scTRIM44 Positively Regulated Siniperca Chuatsi Rhabdovirus Through RIG-I- and MDA5-Mediated Interferon Signaling
Abstract
1. Introduction
2. Materials and Methods
2.1. Cells and Virus Strains
2.2. Molecular Analysis of scTRIM44
2.3. The Distribution of scTRIM44 mRNA in Mandarin Fish
2.4. The Changes in scTRIM44 mRNA Post-SCRV, -ISKNV, and -LMBV Infection
2.5. The Effect of scTRIM44 on SCRV, ISKNV, and LMBV Infection
2.6. TaqMan Real-Time PCR and Quantitative RT-PCR
2.7. Statistical Analysis
3. Results
3.1. Molecular Organization and Characteristics of ScTRIM44
3.2. Expression of scTRIM44 in Siniperca chuatsi
3.3. The Effect of SCRV Infection on scTRIM44
3.4. The Changes in scTRIM44 Post-ISKNV or -LMBV Infection
3.5. scTRIM44 Positively Regulated SCRV Infection but Did Not Regulate ISKNV and LMBV Infection
3.6. scTRIM44 Positively Regulated the RIG-I- or MDA5-Mediated Interferon Pathway
4. Discussion
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Bao, Y.; Zhang, Y.; Xu, W. Effects of Different Freezing Rate and Frozen Storage Temperature on the Quality of Large-Mouth Bass (Micropterus salmoides). Molecules 2023, 28, 5432. [Google Scholar] [CrossRef] [PubMed]
- Zhao, X.; Petrashen, A.P.; Sanders, J.A.; Peterson, A.L.; Sedivy, J.M. SLC1A5 glutamine transporter is a target of MYC and mediates reduced mTORC1 signaling and increased fatty acid oxidation in long-lived Myc hypomorphic mice. Aging Cell 2019, 18, e12947. [Google Scholar] [CrossRef]
- Wang, Y.Q.; Lü, L.; Weng, S.P.; Huang, J.N.; Chan, S.-M.; He, J.G. Molecular epidemiology and phylogenetic analysis of a marine fish infectious spleen and kidney necrosis virus-like (ISKNV-like) virus. Arch. Virol. 2007, 152, 763–773. [Google Scholar] [CrossRef]
- Xu, Z.; Liao, J.; Zhang, D.; Liu, S.; Zhang, L.; Kang, S.; Xu, L.; Chen, H.; Peng, W.; Zhou, S.; et al. Isolation, Characterization, and Transcriptome Analysis of an ISKNV-Like Virus from Largemouth Bass. Viruses 2023, 15, 398. [Google Scholar] [CrossRef]
- Fu, X.; Ming, Y.; Li, C.; Niu, Y.; Lin, Q.; Liu, L.; Liang, H.; Huang, Z.; Li, N. Siniperca chuatsi rhabdovirus (SCRV) induces antophagy via PI3K/Akt-mTOR pathway in CPB cells. Fish Shellfish Immunol. 2020, 2020, 381–388. [Google Scholar] [CrossRef] [PubMed]
- He, J.G.; Denga, M.; Weng, S.P.; Lia, Z.; Zhou, S.Y.; Long, Q.X.; Wang, X.Z.; Chanb, S.M. Complete Genome Analysis of the Mandarin Fish Infectious Spleen and Kidney Necrosis Iridovirus. Virology 2001, 291, 126–139. [Google Scholar] [CrossRef]
- Yu, X.-D.; Ke, F.; Zhang, Q.-Y.; Gui, J.-F. Genome Characteristics of Two Ranavirus Isolates from Mandarin Fish and Largemouth Bass. Pathogens 2023, 12, 730. [Google Scholar] [CrossRef] [PubMed]
