Molecular Positivity of Porcine Circovirus Type 2 Associated with Production Practices on Farms in Jalisco, Mexico
Abstract
:1. Introduction
2. Materials and Methods
2.1. Research Site
2.2. Samples
- Regions were categorized by their pig density per square kilometer and coded as A, B1, B2, or B3.
- Farm types were classified on the basis of the number of breeding sows: semi-intensive (21–500 sows) and intensive pig farming (≥500 sows).
- Farm types were also categorized according to the farm system: In farrow-to-finish commercial farms (FFs), all the stages of the pig production cycle, from farrowing to finishing, occur within a single site. In multisite pig farms (MSs), the different stages of production—reproduction (Site-1), transition (Site-2), and finalization (Site-3)—occur at separate locations.
- The production stage corresponds to specific age ranges: from birth to weaning (suckling phase), from weaning to 10 weeks (weaner phase), 11–14 weeks (growing phase), 15–18 weeks (grower phase), 19–22 weeks (finisher phase), and pregnant sows.
2.3. Real-Time PCR
2.4. Data Collected
2.5. Statistical Analysis
3. Results
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Segalés, J. Porcine circovirus type 2 (PCV2) infections: Clinical signs, pathology and laboratory diagnosis. Virus Res. 2012, 164, 10–19. [Google Scholar] [CrossRef]
- Martin, H.; Le Potier, M.-F.; Maris, P. Virucidal efficacy of nine commercial disinfectants against porcine circovirus type 2. Vet. J. 2008, 177, 388–393. [Google Scholar] [CrossRef] [PubMed]
- López-Lorenzo, G.; Díaz-Cao, J.M.; Prieto, A.; López-Novo, C.; López, C.M.; Díaz, P.; Rodríguez-Vega, V.; Díez-Baños, P.; Fernández, G. Environmental distribution of Porcine Circovirus Type 2 (PCV2) in swine herds with natural infection. Sci. Rep. 2019, 9, 14816. [Google Scholar] [CrossRef] [PubMed]
- Opriessnig, T.; Karuppannan, A.K.; Castro, A.M.; Xiao, C.-T. Porcine circoviruses: Current status, knowledge gaps and challenges. Virus Res. 2020, 286, 198044. [Google Scholar] [CrossRef]
- Sun, L.; Lin, T.; Lee, J.; Kim, S.; Bai, Y.; Jin, D. Interaction between host cell proteins and open reading frames of porcine circovirus type 2. J. Anim. Sci. Technol. 2023, 65, 698–719. [Google Scholar] [CrossRef]
- Bandrick, M.; Balasch, M.; Heinz, A.; Taylor, L.; King, V.; Toepfer, J.; Foss, D. A bivalent porcine circovirus type 2 (PCV2), PCV2a-PCV2b, vaccine offers biologically superior protection compared to monovalent PCV2 vaccines. Vet. Res. 2022, 53, 12. [Google Scholar] [CrossRef]
- Segalés, J.; Allan, G.M.; Domingo, M. Circoviruses. In Diseases of Swine, 11th ed.; Zimmerman, J.J., Karriker, L.A., Ramírez, A., Schwartz, K.J., Stevenson, G.W., Zhang, J., Eds.; Wiley Blackwell: Hoboken, NJ, USA, 2019; ch. 30; pp. 473–487. [Google Scholar]
- López, F.B.; Ortega, M.E.T.; Elvira, S.M.; Ramírez, V.Q.; Morales, R.A.; Ramírez-Mendoza, H.; Sanchez-Betancourt, J.I. Identification and genotyping of porcine circovirus type II (PCV2) in Mexico. Virusdisease 2018, 29, 385–389. [Google Scholar] [CrossRef]
