Reexamining the Mycovirome of Botrytis spp.
Abstract
1. Introduction
2. Materials and Methods
2.1. Fungal Isolates and Culture Conditions
2.2. RNA-Seq and sRNA-Seq Data
2.3. RNAseq Data Analysis
2.4. sRNA-Seq Data Analysis
2.5. Three-Dimensional Structure and Putative Function of Selected Mycoviral Proteins
2.6. In Vivo Detection of Selected Viruses
2.7. Phylogenetic Analysis
3. Results
3.1. Analysis of RNA-Seq Data from Botrytis spp.
3.2. Determination of the Mycovirome of Botrytis spp.
3.3. Analysis of Virus-Derived sRNAs
3.4. Molecular Characterization of Novel Mycoviruses
3.5. In Vivo Detection of Novel Mycoviruses
3.6. Phylogenetic Relationships
4. Discussion
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Elad, Y.; Pertot, I.; Cotes Prado, A.M.; Stewart, A. Plant Hosts of Botrytis spp. In Botrytis—The Fungus, the Pathogen and its Management in Agricultural Systems; Fillinger, S., Elad, Y., Eds.; Springer International Publishing: Cham, Switzerland, 2016; pp. 413–486. ISBN 978-3-319-23371-0. [Google Scholar]
- Amselem, J.; Cuomo, C.A.; van Kan, J.A.L.; Viaud, M.; Benito, E.P.; Couloux, A.; Coutinho, P.M.; de Vries, R.P.; Dyer, P.S.; Fillinger, S.; et al. Genomic Analysis of the Necrotrophic Fungal Pathogens Sclerotinia sclerotiorum and Botrytis cinerea. PLoS Genet. 2011, 7, e1002230. [Google Scholar] [CrossRef] [PubMed]
- Williamson, B.; Tudzynski, B.; Tudzynski, P.; Van Kan, J.A. Botrytis cinerea: The Cause of Grey Mould Disease. Mol. Plant Pathol. 2007, 8, 561–580. [Google Scholar] [CrossRef] [PubMed]
- Staats, M.; van Baarlen, P.; van Kan, J.A.L. Molecular Phylogeny of the Plant Pathogenic Genus Botrytis and the Evolution of Host Specificity. Mol. Biol. Evol. 2005, 22, 333–346. [Google Scholar] [CrossRef] [PubMed]
- Kretschmer, M.; Leroch, M.; Mosbach, A.; Walker, A.-S.; Fillinger, S.; Mernke, D.; Schoonbeek, H.-J.; Pradier, J.-M.; Leroux, P.; De Waard, M.A.; et al. Fungicide-Driven Evolution and Molecular Basis of Multidrug Resistance in Field Populations of the Grey Mould Fungus Botrytis cinerea. PLoS Pathog. 2009, 5, e1000696. [Google Scholar] [CrossRef] [PubMed]
- Fernández-Ortuño, D.; Torés, J.A.; Chamorro, M.; Pérez-García, A.; De Vicente, A. Characterization of Resistance to Six Chemical Classes of Site-Specific Fungicides Registered for Gray Mold Control on Strawberry in Spain. Plant Dis. 2016, 100, 2234–2239. [Google Scholar] [CrossRef]
- Fernández-Ortuño, D.; Pérez-García, A.; Chamorro, M.; de la Peña, E.; de Vicente, A.; Torés, J.A. Resistance to the SDHI Fungicides Boscalid, Fluopyram, Fluxapyroxad, and Penthiopyrad in Botrytis cinerea from Commercial Strawberry Fields in Spain. Plant Dis. 2017, 101, 1306–1313. [Google Scholar] [CrossRef]
- Altieri, V.; Rossi, V.; Fedele, G. Biocontrol of Botrytis cinerea as Influenced by Grapevine Growth Stages and Environmental Conditions. Plants 2023, 12, 3430. [Google Scholar] [CrossRef]
- Hollings, M. Viruses Associated with A Die-Back Disease of Cultivated Mushroom. Nature 1962, 196, 962–965. [Google Scholar] [CrossRef]
- Vainio, E.J. Mitoviruses in the Conifer Root Rot Pathogens Heterobasidion annosum and H. parviporum. Virus Res. 2019, 271, 197681. [Google Scholar] [CrossRef]
