Current Status and Complexity of Three Begomovirus Species in Pepper Plants in Lowlands and Highlands in Java Island, Indonesia
Abstract
1. Introduction
2. Materials and Methods
2.1. Field Survey and Samples Collection
2.2. DNA Extraction and Identification of Begomovirus Species and Bemisia tabaci Biotypes
2.3. Statistical Analysis
3. Results
3.1. Disease Symptoms, Incidence, and Severity
3.2. Biotypes of B. tabaci
3.3. Identification of Three Begomovirus Species
3.4. Phenotypic Symptoms of Single and Mixed begomovirus Infection
4. Discussion
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Rai, V.P.; Kumar, R.; Singh, S.P.; Kumar, S.; Kumar, S.; Singh, M.; Rai, M. Monogenic recessive resistance to Pepper leaf curl virus in an interspecific cross of Capsicum. Sci. Hortic. 2014, 172, 34–38. [Google Scholar] [CrossRef]
- Koeda, S.; Onouchi, M.; Mori, N.; Pohan, N.S.; Nagano, A.J.; Kesumawati, E. A recessive gene pepy-1 encoding Pelota confers resistance to Begomovirus isolates of PepYLCIV and PepYLCAV in Capsicum annuum. Theor. Appl. Genet. 2021, 134, 2947–2964. [Google Scholar] [CrossRef] [PubMed]
- Statistics Indonesia, B. (Ed.) Statistics of Horticulture 2021. In Statistics of Horticulture; BPS-Statistics Indonesia: Jakarta, Indonesia, 2022; p. 96. [Google Scholar]
- Zerbini, F.M.; Briddon, R.W.; Idris, A.; Martin, D.P.; Moriones, E.; Navas-Castillo, J.; Rivera-Bustamante, R.; Roumagnac, P.; Varsani, A.; Consortium, I.R. ICTV virus taxonomy profile: Geminiviridae. J. Gen. Virol. 2017, 98, 131–133. [Google Scholar] [CrossRef] [PubMed]
- Brown, J.K.; Zerbini, F.M.; Navas-Castillo, J.; Moriones, E.; Ramos-Sobrinho, R.; Silva, J.C.; Fiallo-Olivé, E.; Briddon, R.W.; Hernández-Zepeda, C.; Idris, A.; et al. Revision of Begomovirus taxonomy based on pairwise sequence comparisons. Arch. Virol. 2015, 160, 1593–1619. [Google Scholar] [CrossRef] [PubMed]
- Siddique, M.I.; Lee, J.-H.; Ahn, J.-H.; Kusumawardhani, M.K.; Safitri, R.; Harpenas, A.; Kwon, J.-K.; Kang, B.-C. Genotyping-by-sequencing-based QTL mapping reveals novel loci for Pepper yellow leaf curl virus (PepYLCV) resistance in Capsicum annuum. PLoS ONE 2022, 17, e0264026. [Google Scholar] [CrossRef] [PubMed]
- Ghanim, M. A review of the mechanisms and components that determine the transmission efficiency of Tomato yellow leaf curl virus (Geminiviridae; Begomovirus) by its whitefly vector. Virus Res. 2014, 186, 47–54. [Google Scholar] [CrossRef] [PubMed]
- Krause-Sakate, R.; Watanabe, L.F.M.; Gorayeb, E.S.; da Silva, F.B.; Alvarez, D.D.L.; Bello, V.H.; Nogueira, A.M.; de Marchi, B.R.; Vicentin, E.; Ribeiro-Junior, M.R.; et al. Population dynamics of whiteflies and associated viruses in South America: Research progress and perspectives. Insects 2020, 11, 847. [Google Scholar] [CrossRef]
- Fiallo-Olivé, E.; Pan, L.-L.; Liu, S.-S.; Navas-Castillo, J. Transmission of begomoviruses and other whitefly-borne viruses: Dependence on the vector species. Phytopathology 2020, 110, 10–17. [Google Scholar] [CrossRef]
- Wang, Q.; Luo, C.; Wang, R. Insecticide Resistance and Its Management in Two Invasive Cryptic Species of Bemisia tabaci in China. Inter. J. Mol. Sci. 2023, 24, 6048. [Google Scholar] [CrossRef]
- Hidayat, P.; Kurniawan, H.; Afifah, L.; Triwidodo, H. Life cycle and life table of the B and non-B biotypes of the whitefly Bemisia tabaci (Gennadius) (Hemiptera: Aleyrodidae) on chili pepper (Capsicum annuum L.). J. Entomol. Indones. 2017, 14, 143–151. [Google Scholar] [CrossRef]