- De la Luz-Armendáriz, J.; Martínez-Mercado, M.J.; Martínez-Bautista, R.; Gómez-Núñez, L.; Rivera-Benítez, J.F. Porcine circovirus type 2 (PCV2) genotypification in Mexico. In Proceedings of the International Pig Veterinary Society Congress, Rio de Janeiro, Brazil, 26 September 2020; p. 843. [Google Scholar]
- Martínez-Bautista, R.; De La Luz-Armendáriz, J.; Martínez-Mercado, M.J.; Baltazar-Martínez, J.; Gómez-Núñez, L.; Rive-ra-Benítez, J.F. Characterization of the complete genome of porcine Circovirus type 2 in Mexico. In Proceedings of the International Pig Veterinary Society Congress, Rio de Janeiro, Brazil, 26 September 2020; p. 844. [Google Scholar]
- Dupont, K.; Nielsen, E.; Bækbo, P.; Larsen, L. Genomic analysis of PCV2 isolates from Danish archives and a current PMWS case–control study supports a shift in genotypes with time. Vet. Microbiol. 2008, 128, 56–64. [Google Scholar] [CrossRef]
- Franzo, G.; Cortey, M.; de Castro, A.M.M.G.; Piovezan, U.; Szabo, M.P.J.; Drigo, M.; Segalés, J.; Richtzenhain, L.J. Genetic characterisation of Porcine circovirus type 2 (PCV2) strains from feral pigs in the Brazilian Pantanal: An opportunity to reconstruct the history of PCV2 evolution. Vet. Microbiol. 2015, 178, 158–162. [Google Scholar] [CrossRef]
- Liu, X.; Wang, F.-X.; Zhu, H.-W.; Sun, N.; Wu, H. Phylogenetic analysis of porcine circovirus type 2 (PCV2) isolates from China with high homology to PCV2c. Arch. Virol. 2016, 161, 1591–1599. [Google Scholar] [CrossRef]
- Xiao, C.-T.; Halbur, P.G.; Opriessnig, T. Global molecular genetic analysis of porcine circovirus type 2 (PCV2) sequences confirms the presence of four main PCV2 genotypes and reveals a rapid increase of PCV2d. J. Gen. Virol. 2015, 96, 1830–1841. [Google Scholar] [CrossRef] [PubMed]
- Wang, Y.; Noll, L.; Lu, N.; Porter, E.; Stoy, C.; Zheng, W.; Liu, X.; Peddireddi, L.; Niederwerder, M.; Bai, J. Genetic diversity and prevalence of porcine circovirus type 3 (PCV3) and type 2 (PCV2) in the Midwest of the USA during 2016–2018. Transbound. Emerg. Dis. 2020, 67, 1284–1294. [Google Scholar] [CrossRef] [PubMed]
- Giudici, S.D.; Mura, L.; Bonelli, P.; Hawko, S.; Angioi, P.P.; Sechi, A.M.; Denti, S.; Sulas, A.; Burrai, G.P.; Madrau, M.P.; et al. Evidence of Porcine Circovirus Type 2 (PCV2) Genetic Shift from PCV2b to PCV2d Genotype in Sardinia, Italy. Viruses 2023, 15, 2157. [Google Scholar] [CrossRef] [PubMed]
- Franzo, G.; Segalés, J. Porcine circovirus 2 (PCV-2) genotype update and proposal of a new genotyping methodology. PLoS ONE 2018, 13, e0208585. [Google Scholar] [CrossRef] [PubMed]
- Franzo, G.; Segalés, J. Porcine Circovirus 2 Genotypes, Immunity and Vaccines: Multiple Genotypes but One Single Serotype. Pathogens 2020, 9, 1049. [Google Scholar] [CrossRef]
- Gebhardt, J.T.; Tokach, M.D.; Dritz, S.S.; DeRouchey, J.M.; Woodworth, J.C.; Goodband, R.D.; Henry, S.C. Postweaning mortality in commercial swine production. I: Review of non-infectious contributing factors. Transl. Anim. Sci. 2020, 4, 462–484. [Google Scholar] [CrossRef]
- Sistema de Información Agroalimentaria de Consulta, SIACON. Servicio de Información Agroalimentaria y Pesquera, México. 2023. Available online: https://www.gob.mx/siap/documentos/siacon-ng-161430 (accessed on 22 April 2024).
