Computational Prediction of RNA–RNA Interactions between Small RNA Tracks from Betacoronavirus Nonstructural Protein 3 and Neurotrophin Genes during Infection of an Epithelial Lung Cancer Cell Line: Potential Role of Novel Small Regulatory RNA
Abstract
:1. Introduction
2. Materials and Methods
2.1. Data Acquisition
2.2. Differential Expression Analysis
2.3. hsa-miRNAs Targeting Beta-CoVs in Respiratory Epithelial Cells
2.4. RNA–RNA Interactions
2.5. Prediction of Putative vsRNAs
2.6. Validation of vsRNAs and Prediction of Their Potential Targets
2.7. Functional Enrichment Analysis
3. Results
3.1. Over 80% of Conserved RNA Structures in Genomes of SARS-CoV, MERS-CoV, and SARS-CoV-2 Are under Negative Selection
3.2. Identification of DEGs in Beta-CoV-Induced Epithelial Lung Cancer
3.3. hsa-miRNAs Associated with Lung Physiopathology in Beta-CoVs
3.4. The let-7 Family of hsa-miRNAs Is the Most Frequently Predicted in hsa-miRNA:3′UTR Interactions
3.5. RNA–RNA Interactions in ORF1a Appear to Produce Discrete Putative vsRNAs
3.6. ORF1a Is a Crucial Viral Gene in Modulating the Host Transcriptome
3.7. vsRNAs Are Probably Shutting Down Genes Associated with Neurotrophin Signaling Impairment upon Infection
4. Discussion
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- He, R.; Dobie, F.; Ballantine, M.; Leeson, A.; Li, Y.; Bastien, N.; Cutts, T.; Andonov, A.; Cao, J.; Booth, T.F.; et al. Analysis of Multimerization of the SARS Coronavirus Nucleocapsid Protein. Biochem. Biophys. Res. Commun. 2004, 316, 476–483. [Google Scholar] [CrossRef]
- van Boheemen, S.; de Graaf, M.; Lauber, C.; Bestebroer, T.M.; Raj, V.S.; Zaki, A.M.; Osterhaus, A.D.M.E.; Haagmans, B.L.; Gorbalenya, A.E.; Snijder, E.J.; et al. Genomic Characterization of a Newly Discovered Coronavirus Associated with Acute Respiratory Distress Syndrome in Humans. mBio 2012, 3, e00473-12. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Chan, J.F.-W.; Kok, K.-H.; Zhu, Z.; Chu, H.; To, K.K.-W.; Yuan, S.; Yuen, K.-Y. Genomic Characterization of the 2019 Novel Human-Pathogenic Coronavirus Isolated from a Patient with Atypical Pneumonia after Visiting Wuhan. Emerg. Microbes Infect. 2020, 9, 221–236. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Alanagreh, L.; Alzoughool, F.; Atoum, M. The Human Coronavirus Disease COVID-19: Its Origin, Characteristics, and Insights into Potential Drugs and Its Mechanisms. Pathogens 2020, 9, 331. [Google Scholar] [CrossRef]
- Cui, J.; Li, F.; Shi, Z.-L. Origin and Evolution of Pathogenic Coronaviruses. Nat. Rev. Microbiol. 2019, 17, 181–192. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Frutos, R.; Serra-Cobo, J.; Pinault, L.; Lopez Roig, M.; Devaux, C.A. Emergence of Bat-Related Betacoronaviruses: Hazard and Risks. Front. Microbiol. 2021, 12, 591535. [Google Scholar] [CrossRef]
- Fehr, A.R.; Perlman, S. Coronaviruses: An Overview of Their Replication and Pathogenesis. In Coronaviruses: Methods and Protocols; Maier, H.J., Bickerton, E., Britton, P., Eds.; Methods in Molecular Biology; Springer: New York, NY, USA, 2015; pp. 1–23. ISBN 978-1-4939-2438-7. [Google Scholar]
- Hussain, S.; Pan, J.; Chen, Y.; Yang, Y.; Xu, J.; Peng, Y.; Wu, Y.; Li, Z.; Zhu, Y.; Tien, P.; et al. Identification of Novel Subgenomic RNAs and Noncanonical Transcription Initiation Signals of Severe Acute Respiratory Syndrome Coronavirus. J. Virol. 2005, 79, 5288–5295. [Google Scholar] [CrossRef] [Green Version]
- Nowick, K.; Walter Costa, M.B.; Höner zu Siederdissen, C.; Stadler, P.F. Selection Pressures on RNA Sequences and Structures. Evol. Bioinform. Online 2019, 15, 1176934319871919. [Google Scholar] [CrossRef] [Green Version]
- Piskol, R.; Stephan, W. Analyzing the Evolution of RNA Secondary Structures in Vertebrate Introns Using Kimura’s Model of Compensatory Fitness Interactions. Mol. Biol. Evol. 2008, 25, 2483–2492. [Google Scholar] [CrossRef] [Green Version]
- Walter Costa, M.B.; Höner zu Siederdissen, C.; Dunjić, M.; Stadler, P.F.; Nowick, K. SSS-Test: A Novel Test for Detecting Positive Selection on RNA Secondary Structure. BMC Bioinform. 2019, 20, 151. [Google Scholar] [CrossRef] [Green Version]
- Friedman, R.C.; Farh, K.K.-H.; Burge, C.B.; Bartel, D.P. Most Mammalian MRNAs Are Conserved Targets of MicroRNAs. Genome Res. 2009, 19, 92–105. [Google Scholar] [CrossRef] [Green Version]