- Kondo, H.; Botella, L.; Suzuki, N. Mycovirus Diversity and Evolution Revealed/Inferred from Recent Studies. Annu. Rev. Phytopathol. 2022, 60, 307–336. [Google Scholar] [CrossRef]
- Jo, Y.; Choi, H.; Chu, H.; Cho, W.K. Unveiling Mycoviromes Using Fungal Transcriptomes. Int. J. Mol. Sci. 2022, 23, 10926. [Google Scholar] [CrossRef] [PubMed]
- Ayllón, M.A.; Vainio, E.J. Chapter One—Mycoviruses as a Part of the Global Virome: Diversity, Evolutionary Links and Lifestyle. In Advances in Virus Research; Kielian, M., Roossinck, M.J., Eds.; Academic Press: Cambridge, MA, USA, 2023; Volume 115, pp. 1–86. [Google Scholar]
- Lu, X.; Dai, Z.; Xue, J.; Li, W.; Ni, P.; Xu, J.; Zhou, C.; Zhang, W. Discovery of Novel RNA Viruses through Analysis of Fungi-Associated next-Generation Sequencing Data. BMC Genom. 2024, 25, 517. [Google Scholar] [CrossRef] [PubMed]
- Yu, X.; Li, B.; Fu, Y.; Jiang, D.; Ghabrial, S.A.; Li, G.; Peng, Y.; Xie, J.; Cheng, J.; Huang, J.; et al. A Geminivirus-Related DNA Mycovirus That Confers Hypovirulence to a Plant Pathogenic Fungus. Proc. Natl. Acad. Sci. USA 2010, 107, 8387–8392. [Google Scholar] [CrossRef] [PubMed]
- Jiāng, D.; Ayllón, M.A.; Marzano, S.-Y.L. ICTV Report Consortium ICTV Virus Taxonomy Profile: Mymonaviridae. J. Gen. Virol. 2019, 100, 1343–1344. [Google Scholar] [CrossRef] [PubMed]
- Márquez, L.M.; Redman, R.S.; Rodriguez, R.J.; Roossinck, M.J. A Virus in a Fungus in a Plant: Three-Way Symbiosis Required for Thermal Tolerance. Science 2007, 315, 513–515. [Google Scholar] [CrossRef]
- Ghabrial, S.A.; Castón, J.R.; Jiang, D.; Nibert, M.L.; Suzuki, N. 50-plus Years of Fungal Viruses. Virology 2015, 479–480, 356–368. [Google Scholar] [CrossRef]
- Kotta-Loizou, I. Mycoviruses and Their Role in Fungal Pathogenesis. Curr. Opin. Microbiol. 2021, 63, 10–18. [Google Scholar] [CrossRef]
- Khan, H.A.; Baig, D.I.; Bhatti, M.F. An Overview of Mycoviral Curing Strategies Used in Evaluating Fungal Host Fitness. Mol. Biotechnol. 2023, 65, 1547–1564. [Google Scholar] [CrossRef]
- Xie, J.; Jiang, D. New Insights into Mycoviruses and Exploration for the Biological Control of Crop Fungal Diseases. Annu. Rev. Phytopathol. 2014, 52, 45–68. [Google Scholar] [CrossRef]
- García-Pedrajas, M.D.; Cañizares, M.C.; Sarmiento-Villamil, J.L.; Jacquat, A.G.; Dambolena, J.S. Mycoviruses in Biological Control: From Basic Research to Field Implementation. Phytopathology 2019, 109, 1828–1839. [Google Scholar] [CrossRef]
- Dawe, A.L.; Nuss, D.L. Hypoviruses and Chestnut Blight: Exploiting Viruses to Understand and Modulate Fungal Pathogenesis. Annu. Rev. Genet. 2001, 35, 1–29. [Google Scholar] [CrossRef] [PubMed]
- Cortesi, P.; McCulloch, C.E.; Song, H.; Lin, H.; Milgroom, M.G. Genetic Control of Horizontal Virus Transmission in the Chestnut Blight Fungus, Cryphonectria parasitica. Genetics 2001, 159, 107–118. [Google Scholar] [CrossRef] [PubMed]
- Nuss, D.L. Hypovirulence: Mycoviruses at the Fungal–Plant Interface. Nat. Rev. Microbiol. 2005, 3, 632–642. [Google Scholar] [CrossRef] [PubMed]
