017; Volume 223, ISBN 9783319531670. [Google Scholar]
- Li, X.; Heyer, W.-D. Homologous Recombination in DNA Reapir and DNA. Cell Res. 2008, 18, 99–113. [Google Scholar] [PubMed]
- Urnov, F.D.; Rebar, E.J.; Holmes, M.C.; Zhang, H.S.; Gregory, P.D. Genome Editing with Engineered Zinc Finger Nucleases. Nat. Rev. Genet. 2010, 11, 636–646. [Google Scholar] [CrossRef]
- Miller, J.C.; Tan, S.; Qiao, G.; Barlow, K.A.; Wang, J.; Xia, D.F.; Meng, X.; Paschon, D.E.; Leung, E.; Hinkley, S.J.; et al. A TALE Nuclease Architecture for Efficient Genome Editing. Nat. Biotechnol. 2011, 29, 143–148. [Google Scholar] [CrossRef]
- Zhang, F.; Wen, Y.; Guo, X. CRISPR/Cas9 for Genome Editing: Progress, Implications and Challenges. Hum. Mol. Genet. 2014, 23, 40–46. [Google Scholar] [CrossRef]
- Barrangou, R. The Roles of CRISPR-Cas Systems in Adaptive Immunity and Beyond. Curr. Opin. Immunol. 2015, 32, 36–41. [Google Scholar] [CrossRef]
- Hsu, P.D.; Lander, E.S.; Zhang, F. Development and Applications of CRISPR-Cas9 for Genome Engineering. Cell 2014, 157, 1262–1278. [Google Scholar] [CrossRef]
- Mettenleiter, T.C. Aujeszky’s Disease (Pseudorabies) Virus: The Virus and Molecular Pathogenesis—State of the Art, June 1999. Vet. Res. 2000, 31, 99–115. [Google Scholar] [CrossRef] [PubMed]
- Wang, D.; Tao, X.; Fei, M.; Chen, J.; Guo, W.; Li, P.; Wang, J. Human Encephalitis Caused by Pseudorabies Virus Infection: A Case Report. J. Neurovirol. 2020, 26, 442–448. [Google Scholar] [CrossRef] [PubMed]
- Zhou, M.; Abid, M.; Cao, S.; Zhu, S. Recombinant Pseudorabies Virus Usage in Vaccine Development against Swine Infectious Disease. Viruses 2023, 15, 370. [Google Scholar] [CrossRef] [PubMed]
- Qiu, H.-J.; Tian, Z.-J.; Tong, G.-Z.; Zhou, Y.-J.; Ni, J.-Q.; Luo, Y.-Z.; Cai, X.-H. Protective Immunity Induced by a Recombinant Pseudorabies Virus Expressing the GP5 of Porcine Reproductive and Respiratory Syndrome Virus in Piglets. Vet. Immunol. Immunopathol. 2005, 106, 309–319. [Google Scholar] [CrossRef] [PubMed]
- Liu, C.-Y.; Guo, H.; Zhao, H.-Z.; Hou, L.-N.; Wen, Y.-J.; Wang, F.-X. Recombinant Bovine Herpesvirus Type I Expressing the Bovine Viral Diarrhea Virus E2 Protein Could Effectively Prevent Infection by Two Viruses. Viruses 2022, 14, 1618. [Google Scholar] [CrossRef] [PubMed]
- Batra, S.A.; Shanthalingam, S.; Donofrio, G.; Haldorson, G.J.; Chowdhury, S.; White, S.N.; Srikumaran, S. Immunization of Bighorn Sheep against Mannheimia Haemolytica with a Bovine Herpesvirus 1-Vectored Vaccine. Vaccine 2017, 35, 1630–1636. [Google Scholar] [CrossRef] [PubMed]
- Van Cleemput, J.; Koyuncu, O.O.; Laval, K.; Engel, E.A.; Enquist, L.W. CRISPR/Cas9-Constructed Pseudorabies Virus Mutants Reveal the Importance of UL13 in Alphaherpesvirus Escape from Genome Silencing. J. Virol. 2021, 95, e02286-20. [Google Scholar] [CrossRef]
- Zhao, Y.; Wang, L.-Q.; Zheng, H.-H.; Yang, Y.-R.; Liu, F.; Zheng, L.-L.; Jin, Y.; Chen, H.-Y. Construction and Immunogenicity of a GE/GI/TK-Deleted PRV Based on Porcine Pseudorabies Virus Variant. Mol. Cell. Probes 2020, 53, 101605. [Google Scholar] [CrossRef]