- Sætrom, P.; Snøve, O.; Nedland, M.; Grünfeld, T.B.; Lin, Y.; Bass, M.B.; Canon, J.R. Conserved MicroRNA Characteristics in Mammals. Oligonucleotides 2006, 16, 115–144. [Google Scholar] [CrossRef] [PubMed]
- Cullen, B.R. Transcription and Processing of Human MicroRNA Precursors. Mol. Cell 2004, 16, 861–865. [Google Scholar] [CrossRef]
- Brennecke, J.; Stark, A.; Russell, R.B.; Cohen, S.M. Principles of MicroRNA-Target Recognition. PLoS Biol. 2005, 3, e85. [Google Scholar] [CrossRef] [Green Version]
- Lewis, B.P.; Burge, C.B.; Bartel, D.P. Conserved Seed Pairing, Often Flanked by Adenosines, Indicates That Thousands of Human Genes Are MicroRNA Targets. Cell 2005, 120, 15–20. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Cox, J.E.; Sullivan, C.S. Balance and Stealth: The Role of Noncoding RNAs in the Regulation of Virus Gene Expression. Annu. Rev. Virol. 2014, 1, 89–109. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Withers, J.B.; Mondol, V.; Pawlica, P.; Rosa-Mercado, N.A.; Tycowski, K.T.; Ghasempur, S.; Torabi, S.F.; Steitz, J.A. Idiosyncrasies of Viral Noncoding RNAs Provide Insights into Host Cell Biology. Annu. Rev. Virol. 2019, 6, 297–317. [Google Scholar] [CrossRef]
- Kim, V.N.; Han, J.; Siomi, M.C. Biogenesis of Small RNAs in Animals. Nat. Rev. Mol. Cell Biol. 2009, 10, 126–139. [Google Scholar] [CrossRef] [PubMed]
- Mishra, R.; Kumar, A.; Ingle, H.; Kumar, H. The Interplay Between Viral-Derived MiRNAs and Host Immunity During Infection. Front. Immunol. 2020, 10, 3079. [Google Scholar] [CrossRef] [Green Version]
- Omoto, S.; Ito, M.; Tsutsumi, Y.; Ichikawa, Y.; Okuyama, H.; Brisibe, E.A.; Saksena, N.K.; Fujii, Y.R. HIV-1 Nef Suppression by Virally Encoded MicroRNA. Retrovirology 2004, 1, 44. [Google Scholar] [CrossRef] [Green Version]
- Pham, T.N.; Lukhele, S.; Hajjar, F.; Routy, J.-P.; Cohen, É.A. HIV Nef and Vpu Protect HIV-Infected CD4+ T Cells from Antibody-Mediated Cell Lysis through down-Modulation of CD4 and BST2. Retrovirology 2014, 11, 15. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Bernard, M.A.; Zhao, H.; Yue, S.C.; Anandaiah, A.; Koziel, H.; Tachado, S.D. Novel HIV-1 MiRNAs Stimulate TNFα Release in Human Macrophages via TLR8 Signaling Pathway. PLoS ONE 2014, 9, e106006. [Google Scholar] [CrossRef] [PubMed]
- Li, X.; Fu, Z.; Liang, H.; Wang, Y.; Qi, X.; Ding, M.; Sun, X.; Zhou, Z.; Huang, Y.; Gu, H.; et al. H5N1 Influenza Virus-Specific MiRNA-like Small RNA Increases Cytokine Production and Mouse Mortality via Targeting Poly(RC)-Binding Protein 2. Cell Res. 2018, 28, 157–171. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Hussain, M.; Asgari, S. MicroRNA-like Viral Small RNA from Dengue Virus 2 Autoregulates Its Replication in Mosquito Cells. Proc. Natl. Acad. Sci. USA 2014, 111, 2746–2751. [Google Scholar] [CrossRef]
- Teng, Y.; Wang, Y.; Zhang, X.; Liu, W.; Fan, H.; Yao, H.; Lin, B.; Zhu, P.; Yuan, W.; Tong, Y.; et al. Systematic Genome-Wide Screening and Prediction of MicroRNAs in EBOV During the 2014 Ebolavirus Outbreak. Sci. Rep. 2015, 5, 9912. [Google Scholar] [CrossRef] [Green Version]
- Liu, Y.; Sun, J.; Zhang, H.; Wang, M.; Gao, G.F.; Li, X. Ebola Virus Encodes a MiR-155 Analog to Regulate Importin-A5 Expression. Cell. Mol. Life Sci. 2016, 73, 3733–3744. [Google Scholar] [CrossRef]
- Chen, Z.; Liang, H.; Chen, X.; Ke, Y.; Zhou, Z.; Yang, M.; Zen, K.; Yang, R.; Liu, C.; Zhang, C.-Y. An Ebola Virus-Encoded MicroRNA-like Fragment Serves as a Biomarker for Early Diagnosis of Ebola Virus Disease. Cell Res. 2016, 26, 380–383. [Google Scholar] [CrossRef] [Green Version]
- Duy, J.; Honko, A.N.; Altamura, L.A.; Bixler, S.L.; Wollen-Roberts, S.; Wauquier, N.; O’Hearn, A.; Mucker, E.M.; Johnson, J.C.; Shamblin, J.D.; et al. Virus-Encoded MiRNAs in Ebola Virus Disease. Sci. Rep. 2018, 8, 6480. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Langlois, R.A.; Shapiro, J.S.; Pham, A.M.; tenOever, B.R. In Vivo Delivery of Cytoplasmic RNA Virus-Derived MiRNAs. Mol. Ther. 2012, 20, 367–375. [Google Scholar] [CrossRef] [Green Version]
- Rouha, H.; Thurner, C.; Mandl, C.W. Functional MicroRNA Generated from a Cytoplasmic RNA Virus. Nucleic Acids Res. 2010, 38, 8328–8337. [Google Scholar] [CrossRef] [Green Version]