- Tao, J.-J.; Zhou, G.-Z.; Gui, J.-F.; Zhang, Q.-Y. Genomic sequence of mandarin fish rhabdovirus with an unusual small non-transcriptional ORF. Virus Res. 2008, 132, 86–96. [Google Scholar] [CrossRef]
- Koepke, L.; Gack, M.U.; Sparrer, K.M. The antiviral activities of TRIM proteins. Curr. Opin. Microbiol. 2021, 59, 50–57. [Google Scholar] [CrossRef]
- Short, K.M.; Cox, T.C. Subclassification of the RBCC/TRIM Superfamily Reveals a Novel Motif Necessary for Microtubule Binding. J. Biol. Chem. 2006, 281, 8970–8980. [Google Scholar] [CrossRef]
- Uchil, P.D.; Hinz, A.; Siegel, S.; Coenen-Stass, A.; Pertel, T.; Luban, J.; Mothes, W. TRIM Protein-Mediated Regulation of Inflammatory and Innate Immune Signaling and Its Association with Antiretroviral Activity. J. Virol. 2012, 87, 257–272. [Google Scholar] [CrossRef] [PubMed]
- Yu, Y.; Liu, J.; Zhang, J.; Hu, Y.; Yang, Y.; Huang, Y.; Qin, Q. Fish TRIM32 functions as a critical antiviral molecule against iridovirus and nodavirus. Fish Shellfish Immunol. 2017, 60, 33–43. [Google Scholar] [CrossRef]
- Yu, Y.; Huang, X.; Liu, J.; Zhang, J.; Hu, Y.; Yang, Y.; Huang, Y.; Qin, Q. Fish TRIM35 negatively regulates the interferon signaling pathway in response to grouper nodavirus infection. Fish Shellfish Immunol. 2017, 69, 142–152. [Google Scholar]
- Niu, Y.; Fu, X.; Lin, Q.; Liang, H.; Luo, X.; Zuo, S.; Liu, L.; Li, N. The composition and antiviral activity of scTRIM59 in Mandarin fish. Fish Shellfish Immunol. 2022, 130, 86–92. [Google Scholar] [CrossRef] [PubMed]
- Kawabata, H.; Azuma, K.; Ikeda, K.; Sugitani, I.; Kinowaki, K.; Fujii, T.; Osaki, A.; Saeki, T.; Horie-Inoue, K.; Inoue, S. TRIM44 Is a Poor Prognostic Factor for Breast Cancer Patients as a Modulator of NF-κB Signaling. Int. J. Mol. Sci. 2017, 18, 1931. [Google Scholar] [CrossRef]
- Luo, Q.; Lin, H.; Ye, X.; Huang, J.; Lu, S.; Xu, L. Trim44 facilitates the migration and invasion of human lung cancer cells via the NF-κB signaling pathway. Int. J. Clin. Oncol. 2014, 20, 508–517. [Google Scholar] [CrossRef]
- Zhu, H.; Wang, G.; Sun, Q.; Zhu, H.; Xu, A. Elevation of TRIM44 potentiates propagation of gastric cancer stem cells. Genes Dis. 2022, 9, 1156–1159. [Google Scholar] [CrossRef]
- Liu, S.; Meng, F.; Ding, J.; Ji, H.; Lin, M.; Zhu, J.; Ma, R. High TRIM44 expression as a valuable biomarker for diagnosis and prognosis in cervical cancer. Biosci. Rep. 2019, 39, BSR20181639. [Google Scholar] [CrossRef]
- Yang, B.; Wang, J.; Wang, Y.; Zhou, H.; Wu, X.; Tian, Z.; Sun, B. Novel Function of Trim44 Promotes an Antiviral Response by Stabilizing VISA. J. Immunol. 2013, 190, 3613–3619. [Google Scholar] [CrossRef]
- Hou, F.; Sun, L.; Zheng, H.; Skaug, B.; Jiang, Q.-X.; Chen, Z.J. MAVS Forms Functional Prion-like Aggregates to Activate and Propagate Antiviral Innate Immune Response. Cell 2011, 146, 448–461. [Google Scholar] [CrossRef]