- Howitt, R.L.J.; Beever, R.E.; Pearson, M.N.; Forster, R.L.S. Presence of Double-Stranded RNA and Virus-like Particles in Botrytis cinerea. Mycol. Res. 1995, 99, 1472–1478. [Google Scholar] [CrossRef]
- Vilches, S.; Castillo, A. A Double-Stranded RNA Mycovirus in Botrytis cinerea. FEMS Microbiol. Lett. 1997, 155, 125–130. [Google Scholar] [CrossRef]
- Castro, M.; Kramer, K.; Valdivia, L.; Ortiz, S.; Benavente, J.; Castillo, A. A New Double-Stranded RNA Mycovirus from Botrytis cinerea. FEMS Microbiol. Lett. 1999, 175, 95–99. [Google Scholar] [CrossRef]
- Rodríguez-García, C.; Medina, V.; Alonso, A.; Ayllón, M.A. Mycoviruses of Botrytis cinerea Isolates from Different Hosts. Ann. Appl. Biol. 2014, 164, 46–61. [Google Scholar] [CrossRef]
- Hao, F.; Wu, M.; Li, G. Molecular Characterization and Geographic Distribution of a Mymonavirus in the Population of Botrytis cinerea. Viruses 2018, 10, 432. [Google Scholar] [CrossRef]
- Donaire, L.; Pagán, I.; Ayllón, M.A. Characterization of Botrytis cinerea Negative-Stranded RNA Virus 1, a New Mycovirus Related to Plant Viruses, and a Reconstruction of Host Pattern Evolution in Negative-Sense ssRNA Viruses. Virology 2016, 499, 212–218. [Google Scholar] [CrossRef]
- Donaire, L.; Ayllón, M.A. Deep Sequencing of Mycovirus-Derived Small RNAs from Botrytis Species: Deep Sequencing of Mycovirus-Derived Small RNAs. Mol. Plant Pathol. 2017, 18, 1127–1137. [Google Scholar] [CrossRef]
- Donaire, L.; Rozas, J.; Ayllón, M.A. Molecular Characterization of Botrytis Ourmia-like Virus, a Mycovirus Close to the Plant Pathogenic Genus Ourmiavirus. Virology 2016, 489, 158–164. [Google Scholar] [CrossRef] [PubMed]
- Ruiz-Padilla, A.; Rodríguez-Romero, J.; Gómez-Cid, I.; Pacifico, D.; Ayllón, M.A. Novel Mycoviruses Discovered in the Mycovirome of a Necrotrophic Fungus. mBio 2021, 12, e03705-20. [Google Scholar] [CrossRef] [PubMed]
- Ahmed, A.; Khan, H.A.; Jamal, A.; Virk, N.; Bhatti, M.F. Characterization of Two Novel Fusariviruses Co-Infecting a Single Isolate of Phytopathogenic Fungus Botrytis cinerea. Virus Genes. 2024, 60, 402–411. [Google Scholar] [CrossRef] [PubMed]
- Ruiz-Padilla, A.; Turina, M.; Ayllón, M.A. Molecular Characterization of a Tetra Segmented ssDNA Virus Infecting Botrytis cinerea Worldwide. Virol. J. 2023, 20, 306. [Google Scholar] [CrossRef] [PubMed]
- Khalifa, M.E.; MacDiarmid, R.M. A Mechanically Transmitted DNA Mycovirus Is Targeted by the Defence Machinery of Its Host, Botrytis cinerea. Viruses 2021, 13, 1315. [Google Scholar] [CrossRef]
- Hao, F.; Wu, M.; Li, G. Characterization of a Novel Genomovirus in the Phytopathogenic Fungus Botrytis cinerea. Virology 2021, 553, 111–116. [Google Scholar] [CrossRef]
- Hirai, M.; Takaki, Y.; Kondo, F.; Horie, M.; Urayama, S.; Nunoura, T. RNA Viral Metagenome Analysis of Subnanogram dsRNA Using Fragmented and Primer Ligated dsRNA Sequencing (FLDS). Microb. Environ. 2021, 36, ME20152. [Google Scholar] [CrossRef]
- Ruiz-Padilla, A.; Rodríguez-Romero, J.L.; Pacifico, D.; Chiapello, M.; Ayllón, M.A. Determination of the Mycovirome of a Necrotrophic Fungus. In Viral Metagenomics; Pantaleo, V., Miozzi, L., Eds.; Methods in Molecular Biology; Springer: New York, NY, USA, 2024; Volume 2732, pp. 83–101. ISBN 978-1-07-163514-8. [Google Scholar]