- Shapiro, J.S.; Langlois, R.A.; Pham, A.M.; Tenoever, B.R. Evidence for a Cytoplasmic Microprocessor of Pri-MiRNAs. RNA 2012, 18, 1338–1346. [Google Scholar] [CrossRef] [Green Version]
- Aydemir, M.N.; Aydemir, H.B.; Korkmaz, E.M.; Budak, M.; Cekin, N.; Pinarbasi, E. Computationally Predicted SARS-COV-2 Encoded MicroRNAs Target NFKB, JAK/STAT and TGFB Signaling Pathways. Gene Rep. 2021, 22, 101012. [Google Scholar] [CrossRef]
- Merino, G.A.; Raad, J.; Bugnon, L.A.; Yones, C.; Kamenetzky, L.; Claus, J.; Ariel, F.; Milone, D.H.; Stegmayer, G. Novel SARS-CoV-2 Encoded Small RNAs in the Passage to Humans. Bioinformatics 2020, 36, 5571–5581. [Google Scholar] [CrossRef]
- Saçar Demirci, M.D.; Adan, A. Computational Analysis of MicroRNA-Mediated Interactions in SARS-CoV-2 Infection. PeerJ 2020, 8, e9369. [Google Scholar] [CrossRef]
- Saini, S.; Saini, A.; Thakur, C.J.; Kumar, V.; Gupta, R.D.; Sharma, J.K. Genome-Wide Computational Prediction of MiRNAs in Severe Acute Respiratory Syndrome Coronavirus 2 (SARS-CoV-2) Revealed Target Genes Involved in Pulmonary Vasculature and Antiviral Innate Immunity. Mol. Biol. Res. Commun. 2020, 9, 83–91. [Google Scholar] [CrossRef]
- Verma, S.; Dwivedy, A.; Kumar, N.; Biswal, B.K. Computational Prediction of SARS-CoV-2 Encoded MiRNAs and Their Putative Host Targets. bioRxiv 2020. [Google Scholar] [CrossRef]
- Prasad, A.N.; Ronk, A.J.; Widen, S.G.; Wood, T.G.; Basler, C.F.; Bukreyev, A. Ebola Virus Produces Discrete Small Noncoding RNAs Independently of the Host MicroRNA Pathway Which Lack RNA Interference Activity in Bat and Human Cells. J. Virol. 2020, 94, e01441-19. [Google Scholar] [CrossRef]
- Rojas-Cruz, A.F.; Gallego-Gómez, J.C.; Bermúdez-Santana, C.I. RNA Structure-Altering Mutations Underlying Positive Selection on Spike Protein Reveal Novel Putative Signatures to Trace Crossing Host-Species Barriers in Betacoronavirus. RNA Biol. 2022, 19, 1019–1044. [Google Scholar] [CrossRef]
- Gruber, A.R.; Findeiß, S.; Washietl, S.; Hofacker, I.L.; Stadler, P.F. RNAz 2.0: Improved Noncoding RNA Detection. Pac. Symp. Biocomput. 2010, 2010, 69–79. [Google Scholar]
- Robinson, M.D.; McCarthy, D.J.; Smyth, G.K. EdgeR: A Bioconductor Package for Differential Expression Analysis of Digital Gene Expression Data. Bioinformatics 2010, 26, 139–140. [Google Scholar] [CrossRef] [Green Version]
- Lun, A.T.L.; Chen, Y.; Smyth, G.K. It’s DE-Licious: A Recipe for Differential Expression Analyses of RNA-Seq Experiments Using Quasi-Likelihood Methods in EdgeR. Methods Mol. Biol. 2016, 1418, 391–416. [Google Scholar] [CrossRef] [PubMed]
- Masters, P.S. The Molecular Biology of Coronaviruses. In Advances in Virus Research; Academic Press: Cambridge, MA, USA, 2006; Volume 66, pp. 193–292. [Google Scholar]
- Agarwal, V.; Bell, G.W.; Nam, J.-W.; Bartel, D.P. Predicting Effective MicroRNA Target Sites in Mammalian MRNAs. eLife 2015, 4, e05005. [Google Scholar] [CrossRef] [PubMed]
- Chen, Y.; Wang, X. MiRDB: An Online Database for Prediction of Functional MicroRNA Targets. Nucleic Acids Res. 2020, 48, D127–D131. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Huang, H.-Y.; Lin, Y.-C.-D.; Li, J.; Huang, K.-Y.; Shrestha, S.; Hong, H.-C.; Tang, Y.; Chen, Y.-G.; Jin, C.-N.; Yu, Y.; et al. MiRTarBase 2020: Updates to the Experimentally Validated MicroRNA-Target Interaction Database. Nucleic Acids Res. 2020, 48, D148–D154. [Google Scholar] [CrossRef] [Green Version]
- Sticht, C.; De La Torre, C.; Parveen, A.; Gretz, N. MiRWalk: An Online Resource for Prediction of MicroRNA Binding Sites. PLoS ONE 2018, 13, e0206239. [Google Scholar] [CrossRef]
- Kozomara, A.; Birgaoanu, M.; Griffiths-Jones, S. MiRBase: From MicroRNA Sequences to Function. Nucleic Acids Res. 2019, 47, D155–D162. [Google Scholar] [CrossRef]
- Mignone, F.; Grillo, G.; Licciulli, F.; Iacono, M.; Liuni, S.; Kersey, P.J.; Duarte, J.; Saccone, C.; Pesole, G. UTRdb and UTRsite: A Collection of Sequences and Regulatory Motifs of the Untranslated Regions of Eukaryotic MRNAs. Nucleic Acids Res. 2005, 33, D141–D146. [Google Scholar] [CrossRef] [Green Version]
- Krüger, J.; Rehmsmeier, M. RNAhybrid: MicroRNA Target Prediction Easy, Fast and Flexible. Nucleic Acids Res. 2006, 34, W451–W454. [Google Scholar] [CrossRef] [PubMed]