- Zheng, J.; Zhang, Y.; Zhi, L.; Lv, S.; Xiao, L.; Huang, X.; Huang, Y.; Qin, Q.; Huang, Y.; Qin, Q. The novel gene TRIM44L from orange-spotted grouper negatively regulates the interferon response. Fish Shellfish Immunol. 2019, 92, 746–755. [Google Scholar] [CrossRef] [PubMed]
- Fu, X.; Li, N.; Lai, Y.; Luo, X.; Wang, Y.; Shi, C.; Huang, Z.; Wu, S.; Su, J. A novel fish cell line derived from the brain of Chinese perch Siniperca chuatsi: Development and characterization. J. Fish Biol. 2015, 86, 32–45. [Google Scholar] [CrossRef] [PubMed]
- Fu, X.; Lin, Q.; Liang, H.; Liu, L.; Huang, Z.; Li, N.; Su, J. The biological features and genetic diversity of novel fish rhabdovirus isolates in China. Arch. Virol. 2017, 162, 2829–2834. [Google Scholar] [CrossRef]
- Fu, X.; Li, W.; Liu, C.; Luo, X.; Lin, Q.; Niu, Y.; Liang, H.; Ma, B.; Li, N. A naturaly attenuated largemouth bass ranavirus strain provided protection for Micropterus salmoides by immersion immunization. Fish Shellfish Immunol. 2024, 153, 109871. [Google Scholar] [CrossRef]
- Van Tol, S.; Hage, A.; Giraldo, M.I.; Bharaj, P.; Rajsbaum, R. The TRIMendous Role of TRIMs in Virus–Host Interactions. Vaccines 2017, 5, 23. [Google Scholar] [CrossRef] [PubMed]
- Jin, Y.; Jia, K.; Zhang, W.; Xiang, Y.; Jia, P.; Liu, W.; Yi, M. Zebrafish TRIM25 Promotes Innate Immune Response to RGNNV Infection by Targeting 2CARD and RD Regions of RIG-I for K63-Linked Ubiquitination. Front. Immunol. 2019, 10, 2805. [Google Scholar] [CrossRef]
- Yu, T.; Kuang, H.; Chen, J.; Lin, X.; Wu, Y.; Chen, K.; Zhang, M.; Zhang, W.; Wen, Z. Tripartite-motif family protein 35–28 regulates microglia development by preventing necrotic death of microglial precursors in zebrafish. J. Biol. Chem. 2020, 295, 8846–8856. [Google Scholar] [CrossRef]
- Cai, C.; Tang, Y.-D.; Zhai, J.; Zheng, C. The RING finger protein family in health and disease. Signal Transduct. Target. Ther. 2022, 7, 300. [Google Scholar] [CrossRef]
- Yamada, Y.; Takayama, K.; Fujimura, T.; Ashikari, D.; Obinata, D.; Takahashi, S.; Ikeda, K.; Kakutani, S.; Urano, T.; Fukuhara, H.; et al. A novel prognostic factor TRIM44 promotes cell proliferation and migration, and inhibits apoptosis in testicular germ cell tumor. Cancer Sci. 2017, 108, 32–41. [Google Scholar] [CrossRef]
- Wu, J.; Guo, N.-Z.; Cui, L.-L.; Wang, W.; Xiong, C.-Q.; Zhang, X.-Y. Correlation between tripartite motif-containing protein 44 protein expression and the prognosis of postoperative patients exhibiting skin squamous cell carcinoma. Medicine 2018, 97, e13021. [Google Scholar] [CrossRef]