- Poimala, A.; Vainio, E. Discovery and Identification of Viruses Infecting Oomycetes. In Viral Metagenomics; Pantaleo, V., Miozzi, L., Eds.; Methods in Molecular Biology; Springer: New York, NY, USA, 2024; Volume 2732, pp. 45–65. ISBN 978-1-07-163514-8. [Google Scholar]
- Ho, T.; Tzanetakis, I.E. Development of a Virus Detection and Discovery Pipeline Using next Generation Sequencing. Virology 2014, 471–473, 54–60. [Google Scholar] [CrossRef]
- Zheng, Y.; Gao, S.; Padmanabhan, C.; Li, R.; Galvez, M.; Gutierrez, D.; Fuentes, S.; Ling, K.-S.; Kreuze, J.; Fei, Z. VirusDetect: An Automated Pipeline for Efficient Virus Discovery Using Deep Sequencing of Small RNAs. Virology 2017, 500, 130–138. [Google Scholar] [CrossRef]
- Acosta Morel, W.; Marques-Costa, T.M.; Santander-Gordón, D.; Anta Fernández, F.; Zabalgogeazcoa, I.; Vázquez De Aldana, B.R.; Sukno, S.A.; Díaz-Mínguez, J.M.; Benito, E.P. Physiological and Population Genetic Analysis of Botrytis Field Isolates from Vineyards in Castilla y León, Spain. Plant Pathol. 2019, 68, 523–536. [Google Scholar] [CrossRef]
- Haas, B.J.; Papanicolaou, A.; Yassour, M.; Grabherr, M.; Blood, P.D.; Bowden, J.; Couger, M.B.; Eccles, D.; Li, B.; Lieber, M.; et al. De Novo Transcript Sequence Reconstruction from RNA-Seq Using the Trinity Platform for Reference Generation and Analysis. Nat. Protoc. 2013, 8, 1494–1512. [Google Scholar] [CrossRef] [PubMed]
- Bankevich, A.; Nurk, S.; Antipov, D.; Gurevich, A.A.; Dvorkin, M.; Kulikov, A.S.; Lesin, V.M.; Nikolenko, S.I.; Pham, S.; Prjibelski, A.D.; et al. SPAdes: A New Genome Assembly Algorithm and Its Applications to Single-Cell Sequencing. J. Comput. Biol. 2012, 19, 455–477. [Google Scholar] [CrossRef] [PubMed]
- Huang, X.; Madan, A. CAP3: A DNA Sequence Assembly Program. Genome Res. 1999, 9, 868–877. [Google Scholar] [CrossRef] [PubMed]
- Altschul, S.F.; Gish, W.; Miller, W.; Myers, E.W.; Lipman, D.J. Basic Local Alignment Search Tool. J. Mol. Biol. 1990, 215, 403–410. [Google Scholar] [CrossRef] [PubMed]
- Buchfink, B.; Xie, C.; Huson, D.H. Fast and Sensitive Protein Alignment Using DIAMOND. Nat. Methods 2015, 12, 59–60. [Google Scholar] [CrossRef]
- Li, H.; Durbin, R. Fast and Accurate Short Read Alignment with Burrows–Wheeler Transform. Bioinformatics 2009, 25, 1754–1760. [Google Scholar] [CrossRef]
- Danecek, P.; Bonfield, J.K.; Liddle, J.; Marshall, J.; Ohan, V.; Pollard, M.O.; Whitwham, A.; Keane, T.; McCarthy, S.A.; Davies, R.M.; et al. Twelve Years of SAMtools and BCFtools. GigaScience 2021, 10, giab008. [Google Scholar] [CrossRef]
- Kearse, M.; Moir, R.; Wilson, A.; Stones-Havas, S.; Cheung, M.; Sturrock, S.; Buxton, S.; Cooper, A.; Markowitz, S.; Duran, C.; et al. Geneious Basic: An Integrated and Extendable Desktop Software Platform for the Organization and Analysis of Sequence Data. Bioinformatics 2012, 28, 1647–1649. [Google Scholar] [CrossRef]