- Tang, Y.-D.; Liu, J.-T.; Wang, T.-Y.; An, T.-Q.; Sun, M.-X.; Wang, S.-J.; Fang, Q.-Q.; Hou, L.-L.; Tian, Z.-J.; Cai, X.-H. Live Attenuated Pseudorabies Virus Developed Using the CRISPR/Cas9 System. Virus Res. 2016, 225, 33–39. [Google Scholar] [CrossRef]
- Zhao, C.; Gao, J.; Wang, Y.; Ji, L.; Qin, H.; Hu, W.; Yang, Y. A Novel Rabies Vaccine Based on a Recombinant Bovine Herpes Virus Type 1 Expressing Rabies Virus Glycoprotein. Front. Microbiol. 2022, 13, 931043. [Google Scholar] [CrossRef]
- Dai, H.; Wu, J.; Yang, H.; Guo, Y.; Di, H.; Gao, M.; Wang, J. Construction of BHV-1 UL41 Defective Virus Using the CRISPR/Cas9 System and Analysis of Viral Replication Properties. Front. Cell. Infect. Microbiol. 2022, 12, 942987. [Google Scholar] [CrossRef] [PubMed]
- Kit, S.; Kit, M.; Pirtle, E.C. Attenuated Properties of Thymidine Kinase-Negative Deletion Mutant of Pseudorabies Virus. Am. J. Vet. Res. 1985, 46, 1359–1367. [Google Scholar] [PubMed]
- McGregor, S.; Easterday, B.C.; Kaplan, A.S.; Ben-Porat, T. Vaccination of Swine with Thymidine Kinase-Deficient Mutants of Pseudorabies Virus. Am. J. Vet. Res. 1985, 46, 1494–1497. [Google Scholar] [PubMed]
- Husak, P.J.; Kuo, T.; Enquist, L.W. Pseudorabies Virus Membrane Proteins GI and GE Facilitate Anterograde Spread of Infection in Projection- Specific Neurons in the Rat. J. Virol. 2000, 74, 10975–10983. [Google Scholar] [CrossRef] [PubMed]
- Tirabassi, R.S.; Townley, R.A.; Eldridge, M.G.; Enquist, L.W. Characterization of Pseudorabies Virus Mutants Expressing Carboxy-Terminal Truncations of GE: Evidence for Envelope Incorporation, Virulence, and Neurotropism Domains. J. Virol. 1997, 71, 6455–6464. [Google Scholar] [CrossRef] [PubMed]
- Guo, H.; Zhou, R.; Xi, Y.; Xiao, S.; Chen, H. Transcriptional Suppression of IE180 and TK Promoters by the EP0 of Pseudorabies Virus Strains Ea and Fa. Virus Genes 2009, 38, 269–275. [Google Scholar] [CrossRef] [PubMed]
- Curanovic, D.; Enquist, L.W. Virion-Incorporated Glycoprotein B Mediates Transneuronal Spread of Pseudorabies Virus. J. Virol. 2009, 83, 7796–7804. [Google Scholar] [CrossRef] [PubMed]
- Weninger, A.; Hatzl, A.M.; Schmid, C.; Vogl, T.; Glieder, A. Combinatorial Optimization of CRISPR/Cas9 Expression Enables Precision Genome Engineering in the Methylotrophic Yeast Pichia Pastoris. J. Biotechnol. 2016, 235, 139–149. [Google Scholar] [CrossRef]
- Gratz, S.J.; Rubinstein, C.D.; Harrison, M.M.; Wildonger, J.; O’Connor-Giles, K.M. CRISPR-Cas9 Genome Editing in Drosophila. Curr. Protoc. Mol. Biol. 2015, 2015, 31.2.1–31.2.20. [Google Scholar] [CrossRef]
- Maresch, R.; Mueller, S.; Veltkamp, C.; Öllinger, R.; Friedrich, M.; Heid, I.; Steiger, K.; Weber, J.; Engleitner, T.; Barenboim, M.; et al. Multiplexed Pancreatic Genome Engineering and Cancer Induction by Transfection-Based CRISPR/Cas9 Delivery in Mice. Nat. Commun. 2016, 7, 10770. [Google Scholar] [CrossRef]
- Xu, A.; Qin, C.; Lang, Y.; Wang, M.; Lin, M.; Li, C.; Zhang, R.; Tang, J. A Simple and Rapid Approach to Manipulate Pseudorabies Virus Genome by CRISPR/Cas9 System. Biotechnol. Lett. 2015, 37, 1265–1272. [Google Scholar] [CrossRef] [PubMed]