- Betel, D.; Koppal, A.; Agius, P.; Sander, C.; Leslie, C. Comprehensive Modeling of MicroRNA Targets Predicts Functional Non-Conserved and Non-Canonical Sites. Genome Biol. 2010, 11, R90. [Google Scholar] [CrossRef] [Green Version]
- Shu, X.; Zang, X.; Liu, X.; Yang, J.; Wang, J. Predicting MicroRNA Mediated Gene Regulation between Human and Viruses. Cells 2018, 7, 100. [Google Scholar] [CrossRef] [Green Version]
- Gao, C.-H.; Yu, G.; Cai, P. GgVennDiagram: An Intuitive, Easy-to-Use, and Highly Customizable R Package to Generate Venn Diagram. Front. Genet. 2021, 12, 706907. [Google Scholar] [CrossRef]
- Vlachos, I.S.; Hatzigeorgiou, A.G. Functional Analysis of MiRNAs Using the DIANA Tools Online Suite. Methods Mol. Biol. 2017, 1517, 25–50. [Google Scholar] [CrossRef]
- Mi, H.; Muruganujan, A.; Ebert, D.; Huang, X.; Thomas, P.D. PANTHER Version 14: More Genomes, a New PANTHER GO-Slim and Improvements in Enrichment Analysis Tools. Nucleic Acids Res. 2019, 47, D419–D426. [Google Scholar] [CrossRef] [Green Version]
- Diamond, M.S.; Kanneganti, T.-D. Innate Immunity: The First Line of Defense against SARS-CoV-2. Nat. Immunol. 2022, 23, 165–176. [Google Scholar] [CrossRef] [PubMed]
- Gusev, E.; Sarapultsev, A.; Solomatina, L.; Chereshnev, V. SARS-CoV-2-Specific Immune Response and the Pathogenesis of COVID-19. Int. J. Mol. Sci. 2022, 23, 1716. [Google Scholar] [CrossRef]
- Paludan, S.R.; Mogensen, T.H. Innate Immunological Pathways in COVID-19 Pathogenesis. Sci. Immunol. 2022, 7, eabm5505. [Google Scholar] [CrossRef]
- Grundhoff, A.; Sullivan, C.S. Virus-Encoded MicroRNAs. Virology 2011, 411, 325–343. [Google Scholar] [CrossRef] [Green Version]
- Kincaid, R.P.; Burke, J.M.; Sullivan, C.S. RNA Virus MicroRNA That Mimics a B-Cell OncomiR. Proc. Natl. Acad. Sci. USA 2012, 109, 3077–3082. [Google Scholar] [CrossRef]
- Cullen, B.R. Five Questions about Viruses and MicroRNAs. PLoS Pathog. 2010, 6, e1000787. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Varble, A.; tenOever, B.R. Implications of RNA Virus-Produced MiRNAs. RNA Biol. 2011, 8, 190–194. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Shi, J.; Sun, J.; Wang, B.; Wu, M.; Zhang, J.; Duan, Z.; Wang, H.; Hu, N.; Hu, Y. Novel MicroRNA-like Viral Small Regulatory RNAs Arising during Human Hepatitis A Virus Infection. FASEB J. 2014, 28, 4381–4393. [Google Scholar] [CrossRef]
- Alam, T.; Lipovich, L. MiRCOVID-19: Potential Targets of Human MiRNAs in SARS-CoV-2 for RNA-Based Drug Discovery. Non-Coding RNA 2021, 7, 18. [Google Scholar] [CrossRef] [PubMed]
- Arisan, E.D.; Dart, A.; Grant, G.H.; Arisan, S.; Cuhadaroglu, S.; Lange, S.; Uysal-Onganer, P. The Prediction of MiRNAs in SARS-CoV-2 Genomes: Hsa-MiR Databases Identify 7 Key MiRs Linked to Host Responses and Virus Pathogenicity-Related KEGG Pathways Significant for Comorbidities. Viruses 2020, 12, 614. [Google Scholar] [CrossRef]
- Barreda-Manso, M.A.; Nieto-Díaz, M.; Soto, A.; Muñoz-Galdeano, T.; Reigada, D.; Maza, R.M. In Silico and In Vitro Analyses Validate Human MicroRNAs Targeting the SARS-CoV-2 3′-UTR. Int. J. Mol. Sci. 2021, 22, 6094. [Google Scholar] [CrossRef]
- Chow, J.T.-S.; Salmena, L. Prediction and Analysis of SARS-CoV-2-Targeting MicroRNA in Human Lung Epithelium. Genes 2020, 11, 1002. [Google Scholar] [CrossRef]
- Fulzele, S.; Sahay, B.; Yusufu, I.; Lee, T.J.; Sharma, A.; Kolhe, R.; Isales, C.M. COVID-19 Virulence in Aged Patients Might Be Impacted by the Host Cellular MicroRNAs Abundance/Profile. Aging Dis. 2020, 11, 509–522. [Google Scholar] [CrossRef]
- Pierce, J.B.; Simion, V.; Icli, B.; Pérez-Cremades, D.; Cheng, H.S.; Feinberg, M.W. Computational Analysis of Targeting SARS-CoV-2, Viral Entry Proteins ACE2 and TMPRSS2, and Interferon Genes by Host MicroRNAs. Genes 2020, 11, 1354. [Google Scholar] [CrossRef]
- Agwa, S.H.A.; Elghazaly, H.; Meteini, M.S.E.; Shawky, S.M.; Ali, M.; Abd Elsamee, A.M.; Sayed, S.M.; Sherif, N.; Sharaf, H.M.; Alhadidy, M.A.; et al. In Silico Identification and Clinical Validation of a Novel Long Non-Coding RNA/MRNA/MiRNA Molecular Network for Potential Biomarkers for Discriminating SARS CoV-2 Infection Severity. Cells 2021, 10, 3098. [Google Scholar] [CrossRef]