- Thorvaldsdottir, H.; Robinson, J.T.; Mesirov, J.P. Integrative Genomics Viewer (IGV): High-Performance Genomics Data Visualization and Exploration. Brief. Bioinform. 2013, 14, 178–192. [Google Scholar] [CrossRef]
- Jumper, J.; Evans, R.; Pritzel, A.; Green, T.; Figurnov, M.; Ronneberger, O.; Tunyasuvunakool, K.; Bates, R.; Žídek, A.; Potapenko, A.; et al. Highly Accurate Protein Structure Prediction with AlphaFold. Nature 2021, 596, 583–589. [Google Scholar] [CrossRef]
- Benkert, P.; Tosatto, S.C.E.; Schomburg, D. QMEAN: A Comprehensive Scoring Function for Model Quality Assessment. Proteins 2008, 71, 261–277. [Google Scholar] [CrossRef] [PubMed]
- Kelley, L.A.; Mezulis, S.; Yates, C.M.; Wass, M.N.; Sternberg, M.J.E. The Phyre2 Web Portal for Protein Modeling, Prediction and Analysis. Nat. Protoc. 2015, 10, 845–858. [Google Scholar] [CrossRef] [PubMed]
- Holm, L. Using Dali for Protein Structure Comparison. Methods Mol. Biol. 2020, 2112, 29–42. [Google Scholar] [CrossRef] [PubMed]
- Edgar, R.C. MUSCLE: Multiple Sequence Alignment with High Accuracy and High Throughput. Nucleic Acids Res. 2004, 32, 1792–1797. [Google Scholar] [CrossRef] [PubMed]
- Nguyen, L.-T.; Schmidt, H.A.; Von Haeseler, A.; Minh, B.Q. IQ-TREE: A Fast and Effective Stochastic Algorithm for Estimating Maximum-Likelihood Phylogenies. Mol. Biol. Evol. 2015, 32, 268–274. [Google Scholar] [CrossRef]
- Hoang, D.T.; Chernomor, O.; Von Haeseler, A.; Minh, B.Q.; Vinh, L.S. UFBoot2: Improving the Ultrafast Bootstrap Approximation. Mol. Biol. Evol. 2018, 35, 518–522. [Google Scholar] [CrossRef]
- Kalyaanamoorthy, S.; Minh, B.Q.; Wong, T.K.F.; Von Haeseler, A.; Jermiin, L.S. ModelFinder: Fast Model Selection for Accurate Phylogenetic Estimates. Nat. Methods 2017, 14, 587–589. [Google Scholar] [CrossRef]
- Chiapello, M.; Rodríguez-Romero, J.; Ayllón, M.A.; Turina, M. Analysis of the Virome Associated to Grapevine Downy Mildew Lesions Reveals New Mycovirus Lineages. Virus Evol. 2020, 6, veaa058. [Google Scholar] [CrossRef]
- Jia, J.; Fu, Y.; Jiang, D.; Mu, F.; Cheng, J.; Lin, Y.; Li, B.; Marzano, S.-Y.L.; Xie, J. Interannual Dynamics, Diversity and Evolution of the Virome in Sclerotinia sclerotiorum from a Single Crop Field. Virus Evol. 2021, 7, veab032. [Google Scholar] [CrossRef]
- Howitt, R.L.J.; Beever, R.E.; Pearson, M.N.; Forster, R.L.S. Genome Characterization of Botrytis Virus F, a Flexuous Rod-Shaped Mycovirus Resembling Plant ‘Potex-like’ Viruses. J. Gen. Virol. 2001, 82, 67–78. [Google Scholar] [CrossRef]
- Ayllón, M.A.; Turina, M.; Xie, J.; Nerva, L.; Marzano, S.-Y.L.; Donaire, L.; Jiang, D.; Consortium, I.R. ICTV Virus Taxonomy Profile: Botourmiaviridae. J. Gen. Virol. 2020, 101, 454–455. [Google Scholar] [CrossRef] [PubMed]
- Esteban, R.; Vega, L.; Fujimura, T. Launching of the Yeast 20 s RNA Narnavirus by Expressing the Genomic or Antigenomic Viral RNA in Vivo. J. Biol. Chem. 2005, 280, 33725–33734. [Google Scholar] [CrossRef] [PubMed]
- Rana, S.B.; Zadlock, F.J.; Zhang, Z.; Murphy, W.R.; Bentivegna, C.S. Comparison of De Novo ome Assemblers and K-Mer Strategies Using the Killifish, Fundulus heteroclitus. PLoS ONE 2016, 11, e0153104. [Google Scholar] [CrossRef] [PubMed]