- Espinosa-Vázquez, J.I.; Sauceda-Cerecer, S.G.; Galindo-Barboza, A.J.; Mondaca-Fernández, C.E.; Uribe-Flores, J.A. La Producción Porcícola en Jalisco y su Situación Ante las Enfermedades Virales Endémicas, 1ra ed. Guadalajara, Jalisco, México: Unión Regional de Porcicultores de Jalisco, Prometeo Editores, 2022. Available online: https://urpj.org.mx/wp-content/uploads/2022/05/La-produccion-porcicola-en-Jalisco-y-su-situacion-ante-las-enfermedades-virales-endemicas_compressed-1.pdf (accessed on 1 May 2024).
- Olvera, A.; Cortey, M.; Segalés, J. Molecular evolution of porcine circovirus type 2 genomes: Phylogeny and clonality. Virology 2007, 357, 175–185. [Google Scholar] [CrossRef]
- Moore, C. Biosecurity and Minimal Disease Herds. Vet. Clin. N. Am. Food Anim. Pract. 1992, 8, 461–474. [Google Scholar] [CrossRef]
- Pritchard, G.; Dennis, I.; Waddilove, J. Biosecurity: Reducing disease risks to pig breeding herds. In Pract. 2005, 27, 230–237. [Google Scholar] [CrossRef]
- Casal, J.; Manuel-León, A.; Mateu, E.; Martin, M. Evaluation du risque de certains maladies dans les exploitations de porcs en fonction des mesures de biosecurité. Epidémiol. Santé Anim. 2002, 42, 89–93. [Google Scholar]
- Casal, J.; De Manuel, A.; Mateu, E.; Martín, M. Biosecurity measures on swine farms in Spain: Perceptions by farmers and their relationship to current on-farm measures. Prev. Vet. Med. 2007, 82, 138–150. [Google Scholar] [CrossRef] [PubMed]
- Dieste-Pérez, L.; van Nes, A.; van Maanen, K.; Duinhof, T.; Tobias, T. The prevalence of PCV2 viremia in newborn piglets on four endemically infected Dutch sow farms is very low. Prev. Vet. Med. 2018, 153, 42–46. [Google Scholar] [CrossRef] [PubMed]
- Shen, H.; Wang, C.; Madson, D.M.; Opriessnig, T. High prevalence of porcine circovirus viremia in newborn piglets in five clinically normal swine breeding herds in North America. Prev. Vet. Med. 2010, 97, 228–236. [Google Scholar] [CrossRef] [PubMed]
- Dvorak, C.M.; Lilla, M.P.; Baker, S.R.; Murtaugh, M.P. Multiple routes of porcine circovirus type 2 transmission to piglets in the presence of maternal immunity. Vet. Microbiol. 2013, 166, 365–374. [Google Scholar] [CrossRef] [PubMed]
- Afolabi, K.O.; Amoo, O.S.; Onuigbo, T.I.; Oraegbu, J.I.; Awoseyi, A.A.; Fasina, F.O.; Adebowale, O.O. Regional Cross-Sectional Based Study and Associated Risk Factors of Porcine Circovirus 2 in Nigerian Pigs. Transbound. Emerg. Dis. 2023, 2023, 9201177. [Google Scholar] [CrossRef]
- Huber, N.; Andraud, M.; Sassu, E.L.; Prigge, C.; Zoche-Golob, V.; Käsbohrer, A.; D’Angelantonio, D.; Viltrop, A.; Żmudzki, J.; Jones, H.; et al. What is a biosecurity measure? A definition proposal for animal production and linked processing operations. One Health 2022, 15, 100433. [Google Scholar] [CrossRef]
- Holtkamp, D.J.; Anderson, A.V.; Fitzgerald, C.; Baker, K.; Stika, R.; Linhares, D. Comparison of shower-in and shower-in plus bench entry protocols for prevention of environmental contamination due to personnel entry in a commercial swine fa-cility. J. Swine Health Prod. 2018, 26, 192–199. [Google Scholar]