- Rivas, E. RNA Structure Prediction Using Positive and Negative Evolutionary Information. PLoS Comput. Biol. 2020, 16, e1008387. [Google Scholar] [CrossRef]
- Morales, L.; Oliveros, J.C.; Fernandez-Delgado, R.; tenOever, B.R.; Enjuanes, L.; Sola, I. SARS-CoV-Encoded Small RNAs Contribute to Infection-Associated Lung Pathology. Cell Host Microbe 2017, 21, 344–355. [Google Scholar] [CrossRef] [Green Version]
- Pawlica, P.; Yario, T.A.; White, S.; Wang, J.; Moss, W.N.; Hui, P.; Vinetz, J.M.; Steitz, J.A. SARS-CoV-2 Expresses a MicroRNA-like Small RNA Able to Selectively Repress Host Genes. Proc. Natl. Acad. Sci. USA 2021, 118, e2116668118. [Google Scholar] [CrossRef] [PubMed]
- Singh, M.; Chazal, M.; Quarato, P.; Bourdon, L.; Malabat, C.; Vallet, T.; Vignuzzi, M.; van der Werf, S.; Behillil, S.; Donati, F.; et al. A Virus-Derived MicroRNA Targets Immune Response Genes during SARS-CoV-2 Infection. EMBO Rep. 2022, 23, e54341. [Google Scholar] [CrossRef]
- Perez, J.T.; Varble, A.; Sachidanandam, R.; Zlatev, I.; Manoharan, M.; García-Sastre, A.; tenOever, B.R. Influenza A Virus-Generated Small RNAs Regulate the Switch from Transcription to Replication. Proc. Natl. Acad. Sci. USA 2010, 107, 11525–11530. [Google Scholar] [CrossRef]
- Weng, K.-F.; Hung, C.-T.; Hsieh, P.-T.; Li, M.-L.; Chen, G.-W.; Kung, Y.-A.; Huang, P.-N.; Kuo, R.-L.; Chen, L.-L.; Lin, J.-Y.; et al. A Cytoplasmic RNA Virus Generates Functional Viral Small RNAs and Regulates Viral IRES Activity in Mammalian Cells. Nucleic Acids Res. 2014, 42, 12789–12805. [Google Scholar] [CrossRef] [PubMed]
- Sun, G.; Cui, Q.; Garcia, G.; Lizhar, E.M.; Arumugaswami, V.; Shi, Y.; Riggs, A.D. Viral and Host Small RNA Response to SARS-CoV-2 Infection. Microbiol. Res. 2022, 13, 788–808. [Google Scholar] [CrossRef]
- Akula, S.M.; Bolin, P.; Cook, P.P. Cellular MiR-150-5p May Have a Crucial Role to Play in the Biology of SARS-CoV-2 Infection by Regulating Nsp10 Gene. RNA Biol. 2022, 19, 1–11. [Google Scholar] [CrossRef] [PubMed]
- Lei, J.; Kusov, Y.; Hilgenfeld, R. Nsp3 of Coronaviruses: Structures and Functions of a Large Multi-Domain Protein. Antiviral. Res. 2018, 149, 58–74. [Google Scholar] [CrossRef] [PubMed]
- Fu, Z.; Wang, J.; Wang, Z.; Sun, Y.; Wu, J.; Zhang, Y.; Liu, X.; Zhou, Z.; Zhou, L.; Zhang, C.-Y.; et al. A Virus-Derived MicroRNA-like Small RNA Serves as a Serum Biomarker to Prioritize the COVID-19 Patients at High Risk of Developing Severe Disease. Cell Discov. 2021, 7, 48. [Google Scholar] [CrossRef]
- Peronace, C.; Tallerico, R.; Colosimo, M.; Fazio, M.D.; Pasceri, F.; Talotta, I.; Panduri, G.; Pintomalli, L.; Oteri, R.; Calantoni, V.; et al. The First Identification in Italy of SARS-CoV-2 Omicron BA.4 Harboring KSF141_del: A Genomic Comparison with Omicron Sub-Variants. Biomedicines 2022, 10, 1839. [Google Scholar] [CrossRef] [PubMed]
- Elssaig, E.H.; Alnour, T.M.S.; Ullah, M.F.; Ahmed-Abakur, E.H. Omicron SARS-CoV-2 Variants in an In Silico Genomic Comparison Study with the Original Wuhan Strain and WHO-Recognized Variants of Concern. Pol. J. Microbiol. 2022, 71, 577–587. [Google Scholar] [CrossRef] [PubMed]
- Davis, H.E.; McCorkell, L.; Vogel, J.M.; Topol, E.J. Long COVID: Major Findings, Mechanisms and Recommendations. Nat. Rev. Microbiol. 2023, 21, 133–146. [Google Scholar] [CrossRef] [PubMed]
- tenOever, B.R. RNA Viruses and the Host MicroRNA Machinery. Nat. Rev. Microbiol. 2013, 11, 169–180. [Google Scholar] [CrossRef] [PubMed]
- Zhang, W.; Chua, B.Y.; Selva, K.J.; Kedzierski, L.; Ashhurst, T.M.; Haycroft, E.R.; Shoffner-Beck, S.K.; Hensen, L.; Boyd, D.F.; James, F.; et al. SARS-CoV-2 Infection Results in Immune Responses in the Respiratory Tract and Peripheral Blood That Suggest Mechanisms of Disease Severity. Nat. Commun. 2022, 13, 2774. [Google Scholar] [CrossRef] [PubMed]
- Nakayama, E.E.; Kubota-Koketsu, R.; Sasaki, T.; Suzuki, K.; Uno, K.; Shimizu, J.; Okamoto, T.; Matsumoto, H.; Matsuura, H.; Hashimoto, S.; et al. Anti-Nucleocapsid Antibodies Enhance the Production of IL-6 Induced by SARS-CoV-2 N Protein. Sci. Rep. 2022, 12, 8108. [Google Scholar] [CrossRef]
- Luo, J.; Lu, S.; Yu, M.; Zhu, L.; Zhu, C.; Li, C.; Fang, J.; Zhu, X.; Wang, X. The Potential Involvement of JAK-STAT Signaling Pathway in the COVID-19 Infection Assisted by ACE2. Gene 2021, 768, 145325. [Google Scholar] [CrossRef]