- Kenyon, L.; Tsai, W.-S.; Shih, S.-L.; Lee, L.-M. Emergence and diversity of begomoviruses infecting solanaceous crops in East and Southeast Asia. Virus Res. 2014, 186, 104–113. [Google Scholar] [CrossRef]
- Hannum, S.; Aceh, R.M.; Elimasni. Begomovirus detection on diseased chili plant (Capsicum annum L.) in Tanah Karo North Sumatera with PCR techniques. IOP Conf. Ser. Earth Environ. Sci. 2019, 305, 012057. [Google Scholar]
- Annisaa, N.; Hidayat, P.; Hidayat, S.; Lee, S. In Multiple infections of Begomovirus on its host plants. IOP Conf. Ser. Earth Environ. Sci. 2021, 694, 012047. [Google Scholar] [CrossRef]
- Selangga, D.G.W.; Listihani, L. Molecular identification of Pepper yellow leaf curl Indonesia virus on chili pepper in Nusa Penida Island. J. Trop. Plant. Pests. Dis. 2021, 21, 97–102. [Google Scholar] [CrossRef]
- Selangga, D.G.W.; Wiyono, S.; Susila, A.D.; Hidayat, S.H. Distribution and identification of Pepper yellow leaf curl Indonesia virus infecting chili pepper in Bali Island. J. Fitopatol. Indones. 2021, 17, 217–224. [Google Scholar] [CrossRef]
- De Barro, P.J.; Liu, S.-S.; Boykin, L.M.; Dinsdale, A.B. Bemisia tabaci: A statement of species status. Annu. Rev. Entomol. 2011, 56, 1–19. [Google Scholar] [CrossRef] [PubMed]
- Baker, R.; Bragard, C.; Candresse, T.; Gauthier, N. Scientific opinion on the risks to plant health posed by Bemisia tabaci species complex and viruses it transmits for the EU territory. EFSA J. 2013, 11, 3162. [Google Scholar]
- Adilah, N.F.; Hidayat, S.H. Intensity of yellow leaf curl disease and population growth of whitefly on chili pepper genotypes. J. Fitopatol. Indones. 2014, 10, 195–201. [Google Scholar]
- Lukman, R.; Afifuddin, A.; Van Deynze, A.; Hill, T.; Jimenez, R. A survey of mixed begomovirus infection in solanaceae and fabaceae at different altitudes in East Java, Indonesia. Arch. Phytopathol. Plant Prot. 2019, 52, 385–406. [Google Scholar] [CrossRef]
- Raj, S.; Singh, R.; Pandey, S.; Singh, B. Agrobacterium-mediated tomato transformation and regeneration of transgenic lines expressing Tomato leaf curl virus coat protein gene for resistance against TLCV infection. Curr. Sci. 2005, 88, 1674–1679. [Google Scholar]
- Tang, Y.; He, Z.; Du, Z.; Lu, L. First report of Tomato yellow leaf curl Kanchanaburi virus infecting eggplant in Laos. Plant Dis. 2014, 98, 428. [Google Scholar] [CrossRef] [PubMed]
- Ko, C.C.; Hung, Y.C.; Wang, C.H. Sequence characterized amplified region markers for identifying biotypes of Bemisia tabaci (Hem., Aleyrodidae). J. Appl. Entomol. 2007, 131, 542–547. [Google Scholar] [CrossRef]
- Kwak, H.-R.; Hong, S.-B.; Byun, H.-S.; Park, B.; Choi, H.-S.; Myint, S.S.; Kyaw, M.M. Incidence and molecular identification of begomoviruses infecting tomato and pepper in Myanmar. Plants 2022, 11, 1031. [Google Scholar] [CrossRef]
- Fadhila, C.; Lal, A.; Vo, T.T.; Ho, P.T.; Hidayat, S.H.; Lee, J.; Kil, E.-J.; Lee, S. The threat of seed-transmissible Pepper yellow leaf curl Indonesia virus in chili pepper. Microb. Pathog. 2020, 143, 104132. [Google Scholar] [CrossRef] [PubMed]
- Subiastuti, A.S.; Hartono, S.; Daryono, B.S. Detection and identification of Begomovirus infecting Cucurbitaceae and Solanaceae in Yogyakarta, Indonesia. Biodiversitas 2019, 20, 738–744. [Google Scholar] [CrossRef]