- Jimenez, C.E.P.; Keestra, S.; Tandon, P.; Cumming, O.; Pickering, A.J.; Moodley, A.; Chandler, C.I.R. Biosecurity and water, sanitation, and hygiene (WASH) interventions in animal agricultural settings for reducing infection burden, antibiotic use, and antibiotic resistance: A One Health systematic review. Lancet Planet Health 2023, 7, 418–434. [Google Scholar] [CrossRef]
- Opriessnig, T.; Patterson, A.R.; Madson, D.M.; Schalk, S.D.; Halbur, P.G.; Opriessnig, T. Establishment and maintenance of a porcine circovirus type 2 (PCV2)-free breeding herd on a site that experienced a natural outbreak of PCV2-associate repro-ductive disease. J. Swine Health Prod. 2011, 19, 165–174. [Google Scholar]
- Grau-Roma, L.; Fraile, L.; Segalés, J. Recent advances in the epidemiology, diagnosis and control of diseases caused by porcine circovirus type 2. Vet. J. 2011, 187, 23–32. [Google Scholar] [CrossRef]
- Papatsiros, V.; Papakonstantinou, G.; Meletis, E.; Maragkakis, G.; Tsekouras, N.; Bitchava, D.; Kostoulas, P. Risk factors and prevalence of porcine circovirus 2 and porcine reproductive and respiratory virus in 59 Greek pig farms. Authorea Prepr. 2020, 1–16. [Google Scholar] [CrossRef]
- Guillermo-Cordero, L.; Torres-León, M.; Rodríguez-Buenfil, J.C.; Colín-Flores, R.; Miranda-Soberanis, R.; Quintal-Parra, M. Incidencia clínica y frecuencia de lesiones compatibles con enfermedad asociada al Circovirus porcino tipo 2 (EACPV2) en cerdos de una granja del estado de Yucatán, México. Trop. Subtrop. Agroecosyst. 2011, 14, 431–440. [Google Scholar]
- Oliver-Ferrando, S.; Segalés, J.; López-Soria, S.; Callén, A.; Merdy, O.; Joisel, F.; Sibila, M. Evaluation of natural porcine circovirus type 2 (PCV2) subclinical infection and seroconversion dynamics in piglets vaccinated at different ages. Vet. Res. 2016, 47, 121. [Google Scholar] [CrossRef] [PubMed]
- Seo, H.W.; Park, C.; Han, K.; Chae, C. Effect of porcine circovirus type 2 (PCV2) vaccination on PCV2-viremic piglets after experimental PCV2 challenge. Vet. Res. 2014, 45, 13. [Google Scholar] [CrossRef] [PubMed]
- Gillespie, J.; Opriessnig, T.; Meng, X.; Pelzer, K.; Buechner-Maxwell, V. Porcine Circovirus Type 2 and Porcine Circovirus-Associated Disease. J. Vet. Intern. Med. 2009, 23, 1151–1163. [Google Scholar] [CrossRef]
- Zhang, J.; Wang, P.; Xie, C.; Ha, Z.; Shi, N.; Zhang, H.; Li, Z.; Han, J.; Xie, Y.; Qiu, X.; et al. Synergistic Pathogenicity by Coinfection and Sequential Infection with NADC30-like PRRSV and PCV2 in Post-Weaned Pigs. Viruses 2022, 14, 193. [Google Scholar] [CrossRef]
- Tirado, M.E.H.; Rodríguez, J.M.F.; Zendejas, C.C.; Terrazas, A.L.; Olivares, L.L.; Pérez, R.P.; Napoles, R.C. Detección de patógenos de importancia epidemiológica en cerdos ferales de Chihuahua y Durango, México. Rev. Mex. Cienc. Pecu. 2023, 14, 915–922. [Google Scholar] [CrossRef]