- He, H.; Cai, T.; Chen, Q.; Chen, Z.; Zhang, B.; Chen, C.; Wang, Y.; Liu, Y.; Wang, Y.; Luo, Y.; et al. TRIM44 Promotes Rabies Virus Replication by Autophagy-Dependent Mechanism. Int. J. Mol. Sci. 2024, 25, 4616. [Google Scholar] [CrossRef] [PubMed]
- Leiva-Rebollo, R.; Labella, A.M.; Gémez-Mata, J.; Castro, D.; Borrego, J.J. Fish Iridoviridae: Infection, vaccination and immune response. Vet. Res. 2024, 55, 88. [Google Scholar] [CrossRef] [PubMed]







| Primer Name | Sequence | |
|---|---|---|
| TRIM44-F | 5′ ATGGACCACAAAGGGGAAC 3′ | |
| TRIM44-R | 5′ TCAGGGGGCGTGGTCCATG 3′ | |
| pCMV-TRIM44-F | 5′ CGGAATTCATCGACCACAAAGGGGAAC 3′ | EcoRI |
| pCMV-TRIM44-R | 5′ GGGGTACCTCAGGGGGCGTGGTCCATC 3′ | KpnI |
| ScTRIM44-RT-F | ACTTGGCACCAAAAGAGACTCC | |
| ScTRIM44-RT-R | TCTCACTGTGTCCCTCTTCCCA | |
| TRIM44-1-sense | GCUGAAACAAGAGGAACUUTT | Trim44-siRNA |
| TRIM44-1-antisense | UAGUGCCAAGUCCAUUAGCTT | |
| TRIM44-2-sense | GCUAAUGGACUUGGCACUATT | |
| TRIM44-2-antisense | UAGUGCCAAGUCCAUUAGCTT | |
| TRIM44-3-sense | GGAGGAGAAGAGGACCCUUTT | |
| TRIM44-3-antisense | AAGGGUCCUCUUCUCCUCCTT | |
| NC-sense | UUCUCCGAACGUGUCACGUTT | |
| NC-antisense | ACGUGACACGUUCGGAGAATT | |
| IRF3-RT-F | GTCTACAGCCCTGAACTCAACGG | RT-PCR |
| IRF3-RT-R | AAATCTCTTGGGGCTGTGTGGTC | |
| IRF7-RT-F | AGTTCACCTCTGCAGCCATGTAT | |
| IRF7-RT-R | GTTAAGGACGCGGTTGGTGAAAT | |
| RIG-I-RT-F | AAGTGCAAGATGTTTGCGTGTC | |
| RIG-I-RT-R | GAAGTTGATGGGCTTTCTGTGAG | |
| MAD5-RT-F | CTCCCGACAGGAAGTGGTAAA | |
| MAD5-RT-R | GCGGAATAATGCTGCTCAAC | |
| IFN-α-RT-F | TGAGGATGCTGGAGTGACC | |
| IFN-α-RT-R | GCCTGCCGAGTAACATTGAC | |
| IFN-β-RT-F | ACGGATCTCAAGTCAGGGTC | |
| IFN-β-RT-R | TGAGTAGGGTATGAGGGCATT | |
| 18S-F | CATTCGTATTGTGCCGCTAGA | |
| 18S-R | CAAATGCTTTCGCTTTGGTC |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Niu, Y.; Yang, X.; Liang, H.; Luo, X.; Ma, B.; Lin, Q.; Fu, X.; Li, N. scTRIM44 Positively Regulated Siniperca Chuatsi Rhabdovirus Through RIG-I- and MDA5-Mediated Interferon Signaling. Viruses 2024, 16, 1876. https://doi.org/10.3390/v16121876
Niu Y, Yang X, Liang H, Luo X, Ma B, Lin Q, Fu X, Li N. scTRIM44 Positively Regulated Siniperca Chuatsi Rhabdovirus Through RIG-I- and MDA5-Mediated Interferon Signaling. Viruses. 2024; 16(12):1876. https://doi.org/10.3390/v16121876
Chicago/Turabian StyleNiu, Yinjie, Xinmei Yang, Hongru Liang, Xia Luo, Baofu Ma, Qiang Lin, Xiaozhe Fu, and Ningqiu Li. 2024. "scTRIM44 Positively Regulated Siniperca Chuatsi Rhabdovirus Through RIG-I- and MDA5-Mediated Interferon Signaling" Viruses 16, no. 12: 1876. https://doi.org/10.3390/v16121876
APA StyleNiu, Y., Yang, X., Liang, H., Luo, X., Ma, B., Lin, Q., Fu, X., & Li, N. (2024). scTRIM44 Positively Regulated Siniperca Chuatsi Rhabdovirus Through RIG-I- and MDA5-Mediated Interferon Signaling. Viruses, 16(12), 1876. https://doi.org/10.3390/v16121876