- Wang, S.; Gribskov, M. Comprehensive Evaluation of de Novo Transcriptome Assembly Programs and Their Effects on Differential Gene Expression Analysis. Bioinformatics 2017, 33, 327–333. [Google Scholar] [CrossRef] [PubMed]
- Hölzer, M.; Marz, M. De Novo Transcriptome Assembly: A Comprehensive Cross-Species Comparison of Short-Read RNA-Seq Assemblers. GigaScience 2019, 8, giz039. [Google Scholar] [CrossRef]
- Yang, D.; Wu, M.; Zhang, J.; Chen, W.; Li, G.; Yang, L. Sclerotinia Minor Endornavirus 1, a Novel Pathogenicity Debilitation-Associated Mycovirus with a Wide Spectrum of Horizontal Transmissibility. Viruses 2018, 10, 589. [Google Scholar] [CrossRef]
- Dolja, V.V.; Koonin, E.V. Metagenomics Reshapes the Concepts of RNA Virus Evolution by Revealing Extensive Horizontal Virus Transfer. Virus Res. 2018, 244, 36–52. [Google Scholar] [CrossRef]
- Sutela, S.; Forgia, M.; Vainio, E.J.; Chiapello, M.; Daghino, S.; Vallino, M.; Martino, E.; Girlanda, M.; Perotto, S.; Turina, M. The Virome from a Collection of Endomycorrhizal Fungi Reveals New Viral Taxa with Unprecedented Genome Organization. Virus Evol. 2020, 6, veaa076. [Google Scholar] [CrossRef]
- Sato, Y.; Shahi, S.; Telengech, P.; Hisano, S.; Cornejo, C.; Rigling, D.; Kondo, H.; Suzuki, N. A New Tetra-Segmented Splipalmivirus with Divided RdRP Domains from Cryphonectria naterciae, a Fungus Found on Chestnut and Cork Oak Trees in Europe. Virus Res. 2022, 307, 198606. [Google Scholar] [CrossRef]
- Sutela, S.; Piri, T.; Vainio, E.J. Discovery and Community Dynamics of Novel ssRNA Mycoviruses in the Conifer Pathogen Heterobasidion parviporum. Front. Microbiol. 2021, 12, 770787. [Google Scholar] [CrossRef]
- Huang, H.; Hua, X.; Pang, X.; Zhang, Z.; Ren, J.; Cheng, J.; Fu, Y.; Xiao, X.; Lin, Y.; Chen, T.; et al. Discovery and Characterization of Putative Glycoprotein-Encoding Mycoviruses in the Bunyavirales. J. Virol. 2023, 97, e01381-22. [Google Scholar] [CrossRef] [PubMed]
- Wang, Q.; Cheng, S.; Xiao, X.; Cheng, J.; Fu, Y.; Chen, T.; Jiang, D.; Xie, J. Discovery of Two Mycoviruses by High-Throughput Sequencing and Assembly of Mycovirus-Derived Small Silencing RNAs from a Hypovirulent Strain of Sclerotinia sclerotiorum. Front. Microbiol. 2019, 10, 1415. [Google Scholar] [CrossRef] [PubMed]
- Yaegashi, H.; Shimizu, T.; Ito, T.; Kanematsu, S. Differential Inductions of RNA Silencing among Encapsidated Double-Stranded RNA Mycoviruses in the White Root Rot Fungus Rosellinia necatrix. J. Virol. 2016, 90, 5677–5692. [Google Scholar] [CrossRef] [PubMed]
- Bandiera, S.; Rüberg, S.; Girard, M.; Cagnard, N.; Hanein, S.; Chrétien, D.; Munnich, A.; Lyonnet, S.; Henrion-Caude, A. Nuclear Outsourcing of RNA Interference Components to Human Mitochondria. PLoS ONE 2011, 6, e20746. [Google Scholar] [CrossRef] [PubMed]
- McBride, H.M.; Neuspiel, M.; Wasiak, S. Mitochondria: More than Just a Powerhouse. Curr. Biol. 2006, 16, R551–R560. [Google Scholar] [CrossRef]
- Moore, C.B.; Ting, J.P.-Y. Regulation of Mitochondrial Antiviral Signaling Pathways. Immunity 2008, 28, 735–739. [Google Scholar] [CrossRef]