- Biohaz, E.P.O.B.H. Scientific Opinion on On-site treatment of pig carcasses. EFSA J. 2011, 9, 2425. [Google Scholar] [CrossRef]
Age Range of the Pigs | Region | |||
---|---|---|---|---|
A (n = 1924) | B1 (n = 571) | B2 (n = 832) | B3 (n = 880) | |
Birth to weaning | 276 | 76 | 128 | 122 |
Weaning to 10 weeks | 344 | 120 | 126 | 150 |
11 to 14 weeks | 383 | 121 | 139 | 168 |
15 to 18 weeks | 344 | 82 | 161 | 169 |
19 to 22 weeks | 275 | 86 | 136 | 127 |
Pregnant sows | 302 | 86 | 142 | 144 |
Primers and Probe | Sequences (5′ → 3′) |
---|---|
PCV2F [22] | CCAGGAGGGCGTTGTGACT |
PCV2R | CGCTACCGTTGGAGAAGGAA |
PCV2-Probe | FAM/AATGGCATCTTCAACACCCGCCTCT/BHQ1 |
Category | Risk Factor | Codification |
---|---|---|
Production management | Failure to implement the “All in, All out” system | all |
Purchase and entry of gilts and boars without complying with animal health protocols. | gilts | |
Not on-farm replacement gilt production | generate | |
Feeding and water provisions | Feeding with scraps food (swill feeding). | swill_feeding |
Disinfection practices and fomite control | Lack of farm access control | access |
No change of clothing upon farm entry | clothing | |
No change of boots or clothing between areas | boots | |
Failure to disinfect vehicles upon farm entry | vehicles | |
Failure to disinfect equipment and work material | material | |
Failure to wash pens | pens | |
Technical staff visits other farms | technical | |
Workers visit other farms | workers | |
Workers move between production areas | move | |
Absence of sanitizing mats | mats | |
Failure to disinfect pens | disinfect | |
Sanitary management | Failure to deworm | deworm |
Failure to vaccinate against influenza | flu | |
Failure to vaccinate against blue eye disease | blueye | |
Failure to vaccinate against Bordetella + Pasteurella | bp | |
Failure to vaccinate against E. coli | coli | |
Failure to vaccinate against Glaserella parasuis | parasuis | |
Failure to vaccinate against PRRSV | prrs | |
Failure to vaccinate against PCV2 | circo | |
Failure to vaccinate against Parvovirus, Leptospira, and Erysipelas on sows. | ple | |
Failure to vaccinate against Mycoplasma | myco | |
Failure to vaccinate against Actinobacillus pleuropneumoniae | app | |
Failure to vaccinate against Erysipelas only | ery | |
Facility and equipment standards | Absence of perimeter fence | fence |
Loading docks of pigs are inside the farm | docks | |
Services not located outside the farm (water intake, energy, gas, reception of farm inputs). | services | |
Absence of a specific dining room and bathrooms for collaborators within the farm | rooms | |
Pest management strategies | Failure to control rodents | rodents |
Failure to control insects | insects | |
Collaborators also raise and care for pigs off-farm | off-farm | |
Presence of wild pigs near farms | wild | |