- Asgarzadeh, A.; Fouladi, N.; Asghariazar, V.; Sarabi, S.F.; Khiavi, H.A.; Mahmoudi, M.; Safarzadeh, E. Serum Brain-Derived Neurotrophic Factor (BDNF) in COVID-19 Patients and Its Association with the COVID-19 Manifestations. J. Mol. Neurosci. 2022, 72, 1820–1830. [Google Scholar] [CrossRef]
- Rutkai, I.; Mayer, M.G.; Hellmers, L.M.; Ning, B.; Huang, Z.; Monjure, C.J.; Coyne, C.; Silvestri, R.; Golden, N.; Hensley, K.; et al. Neuropathology and Virus in Brain of SARS-CoV-2 Infected Non-Human Primates. Nat. Commun. 2022, 13, 1745. [Google Scholar] [CrossRef]
- Azoulay, D.; Shehadeh, M.; Chepa, S.; Shaoul, E.; Baroum, M.; Horowitz, N.A.; Kaykov, E. Recovery from SARS-CoV-2 Infection Is Associated with Serum BDNF Restoration. J. Infect. 2020, 81, e79–e81. [Google Scholar] [CrossRef] [PubMed]
- Minuzzi, L.G.; Seelaender, M.; Silva, B.S.D.A.; Cunha, E.D.B.B.; Deus, M.D.C.; Vasconcellos, F.T.F.; Marqueze, L.F.B.; Gadotti, A.C.; Baena, C.P.; Pereira, T.; et al. COVID-19 Outcome Relates with Circulating BDNF, According to Patient Adiposity and Age. Front. Nutr. 2021, 8, 784429. [Google Scholar] [CrossRef]
- Bohmwald, K.; Andrade, C.A.; Mora, V.P.; Muñoz, J.T.; Ramírez, R.; Rojas, M.F.; Kalergis, A.M. Neurotrophin Signaling Impairment by Viral Infections in the Central Nervous System. Int. J. Mol. Sci. 2022, 23, 5817. [Google Scholar] [CrossRef]
- Zhao, Q.; Lü, J.; Zhao, B.; Guo, Y.; Wang, Q.; Yu, S.; Hao, L.; Zhu, X.; Yu, Z. Identification of a SARS-CoV-2 virus-derived vmiRNA in COVID-19 patients holding potential as a diagnostic biomarker. Front. Cell Infect. Microbiol. 2023, 13, 1190870. [Google Scholar] [CrossRef] [PubMed]
- Fossat, N.; Lundsgaard, E.A.; Costa, R.; Rivera-Rangel, L.R.; Nielsen, L.; Mikkelsen, L.S.; Ramirez, S.; Bukh, J.; Scheel, T.K.H. Identification of the viral and cellular microRNA interactomes during SARS-CoV-2 infection. Cell Rep. 2023, 42, 112282. [Google Scholar] [CrossRef] [PubMed]
- Mallick, B.; Ghosh, Z.; Chakrabarti, J. MicroRNome Analysis Unravels the Molecular Basis of SARS Infection in Bronchoalveolar Stem Cells. PLoS ONE 2009, 4, e7837. [Google Scholar] [CrossRef] [PubMed]
- Liu, Q.; Du, J.; Yu, X.; Xu, J.; Huang, F.; Li, X.; Zhang, C.; Li, X.; Chang, J.; Shang, D.; et al. MiRNA-200c-3p Is Crucial in Acute Respiratory Distress Syndrome. Cell Discov. 2017, 3, 17021. [Google Scholar] [CrossRef]
- Wyler, E.; Mösbauer, K.; Franke, V.; Diag, A.; Gottula, L.T.; Arsiè, R.; Klironomos, F.; Koppstein, D.; Hönzke, K.; Ayoub, S.; et al. Transcriptomic Profiling of SARS-CoV-2 Infected Human Cell Lines Identifies HSP90 as Target for COVID-19 Therapy. iScience 2021, 24, 102151. [Google Scholar] [CrossRef]
- Kim, W.R.; Park, E.G.; Kang, K.-W.; Lee, S.-M.; Kim, B.; Kim, H.-S. Expression Analyses of MicroRNAs in Hamster Lung Tissues Infected by SARS-CoV-2. Mol. Cells 2020, 43, 953–963. [Google Scholar] [CrossRef]
- Zhang, X.; Chu, H.; Wen, L.; Shuai, H.; Yang, D.; Wang, Y.; Hou, Y.; Zhu, Z.; Yuan, S.; Yin, F.; et al. Competing Endogenous RNA Network Profiling Reveals Novel Host Dependency Factors Required for MERS-CoV Propagation. Emerg. Microbes Infect. 2020, 9, 733–746. [Google Scholar] [CrossRef] [Green Version]
- Hasan, M.M.; Akter, R.; Ullah, M.S.; Abedin, M.J.; Ullah, G.M.A.; Hossain, M.Z. A Computational Approach for Predicting Role of Human MicroRNAs in MERS-CoV Genome. Adv. Bioinform. 2014, 2014, e967946. [Google Scholar] [CrossRef] [Green Version]
- Wu, Y.-H.; Yeh, I.-J.; Phan, N.N.; Yen, M.-C.; Hung, J.-H.; Chiao, C.-C.; Chen, C.-F.; Sun, Z.; Hsu, H.-P.; Wang, C.-Y.; et al. Gene Signatures and Potential Therapeutic Targets of Middle East Respiratory Syndrome Coronavirus (MERS-CoV)-Infected Human Lung Adenocarcinoma Epithelial Cells. J. Microbiol. Immunol. Infect. 2021, 54, 845. [Google Scholar] [CrossRef]
- Martínez-Fleta, P.; Vera-Tomé, P.; Jiménez-Fernández, M.; Requena, S.; Roy-Vallejo, E.; Sanz-García, A.; Lozano-Prieto, M.; López-Sanz, C.; Vara, A.; Lancho-Sánchez, Á.; et al. A Differential Signature of Circulating MiRNAs and Cytokines Between COVID-19 and Community-Acquired Pneumonia Uncovers Novel Physiopathological Mechanisms of COVID-19. Front. Immunol. 2022, 12, 815651. [Google Scholar] [CrossRef]