- Tang, Y.D.; Liu, J.T.; Fang, Q.Q.; Wang, T.Y.; Sun, M.X.; An, T.Q.; Tian, Z.J.; Cai, X.H. Recombinant Pseudorabies Virus (PRV) Expressing Firefly Luciferase Effectively Screened for Crispr/Cas9 Single Guide Rnas and Antiviral Compounds. Viruses 2016, 8, 90. [Google Scholar] [CrossRef] [PubMed]
- Liu, C.Y.; Jin, M.; Guo, H.; Zhao, H.Z.; Hou, L.N.; Yang, Y.; Wen, Y.J.; Wang, F.X. Concurrent Gene Insertion, Deletion, and Inversion during the Construction of a Novel Attenuated BoHV-1 Using CRISPR/Cas9 Genome Editing. Vet. Sci. 2022, 9, 166. [Google Scholar] [CrossRef] [PubMed]
Primers and sgRNAs | Sequences (5′ to 3′) |
---|---|
TK-L-F | AAAACGACGGCCAGTGAATTCAGCACGCTGTGGCCCTCCAG |
TK-L-R | CGCCCTTGCTCACCATATCCGCTGCCACAACCGCTTCTAC |
TK-R-F | GACGAGCTGTACAAGTAAATGGAGACCGCGACGGAGGCAAC |
TK-R-R | GACCATGATTACGCCAAGCTTAGGTTGGCCAGGGTGGCGTC |
eGFP-F | CGCCCTTGCTCACCATCCCGGCGCGCTTCCGGGCGG |
eGFP-R | GTTGCCTCCGTCGCGGTCTCCATTTACTTGTACAGCTCGTC |
sgRNA-TK1-F | CACCGATCTACCTCGACGGCGCCTA |
sgRNA-TK1-R | AAACTAGGCGCCGTCGAGGTAGATC |
sgRNA-TK2-F | CACCGCGCGTCTCCACCGTCGACCT |
sgRNA-TK2-R | AAACAGGTCGACGGTGGAGACGCGC |
TK-check-F | TGGCCGGTATTTACGATGCG |
TK-check-R | GCGCTGATGTCCCCGACGATG |
eGFP-check-F | CAGTGCTTCAGCCGCTACCC |
eGFP-check-R | TTCACCTTGATGCCGTTCTTC |
gIE-L-F | AAAACGACGGCCAGTGAATTCGCGTTTACAATAAACAG |
gIE-L-R | GATTACTATTAATAACTAGCTAGGAGCAAAGGGG |
CMVp-eGFP-F | CCCCTTTGCTCCTAGCTAGTTATTAATAGTAATC |
CMVp-eGFP-R | GATTACTATTAATAACTAGCTAGGAGCAAAGGGG |
gIE-R-F | CCCCTTTGCTCCTAGCTAGTTATTAATAGTAATC |
gIE-R-R | GACCATGATTACGCCAAGCTTACGGCGACGACGACGTGTTC |
sgRNA-gIE1-F | CACCGATCTCCCGCCCCGCGCGGCT |
sgRNA-gIE1-R | AAACAGCCGCGCGGGGCGGGAGATC |
sgRNA-gIE2-F | CACCGCGCGCTTGGACTCGCGGGAC |
sgRNA-gIE2-R | AAACGTCCCGCGAGTCCAAGCGCGC |
gI-check-F | GTCGAGCTGCTGCGCTACCAC |
gI-check-R | AAACGCGGCCAAGGGAAAGAC |
gE-check-F | ACCTGCGTCCCGCCAATAAC |
gE-check-R | ACCAGTCCCGCGAGTCCAAG |
OD450 | gB | gE | ||||||
---|---|---|---|---|---|---|---|---|
Positive | 0.1032 + | 0.1028 + | 0.0821 + | 0.1091 + | ||||
Negative | 1.4816 − | 1.4900 − | 1.0886 − | 1.0786 − | ||||
DMEM | 1.3086 − | 1.3156 − | 1.0434 − | 0.9498 − | ||||
BHV-1 | 0.2086 + | 0.1647 + | 0.3496 + | 0.1499 + | 0.6639 + | 0.6843 + | 0.5320 + | 0.6685 + |
BHVmu | 0.3511 + | 0.2285 + | 0.3885 + | 0.3517 + | 0.9930 − | 1.0471 − | 1.0420 − | 1.0128 − |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Yu, W.; Liu, J.; Liu, Y.; Forlenza, M.; Chen, H. Application of CRISPR/Cas9 for Rapid Genome Editing of Pseudorabies Virus and Bovine Herpesvirus-1. Viruses 2024, 16, 311. https://doi.org/10.3390/v16020311
Yu W, Liu J, Liu Y, Forlenza M, Chen H. Application of CRISPR/Cas9 for Rapid Genome Editing of Pseudorabies Virus and Bovine Herpesvirus-1. Viruses. 2024; 16(2):311. https://doi.org/10.3390/v16020311
Chicago/Turabian StyleYu, Wanqi, Jingyi Liu, Yingnan Liu, Maria Forlenza, and Hongjun Chen. 2024. "Application of CRISPR/Cas9 for Rapid Genome Editing of Pseudorabies Virus and Bovine Herpesvirus-1" Viruses 16, no. 2: 311. https://doi.org/10.3390/v16020311
APA StyleYu, W., Liu, J., Liu, Y., Forlenza, M., & Chen, H. (2024). Application of CRISPR/Cas9 for Rapid Genome Editing of Pseudorabies Virus and Bovine Herpesvirus-1. Viruses, 16(2), 311. https://doi.org/10.3390/v16020311