Waste disposal methods | Failure to treat solid waste | waste |
Improper disposal of carcasses | carcass | |
Failure to treat wastewater | wastewater |
Age Range of the Pigs | Pools Positive/Analyzed (RF 1) | ||||
---|---|---|---|---|---|
All Pools | Semi-Intensive (21–500 Sows) | Intensive (≥500 Sows) | Farrow-to-Finish | Multisite | |
Birth to weaning | 19/123 (15.4%) | 9/87 (10.3%) | 10/36 (27.8%) | 17/114 (14.9%) | 7/9 (77.8%) |
Weaning to 10 weeks | 37/149 (24.8%) | 21/111 (18.9%) | 16/38 (42.1%) | 33/136 (24.3%) | 4/13 (30.8%) |
11 to 14 weeks | 60/161 (37.3%) | 35/119 (29.4%) | 25/42 (59.5%) | 52/149 (34.9%) | 8/12 (66.7%) |
15 to 18 weeks | 60/152 (39.5%) | 34/100 (34%) | 26/52 (50%) | 52/137 (38%) | 8/15 (53.3%) |
19 to 22 weeks | 40/126 (31.7%) | 17/82 (20.7%) | 23/44 (52.3%) | 32/112 (28.6%) | 8/14 (57.1%) |
Pregnant sows | 19/133 (14.3%) | 6/92 (6.5%) | 13/41 (31.7%) | 17/123 (13.8%) | 2/10 (20.0%) |
Coded Risk Factors | Cluster | χ2 | N | p | OR | CI (95%) | |
---|---|---|---|---|---|---|---|
Lower | Upper | ||||||
gilts | Region B3 | 11.12 | 152 | 0.0008 | 5.7 | 2.025 | 16.29 |
Semi-intensive | 6.12 | 566 | 0.0133 | 1.9 | 1.172 | 3.332 | |
Farrow-to-finish farm | 4.15 | 735 | 0.0416 | 1.5 | 1.034 | 2.328 | |
access | Region B2 | 13.37 | 157 | 0.0002 | 21.5 | 2.704 | 171.788 |
Intensive | 9.35 | 237 | 0.0022 | 15.0 | 1.911 | 118.592 | |
Farrow-to-finish farm | 6.52 | 756 | 0.0106 | 3.2 | 1.367 | 7.825 | |
vehicles | Region B2 | 11.79 | 147 | 0.0005 | 19.3 | 2.419 | 154.066 |
Intensive | 9.35 | 237 | 0.0022 | 15.0 | 1.911 | 118.592 | |
move | Semi-intensive | 12.34 | 575 | 0.0004 | 5.5 | 2.003 | 15.631 |
technical | Region A | 6.14 | 377 | 0.0132 | 1.8 | 1.164 | 3.053 |
deworm | Region B2 | 10.38 | 157 | 0.0012 | 7.8 | 2.109 | 29.092 |
Region B3 | 7.41 | 165 | 0.0064 | 4.5 | 1.611 | 13.096 | |
Intensive | 6.23 | 237 | 0.0125 | 3.4 | 1.347 | 8.502 | |
Multisite | 7.00 | 68 | 0.008 | 4.6 | 1.597 | 13.806 | |
flu | Intensive | 11.72 | 237 | 0.0006 | 2.6 | 1.539 | 4.569 |
Pigs aged 11 to 14 weeks | 6.5 | 159 | 0.0107 | 2.6 | 1.286 | 5.151 | |
blueye | Region B1 | 11.46 | 114 | 0.0007 | 4.2 | 1.884 | 9.572 |
coli | Region B3 | 6.00 | 165 | 0.0142 | 2.9 | 1.302 | 6.476 |
Multisite | 4.00 | 68 | 0.045 | 3.5 | 1.149 | 10.463 | |
parasuis | Region A | 6.23 | 388 | 0.0125 | 2.1 | 1.196 | 3.651 |
Pigs aged 11 to 14 weeks | 4.64 | 159 | 0.0312 | 2.4 | 1.144 | 5.246 | |
prrs | Region B3 | 4.07 | 165 | 0.0435 | 2.6 | 1.117 | 6.252 |
Multisite | 4.00 | 68 | 0.045 | 3.5 | 1.149 | 10.463 | |
Pigs aged 11 to 14 weeks | 3.84 | 159 | 0.0499 | 2.1 | 1.046 | 4.039 | |
circo | Region B3 | 9.89 | 165 | 0.0016 | 6 | 1.989 | 18.103 |
Pigs aged 11 to 14 weeks | 3.79 | 159 | 0.0516 | 5.7 | 1.151 | 41.900 | |
ple | Region B1 | 3.87 | 114 | 0.0492 | 3.1 | 1.113 | 8.877 |
Region B3 | 9.44 | 152 | 0.0021 | 4.7 | 1.811 | 12.428 | |
Semi-intensive | 6.12 | 574 | 0.0133 | 2.3 | 1.229 | 4.333 | |
Multisite | 4.00 | 68 | 0.045 | 3.5 | 1.149 | 10.463 | |