- Muñoz-Adalia, E.J.; Diez, J.J.; Fernández, M.M.; Hantula, J.; Vainio, E.J. Characterization of Small RNAs Originating from Mitoviruses Infecting the Conifer Pathogen Fusarium circinatum. Arch. Virol. 2018, 163, 1009–1018. [Google Scholar] [CrossRef]
- Donaire, L.; Barajas, D.; Martínez-García, B.; Martínez-Priego, L.; Pagán, I.; Llave, C. Structural and Genetic Requirements for the Biogenesis of Tobacco Rattle Virus-Derived Small Interfering RNAs. J. Virol. 2008, 82, 5167–5177. [Google Scholar] [CrossRef]
- Campo, S.; Gilbert, K.B.; Carrington, J.C. Small RNA-Based Antiviral Defense in the Phytopathogenic Fungus Colletotrichum higginsianum. PLoS Pathog. 2016, 12, e1005640. [Google Scholar] [CrossRef]
- Rodriguez Coy, L.; Plummer, K.M.; Khalifa, M.E.; MacDiarmid, R.M. Mycovirus-Encoded Suppressors of RNA Silencing: Possible Allies or Enemies in the Use of RNAi to Control Fungal Disease in Crops. Front. Fungal Biol. 2022, 3, 965781. [Google Scholar] [CrossRef]
- Himeno, M.; Maejima, K.; Komatsu, K.; Ozeki, J.; Hashimoto, M.; Kagiwada, S.; Yamaji, Y.; Namba, S. Significantly Low Level of Small RNA Accumulation Derived from an Encapsidated Mycovirus with dsRNA Genome. Virology 2010, 396, 69–75. [Google Scholar] [CrossRef] [PubMed]
- Hillman, B.I.; Cai, G. Chapter Six—The Family Narnaviridae: Simplest of RNA Viruses. In Advances in Virus Research; Ghabrial, S.A., Ed.; Mycoviruses; Academic Press: Cambridge, MA, USA, 2013; Volume 86, pp. 149–176. [Google Scholar]
- Raco, M.; Vainio, E.J.; Sutela, S.; Eichmeier, A.; Hakalová, E.; Jung, T.; Botella, L. High Diversity of Novel Viruses in the Tree Pathogen Phytophthora castaneae Revealed by High-Throughput Sequencing of Total and Small RNA. Front. Microbiol. 2022, 13, 911474. [Google Scholar] [CrossRef] [PubMed]
- Gao, Y.; Xu, Z.; Li, P.; Hu, X.; Chen, J.-P.; Zhang, C.-X.; Li, Y. Complete Genome Analysis of a Novel Narnavirus in Sweet Viburnum (Viburnum odoratissimum). Arch. Virol. 2024, 169, 90. [Google Scholar] [CrossRef] [PubMed]
Primer | Sequence (5’-3’) | Virus-Segment Targeted | Position of Primers |
---|---|---|---|
BNV1 F1 | AGAAGGGTATTTGGATAGGTTCGC | BNV1-RNA1 | 1006–1029 |
BNV1 R1 | TCTTGGGAATACCAATCGCCAGAC | BNV1-RNA1 | 1591–1614 |
BcNV1-RNA1 | 1556–1579 | ||
BcNV1 F2 | AAGGTCATCCCTAAACAGGAGAT | BNV1-RNA2 | 1280–1302 |
BcNV1-RNA2 | 1286–1308 | ||
BNV1 R2 | GATTCTAAAATTTCCTTTGGGATAGCTT | BNV1-RNA2 | 2325–2352 |
BcNV1 F1 | ACGTTTTAAACCTAAGTTTACGTCCTC | BcNV1-RNA1 | 992–1018 |
BcNV1 R2 | TCTAAAACCTCATGGGATATTACCC | BcNV1-RNA2 | 2338–2362 |
PvaOLV80 F | CCGGTTCCTTCGTTTCCGTTGACTTC | RNA | 942–967 |
PvaOLV80 R | CCCATCATCTGTCCCATCGAAAGC | RNA | 1174–1197 |
Isolates | Trinity | Spades | ||||
---|---|---|---|---|---|---|
# Contigs | # Hits | # Hits CAP3 | # Contigs | # Hits | # Hits CAP3 | |
Pi258.8 | 14.178 | 3.278 | 2.956 | 10.967 | 2.574 | 2.524 |
V446 | 15.209 | 3.612 | 3.293 | 11.671 | 2.751 | 2.688 |
V448 | 19.205 | 4.815 | 4.314 | 13.770 | 3.440 | 3.339 |
Field Isolate | Mycovirus * | Family | Genus | Genome | Acc. No. |
---|---|---|---|---|---|
Pi258.8 | BcMV-1 | Mitoviridae | Duamitovirus | (+)ssRNA | LN827940/CEZ26296 |
BcMV-2 | Mitoviridae | Unuamitovirus | (+)ssRNA | LN827941/CEZ26297 | |