- Sidik, E.A.; Hartono, S.; Sulandari, S.; Lukman, R.; Affifudin, A.; Wahyudin, D.; Santoso, H.B. Molecular evidence for mixed infections of four begomoviruses in common bean and yard long bean showing severe yellow symptoms in East Java, Indonesia. In Proceeding of the 1st International Conference on Tropical Agriculture; Isnansetyo, A., Nuringtya, T.R., Eds.; Springer: Cham, Switzerland, 2017; pp. 73–84. [Google Scholar]
- Koeda, S.; Kesumawati, E.; Tanaka, Y.; Hosokawa, M.; Doi, M.; Kitajima, A. Mixed infection of begomoviruses on pepper plants at Northern Sumatra, Indonesia. Trop. Agric. Develop. 2016, 60, 59–64. [Google Scholar]
- Yao, F.-L.; Zheng, Y.; Huang, X.-Y.; Ding, X.-L.; Zhao, J.-W.; Desneux, N.; He, Y.-X.; Weng, Q.-Y. Dynamics of Bemisia tabaci biotypes and insecticide resistance in Fujian Province in China during 2005–2014. Sci. Rep. 2017, 7, 40803. [Google Scholar] [CrossRef]
- Laarif, A.; Saleh, D.; Clouet, C.; Gauthier, N. Regional co-occurrence between distinct Bemisia tabaci species in Tunisia with new insights into the role of host plants. Phytoparasitica 2015, 43, 135–150. [Google Scholar] [CrossRef]
- Pan, H.; Chu, D.; Yan, W.; Su, Q.; Liu, B.; Wang, S.; Wu, Q.; Xie, W.; Jiao, X.; Li, R.; et al. Rapid spread of Tomato yellow leaf curl virus in China is aided differentially by two invasive whiteflies. PLoS ONE 2012, 7, e34817. [Google Scholar] [CrossRef]
- Wei, J.; Zhao, J.-J.; Zhang, T.; Li, F.-F.; Ghanim, M.; Zhou, X.-P.; Ye, G.-Y.; Liu, S.-S.; Wang, X.-W. Specific cells in the primary salivary glands of the whitefly Bemisia tabaci control retention and transmission of begomoviruses. J. Virol. 2014, 88, 13460–13468. [Google Scholar] [CrossRef]
- Kil, E.-J.; Kim, S.; Lee, Y.-J.; Byun, H.-S.; Park, J.; Seo, H.; Kim, C.-S.; Shim, J.-K.; Lee, J.-H.; Kim, J.-K.; et al. Tomato yellow leaf curl virus (TYLCV-IL): A seed-transmissible geminivirus in tomatoes. Sci. Rep. 2016, 6, 19013. [Google Scholar] [CrossRef] [PubMed]
- Kothandaraman, S.V.; Devadason, A.; Ganesan, M.V. Seed-borne nature of a Begomovirus, Mung bean yellow mosaic virus in black gram. Appl. Microbiol. Biotechnol. 2016, 100, 1925–1933. [Google Scholar] [CrossRef] [PubMed]
- Xie, M.; Chen, Y.-H.; Wan, F.-H. Responses of two whitefly species, Trialeurodes vaporariorum (Westwood) and Bemisia tabaci (Gennadius) B-biotype, to low temperatures. J. Insect Sci. 2007, 8, 1–53. [Google Scholar]
- Hidayat, S.H.; Rahmayani, E. Transmission of Tomato leaf curl begomovirus by two different species of whitefly (Hemiptera: Aleyrodidae). Plant. Pathol. J. 2007, 23, 57–61. [Google Scholar] [CrossRef]
- Sangeetha, B.; Malathi, V.; Alice, D.; Suganthy, M.; Renukadevi, P. A distinct seed-transmissible strain of Tomato leaf curl New Delhi virus infecting Chayote in India. Virus Res. 2018, 258, 81–91. [Google Scholar] [CrossRef]
- Temaja, I.G.R.M.; Selangga, D.G.W.; Phabiola, T.A.; Khalimi, K.; Listihani, L. Relationship between viruliferous Bemisia tabaci population and disease incidence of Pepper yellow leaf curl Indonesia virus in chili pepper. Biodiversitas 2022, 23, 5360–5366. [Google Scholar] [CrossRef]
- Singh, A.K.; Kushwaha, N.; Chakraborty, S. Synergistic interaction among begomoviruses leads to the suppression of host defense-related gene expression and breakdown of resistance in chilli. Appl. Microbiol. Biotechnol. 2016, 100, 4035–4049. [Google Scholar] [CrossRef]