- Siniscalchi, C.; Di Palo, A.; Russo, A.; Potenza, N. Human MicroRNAs Interacting With SARS-CoV-2 RNA Sequences: Computational Analysis and Experimental Target Validation. Front. Genet. 2021, 12, 760. [Google Scholar] [CrossRef]
- Jafarinejad-Farsangi, S.; Jazi, M.M.; Rostamzadeh, F.; Hadizadeh, M. High Affinity of Host Human MicroRNAs to SARS-CoV-2 Genome: An in Silico Analysis. Non-Coding RNA Res. 2020, 5, 222–231. [Google Scholar] [CrossRef] [PubMed]
- Tang, H.; Gao, Y.; Li, Z.; Miao, Y.; Huang, Z.; Liu, X.; Xie, L.; Li, H.; Wen, W.; Zheng, Y.; et al. The Noncoding and Coding Transcriptional Landscape of the Peripheral Immune Response in Patients with COVID-19. Clin. Transl. Med. 2020, 10, e200. [Google Scholar] [CrossRef] [PubMed]
- García-Hidalgo, M.C.; González, J.; Benítez, I.D.; Carmona, P.; Santisteve, S.; Pérez-Pons, M.; Moncusí-Moix, A.; Gort-Paniello, C.; Rodríguez-Jara, F.; Molinero, M.; et al. Identification of Circulating MicroRNA Profiles Associated with Pulmonary Function and Radiologic Features in Survivors of SARS-CoV-2-Induced ARDS. Emerg. Microbes Infect. 2022, 11, 1537–1549. [Google Scholar] [CrossRef] [PubMed]
- Kassif-Lerner, R.; Zloto, K.; Rubin, N.; Asraf, K.; Doolman, R.; Paret, G.; Nevo-Caspi, Y. MiR-155: A Potential Biomarker for Predicting Mortality in COVID-19 Patients. J. Pers. Med. 2022, 12, 324. [Google Scholar] [CrossRef] [PubMed]
- Farr, R.J.; Rootes, C.L.; Stenos, J.; Foo, C.H.; Cowled, C.; Stewart, C.R. Detection of SARS-CoV-2 Infection by MicroRNA Profiling of the Upper Respiratory Tract. PLoS ONE 2022, 17, e0265670. [Google Scholar] [CrossRef]
- Garcia-Giralt, N.; Du, J.; Marin-Corral, J.; Bódalo-Torruella, M.; Blasco-Hernando, F.; Muñoz-Bermúdez, R.; Clarós, M.; Nonell, L.; Perera-Bel, J.; Fernandez-González, M.; et al. Circulating MicroRNA Profiling Is Altered in the Acute Respiratory Distress Syndrome Related to SARS-CoV-2 Infection. Sci. Rep. 2022, 12, 6929. [Google Scholar] [CrossRef]
- Li, C.; Wang, R.; Wu, A.; Yuan, T.; Song, K.; Bai, Y.; Liu, X. SARS-COV-2 as Potential MicroRNA Sponge in COVID-19 Patients. BMC Med. Genom. 2022, 15, 94. [Google Scholar] [CrossRef]
- Banaganapalli, B.; Al-Rayes, N.; Awan, Z.A.; Alsulaimany, F.A.; Alamri, A.S.; Elango, R.; Malik, M.Z.; Shaik, N.A. Multilevel Systems Biology Analysis of Lung Transcriptomics Data Identifies Key MiRNAs and Potential MiRNA Target Genes for SARS-CoV-2 Infection. Comput. Biol. Med. 2021, 135, 104570. [Google Scholar] [CrossRef] [PubMed]
- Matarese, A.; Gambardella, J.; Sardu, C.; Santulli, G. MiR-98 Regulates TMPRSS2 Expression in Human Endothelial Cells: Key Implications for COVID-19. Biomedicines 2020, 8, 462. [Google Scholar] [CrossRef]
- Centa, A.; Fonseca, A.S.; da Silva Ferreira, S.G.; Azevedo, M.L.V.; de Paula, C.B.V.; Nagashima, S.; Machado-Souza, C.; Dos Santos Miggiolaro, A.F.R.; Pellegrino Baena, C.; de Noronha, L.; et al. Deregulated MiRNA Expression Is Associated with Endothelial Dysfunction in Post-Mortem Lung Biopsies of COVID-19 Patients. Am. J. Physiol. Lung Cell. Mol. Physiol. 2021, 320, L405–L412. [Google Scholar] [CrossRef]
- Gasparello, J.; Finotti, A.; Gambari, R. Tackling the COVID-19 “Cytokine Storm” with MicroRNA Mimics Directly Targeting the 3′UTR of pro-Inflammatory MRNAs. Med. Hypotheses 2021, 146, 110415. [Google Scholar] [CrossRef] [PubMed]
- Balmeh, N.; Mahmoudi, S.; Mohammadi, N.; Karabedianhajiabadi, A. Predicted Therapeutic Targets for COVID-19 Disease by Inhibiting SARS-CoV-2 and Its Related Receptors. Inform. Med. Unlocked 2020, 20, 100407. [Google Scholar] [CrossRef]
- Lu, D.; Chatterjee, S.; Xiao, K.; Riedel, I.; Wang, Y.; Foo, R.; Bär, C.; Thum, T. MicroRNAs Targeting the SARS-CoV-2 Entry Receptor ACE2 in Cardiomyocytes. J. Mol. Cell. Cardiol. 2020, 148, 46–49. [Google Scholar] [CrossRef] [PubMed]
- Fernández-Pato, A.; Virseda-Berdices, A.; Resino, S.; Ryan, P.; Martínez-González, O.; Pérez-García, F.; Martin-Vicente, M.; Valle-Millares, D.; Brochado-Kith, O.; Blancas, R.; et al. Plasma MiRNA Profile at COVID-19 Onset Predicts Severity Status and Mortality. Emerg. Microbes Infect. 2022, 11, 676–688. [Google Scholar] [CrossRef]
- Eichmeier, A.; Kiss, T.; Kocanova, M.; Hakalova, E.; Spetik, M.; Cechova, J.; Tichy, B. Conserved MicroRNAs in Human Nasopharynx Tissue Samples from Swabs Are Differentially Expressed in Response to SARS-CoV-2. Genes 2022, 13, 348. [Google Scholar] [CrossRef] [PubMed]