BcMV-3 | Mitoviridae | Duamitovirus | (+)ssRNA | LN827942/CEZ26298 | |
GaNV-1 | Mitoviridae | Mitovirus | (+)ssRNA | LN827943/CEZ26299 | |
BcAV1 | Togaviridae | Alphavirus | (+)ssRNA | MN625250/QJT73733 | |
V446 | BOLV | Botourmiaviridae | Botoulivirus | (+)ssRNA | LN827955/CEZ26310 |
SsNsV-L | Unclassified | Unclassified | dsRNA | LN827951/CEZ26307 | |
PvaOLV80 | Botourmiaviridae | Deltascleroulivirus | (+)ssRNA | MN532667/QGY72610 | |
SsNV-3 (RNA1) | Narnaviridae | Narnavirus | (+)ssRNA | MW442873/QZE12022 | |
SsNV-3 (RNA2) | Narnaviridae | Narnavirus | (+)ssRNA | MW442874/QZE12023 | |
V448 | BcMV-1 | Mitoviridae | Duamitovirus | (+)ssRNA | LN827944/CEZ26300 |
BcMV-2 | Mitoviridae | Unuamitovirus | (+)ssRNA | LN827945/CEZ26301 | |
BcMV-3 | Mitoviridae | Duamitovirus | (+)ssRNA | LN827946/CEZ26302 | |
BcMV-4 | Mitoviridae | Unuamitovirus | (+)ssRNA | LN827947/CEZ26303 | |
GaNV-1 | Mitoviridae | Mitovirus | (+)ssRNA | LN827948/CEZ26304 | |
SsMV-3 | Mitoviridae | Duamitovirus | (+)ssRNA | LN827949/CEZ26305 | |
SsNsV-L | Unclassified | Unclassified | dsRNA | LN827952/CEZ26308 | |
BVF | Gammaflexiviridae | Mycoflexivirus | (+)ssRNA | LN827954/CEZ26309 | |
BcNSRV-1 | Unclassified | Unclassified | (−)ssRNA | LN827956/CEZ26311 | |
BcAV1 | Togaviridae | Alphavirus | (+)ssRNA | MN625250/QJT73733 | |
SsNV-3 (RNA1) | Narnaviridae | Narnavirus | (+)ssRNA | MW442873/QZE12022 | |
SsNV-3 (RNA2) | Narnaviridae | Narnavirus | (+)ssRNA | MW442874/QZE12023 |
Field Isolate * | Mycoviral Reference Genome | Mycoviral Reference Genome Length (nt) | Mycoviral Reference Genome CDS (aa) | Mycoviral Reference Genome CDS Domain | Contig Length (nt) | Contig Coverage on Reference Genome (aa) | Contig nt Identity (%) | Contig aa Identity (%) | Complete CDS |
---|---|---|---|---|---|---|---|---|---|
Pi258.8 | BcAV1 | 8008 | 1975 | RdRp | 8045 | 100 | 96 | 99 | Yes |
V446 | PavOLV80 | 3000 | 737 | RdRp | 3146 | 100 | 96 | 98 | Yes |
SsNV-3 (RNA1) | 3453 | 1087 | RdRp | 3447 | 100 | 77 | 83 | Yes | |
SsNV-3 (RNA2) | 3100 | 957 | HP | 3108 | 100 | 58.5 | 61 | Yes | |
V448 | BcAV1 | 8008 | 1975 | RdRp | 6177 | 76.1 | 95 | 99 | No |
SsNV-3 (RNA1) | 3453 | 1087 | RdRp | 3437 | 100 | 79.5 | 80 | Yes | |
SsNV-3 (RNA2) | 3100 | 957 | HP | 3120 | 100 | 56.8 | 58 | Yes |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Muñoz-Suárez, H.; Ruiz-Padilla, A.; Donaire, L.; Benito, E.P.; Ayllón, M.A. Reexamining the Mycovirome of Botrytis spp. Viruses 2024, 16, 1640. https://doi.org/10.3390/v16101640
Muñoz-Suárez H, Ruiz-Padilla A, Donaire L, Benito EP, Ayllón MA. Reexamining the Mycovirome of Botrytis spp. Viruses. 2024; 16(10):1640. https://doi.org/10.3390/v16101640
Chicago/Turabian StyleMuñoz-Suárez, Hugo, Ana Ruiz-Padilla, Livia Donaire, Ernesto Pérez Benito, and María A. Ayllón. 2024. "Reexamining the Mycovirome of Botrytis spp." Viruses 16, no. 10: 1640. https://doi.org/10.3390/v16101640
APA StyleMuñoz-Suárez, H., Ruiz-Padilla, A., Donaire, L., Benito, E. P., & Ayllón, M. A. (2024). Reexamining the Mycovirome of Botrytis spp. Viruses, 16(10), 1640. https://doi.org/10.3390/v16101640