Pigs aged 11 to 14 weeks | 8.49 | 156 | 0.0035 | 4.4 | 1.661 | 12.376 | |
Pigs aged 19 to 22 weeks | 3.85 | 122 | 0.0498 | 2.8 | 1.073 | 7.436 | |
myco | Region B3 | 6.84 | 165 | 0.0089 | 3.9 | 1.492 | 10.434 |
ery | Region B2 | 9.27 | 157 | 0.0023 | 8.5 | 1.922 | 37.652 |
Semi-intensive | 5.67 | 587 | 0.0172 | 2.2 | 1.178 | 4.223 | |
Intensive | 11.43 | 237 | 0.0007 | 2.9 | 1.589 | 5.362 | |
Farrow-to-finish farm | 6.02 | 756 | 0.0141 | 1.7 | 1.133 | 2.673 | |
Pigs aged 11 to 14 weeks | 6.21 | 159 | 0.0127 | 3.5 | 1.389 | 9.762 | |
Pigs aged 19 to 22 weeks | 3.61 | 124 | 0.0500 | 3.8 | 1.124 | 16.709 | |
services | Region B3 | 7.69 | 152 | 0.0055 | 3.5 | 1.496 | 8.176 |
Semi-intensive | 17.73 | 513 | 0.0000 | 2.7 | 1.708 | 4.318 | |
Farrow-to-finish farm | 8.74 | 654 | 0.0031 | 1.7 | 1.219 | 2.521 | |
Multisite | 14.75 | 64 | 0.0000 | 13.0 | 3.32 | 51.652 | |
wild | Region B1 | 8.11 | 114 | 0.0044 | 9.1 | 1.869 | 44.616 |
Semi-intensive | 6.44 | 587 | 0.0111 | 2.2 | 1.23 | 3.947 | |
Farrow-to-finish farm | 3.78 | 756 | 0.0519 | 1.8 | 1.032 | 3.058 | |
waste | Intensive | 5.50 | 237 | 0.0189 | 2.0 | 1.159 | 3.593 |
carcass | Region B2 | 13.37 | 157 | 0.0002 | 21.5 | 2.704 | 171.788 |
Intensive | 9.35 | 237 | 0.0022 | 15.0 | 1.911 | 118.592 | |
Farrow-to-finish farm | 5.16 | 756 | 0.0230 | 2.3 | 1.165 | 4.467 | |
wastewater | Region B1 | 18.55 | 114 | 0.0000 | 29 | 3.775 | 222.768 |
Semi-intensive | 13.20 | 587 | 0.0185 | 2.2 | 1.438 | 3.279 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Galindo-Barboza, A.J.; Rivera-Benítez, J.F.; De la Luz-Armendáriz, J.; Sánchez-Betancourt, J.I.; Hernández, J.; Sauceda-Cerecer, S.G.; De Alba-Campos, J.E. Molecular Positivity of Porcine Circovirus Type 2 Associated with Production Practices on Farms in Jalisco, Mexico. Viruses 2024, 16, 1633. https://doi.org/10.3390/v16101633
Galindo-Barboza AJ, Rivera-Benítez JF, De la Luz-Armendáriz J, Sánchez-Betancourt JI, Hernández J, Sauceda-Cerecer SG, De Alba-Campos JE. Molecular Positivity of Porcine Circovirus Type 2 Associated with Production Practices on Farms in Jalisco, Mexico. Viruses. 2024; 16(10):1633. https://doi.org/10.3390/v16101633
Chicago/Turabian StyleGalindo-Barboza, Alberto Jorge, José Francisco Rivera-Benítez, Jazmín De la Luz-Armendáriz, José Ivan Sánchez-Betancourt, Jesús Hernández, Suzel Guadalupe Sauceda-Cerecer, and Jaime Enrique De Alba-Campos. 2024. "Molecular Positivity of Porcine Circovirus Type 2 Associated with Production Practices on Farms in Jalisco, Mexico" Viruses 16, no. 10: 1633. https://doi.org/10.3390/v16101633
APA StyleGalindo-Barboza, A. J., Rivera-Benítez, J. F., De la Luz-Armendáriz, J., Sánchez-Betancourt, J. I., Hernández, J., Sauceda-Cerecer, S. G., & De Alba-Campos, J. E. (2024). Molecular Positivity of Porcine Circovirus Type 2 Associated with Production Practices on Farms in Jalisco, Mexico. Viruses, 16(10), 1633. https://doi.org/10.3390/v16101633