- Elemam, N.M.; Hasswan, H.; Aljaibeji, H.; Sharif-Askari, N.S.; Halwani, R.; Taneera, J.; Sulaiman, N. Profiling Levels of Serum MicroRNAs and Soluble ACE2 in COVID-19 Patients. Life 2022, 12, 575. [Google Scholar] [CrossRef] [PubMed]
- Zhang, S.; Amahong, K.; Zhang, C.; Li, F.; Gao, J.; Qiu, Y.; Zhu, F. RNA–RNA Interactions between SARS-CoV-2 and Host Benefit Viral Development and Evolution during COVID-19 Infection. Brief. Bioinform. 2022, 23, bbab397. [Google Scholar] [CrossRef] [PubMed]
- Bartoszewski, R.; Dabrowski, M.; Jakiela, B.; Matalon, S.; Harrod, K.S.; Sanak, M.; Collawn, J.F. SARS-CoV-2 May Regulate Cellular Responses through Depletion of Specific Host MiRNAs. Am. J. Physiol. Lung Cell. Mol. Physiol. 2020, 319, L444–L455. [Google Scholar] [CrossRef]
Virus | Host | Total of Loci under Selection Pressures | Total of Loci under Negative Selection | 1 Genome Coverage (%) |
---|---|---|---|---|
SARS-CoV | Bat | 46 | 32 | 12.91 |
Intermediate | 62 | 59 | 23.85 | |
Human | 72 | 68 | 27.47 | |
MERS-CoV | Bat | 85 | 78 | 31.17 |
Intermediate | 86 | 70 | 27.90 | |
Human | 83 | 65 | 25.90 | |
SARS-CoV-2 | Bat | 40 | 36 | 14.51 |
Intermediate | 69 | 45 | 18.16 | |
Human | 76 | 52 | 20.92 |
Virus | Number of hsa-miRNAs | Detection Method | Number of Articles | Date Range for Publication Search |
---|---|---|---|---|
SARS-CoV | 36 | Computational | 1 | 2002–2022 |
Experimental | 2 | |||
Computational/Experimental | 1 | |||
MERS-CoV | 70 | Computational | 3 | 2012–2022 |
Experimental | 2 | |||
SARS-CoV-2 | 150 | Computational | 10 | 2019–2022 |
Experimental | 7 | |||
Computational/Experimental | 5 |
Virus | Host | vsRNA Name | vsRNA Sequence | vsRNA Length | Genome Position | Strand | ORF | RNAhybrid MFE |
---|---|---|---|---|---|---|---|---|
SARS-CoV | Bat | SB-vsRNA-ORF1a-3p | GCAUUUUACGUGCUACCUUC | 20 | 4250–4270 | Forward | ORF1a | −20.9 |
Bat | SB-vsRNA-S-5p | UACCAUACAGCUUCUACUUUAC | 22 | 23,434–23,456 | Forward | S | −27.7 | |
MERS-CoV | Bat | MB-vsRNA-ORF1b-3p | GAGGUGAUGUGCUGUUGG | 18 | 15,575–15,593 | Forward | ORF1b | −27.0 |
SARS-CoV-2 | Bat | S2B-vsRNA-ORF1a-5p | UUAUCUGUAGGCACUUUU | 18 | 4212–4230 | Reverse | ORF1a | −23.1 |
Intermediate | S2I-vsRNA-ORF1a-5p * | AUUGUCUGUUGGCACUUUU | 19 | 4170–4189 | Reverse | ORF1a | −25.4 | |
Human | S2H-vsRNA-ORF1a-5p * | AUUGUCUGUUGGCACUUUU | 19 | 4153–4172 | Reverse | ORF1a | −25.4 | |
Human | S2H-vsRNA-ORF1a-3p | CUGAGCAGGUGGUGCUGA | 18 | 5526–5544 | Reverse | ORF1a | −22.9 | |
Human | S2H-vsRNA-ORF1b-3p | CAAUUUAGGUGGUGCUGU | 18 | 19,443–19,461 | Forward | ORF1b | −26.1 | |
Human | S2H-vsRNA-ORF3a-3p | GGCUUAUUGUUGGCGUUGCACUU | 23 | 25,459–25,482 | Forward | ORF3a | −23.4 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Rojas-Cruz, A.F.; Bermúdez-Santana, C.I. Computational Prediction of RNA–RNA Interactions between Small RNA Tracks from Betacoronavirus Nonstructural Protein 3 and Neurotrophin Genes during Infection of an Epithelial Lung Cancer Cell Line: Potential Role of Novel Small Regulatory RNA. Viruses 2023, 15, 1647. https://doi.org/10.3390/v15081647
Rojas-Cruz AF, Bermúdez-Santana CI. Computational Prediction of RNA–RNA Interactions between Small RNA Tracks from Betacoronavirus Nonstructural Protein 3 and Neurotrophin Genes during Infection of an Epithelial Lung Cancer Cell Line: Potential Role of Novel Small Regulatory RNA. Viruses. 2023; 15(8):1647. https://doi.org/10.3390/v15081647
Chicago/Turabian StyleRojas-Cruz, Alexis Felipe, and Clara Isabel Bermúdez-Santana. 2023. "Computational Prediction of RNA–RNA Interactions between Small RNA Tracks from Betacoronavirus Nonstructural Protein 3 and Neurotrophin Genes during Infection of an Epithelial Lung Cancer Cell Line: Potential Role of Novel Small Regulatory RNA" Viruses 15, no. 8: 1647. https://doi.org/10.3390/v15081647
APA StyleRojas-Cruz, A. F., & Bermúdez-Santana, C. I. (2023). Computational Prediction of RNA–RNA Interactions between Small RNA Tracks from Betacoronavirus Nonstructural Protein 3 and Neurotrophin Genes during Infection of an Epithelial Lung Cancer Cell Line: Potential Role of Novel Small Regulatory RNA. Viruses, 15(8), 1647. https://doi.org/10.3390/v15081647