- Mangal, M.; Srivastava, A.; Sharma, R.; Kalia, P. Conservation and dispersion of genes conferring resistance to tomato begomoviruses between tomato and pepper genomes. Front. Plant Sci. 2017, 8, 1803. [Google Scholar] [CrossRef]
- Cania, D.; Nova, B.; Runifah, T.; Hidayati, R.; Anwar, A.; Jamsari, J. Molecular diversity of Pepper yellow leaf curl virus (PepYLCV) infecting Capsicum annuum in West Sumatra. IOP Conf. Ser. Earth Environ. Sci. 2021, 741, 012038. [Google Scholar] [CrossRef]
- Ouattara, A.; Tiendrébéogo, F.; Becker, N.; Urbino, C.; Thébaud, G.; Hoareau, M.; Allibert, A.; Chiroleu, F.; Vernerey, M.-S.; Traoré, E.V.; et al. Synergy between an emerging monopartite Begomovirus and a DNA-B component. Sci. Rep. 2022, 12, 695. [Google Scholar] [CrossRef]
- Gupta, N.; Reddy, K.; Bhattacharyya, D.; Chakraborty, S. Plant responses to geminivirus infection: Guardians of the plant immunity. Virol. J. 2021, 18, 143. [Google Scholar] [CrossRef] [PubMed]
Primers | Sequence (5′-3′) | Target | DNA Target (bp) | Target Region | References |
---|---|---|---|---|---|
Begomovirus | |||||
PepYLCIV_4-F | ACCTTGGGGCTCAAGTCAAG | PepYLCIV | ±997 | DNA A Protein AC1 | [20] |
PepYLCIV_4-R | GGTCCCTATCTTTATAGTGGGCG | ||||
TLCV-CPI | ATGGCGAAGCGACCAG | ToLCNDV | ±771 | DNA A Protein AV1 | [21] |
TLCV-CPT | TTAATTTGTGACCGAATCAT | ||||
TYLCKaV-F | GTAACAGCCGAAGTGCACG | TYLCKaV | ±1668 | DNA B Protein BC1 and BV1 | [22] |
TYLCKaV-R | AATGGAGAGACACCAGTCTGCC | ||||
Biotypes of B. tabaci | |||||
BaAF | GTGAAATCACTGTCCTCAGTTAGGT | biotype A | ±812 | DNA | [23] |
BaAR | AAAGCCATAGACAAAGAAGTAGACG | ||||
BaBF | CCACTATAATTATTGCTGTTCCCACA | biotype B | ±661 | Mitochondrial DNA mtCO1 | |
L2-N-3014R | TCCAATGCACTAATCTGCCATATTA | ||||
BaANF | GGTTATTGCTGTTCCAACTGGG | biotype AN | ±665 | Mitochondrial DNA mtCO1 | |
L2-N-3014R | TCCAATGCACTAATCTGCCATATTA | ||||
BaQF | GAAGCAACGCACTACTTACAA | biotype Q | ±892, 700,400 | DNA | |
BaQR | TTCTCGGCGTTTTTACCAA | ||||
BaNaF | GGCTTTGGTTTACTGGATTCTTTT | biotype Nauru | ±578 | Mitochondrial DNA mtCO1 | |
L2-N-3014R | TCCAATGCACTAATCTGCCATATTA | ||||
BaSF | CTCGCAACATTGGGTGGTATAAAGT | biotype S | ±613 | Mitochondrial DNA mtCO1 | |
L2-N-3014R | TCCAATGCACTAATCTGCCATATTA |
Location (District) | Altitude (m asl) | Observed Symptoms 1 | Disease Incidence (%) * | Disease Severity (%) * |
---|---|---|---|---|
Lowlands | ||||
Cirebon (West Java) | 24 | y, ym, lf, cp | 86.00 | 29.50 |
Pangandaran 1 (West Java) | 254 | y, ym, gm, lf, cp, vb, st | 93.00 | 57.50 |
Pangandaran 2 (West Java) | 122 | y, ym, gm, lf, cp, sl | 93.00 | 45.75 |
Bantul (Yogyakarta) | 9 | y, ym, gm, lf, cp, vb | 98.00 | 72.75 |
Kulon Progo (Yogyakarta) | 11 | y, ym, gm, lf, cp, vb, st | 82.00 | 35.25 |
Sragen (Central Java) | 163 | y, ym, gm, lf, cp | 97.00 | 60.00 |
Banyuwangi 1 (East Java) | 141 | y, ym, gm, lf, cp | 90.00 | 44.75 |
Banyuwangi 2 (East Java) | 108 | y, ym, gm, lf, cp | 98.00 | 63.75 |
Kediri (East Java) | 176 | y, ym, gm, lf, cp, vb, vc, st | 100.00 | 81.25 |
Mean | 93.00 a | 54.50 a | ||
Highlands | ||||
Sukabumi (West Java) | 872 | y, ym, lf, cp | 90.00 | 46.25 |
Bandung Barat (West Java) | 1200 | y, ym, gm, lf, cp | 94.00 | 43.25 |
Garut (West Java) | 1418 | y, ym, gm, lf, cp | 85.00 | 36.25 |
Banjarnegara (Central Java) | 1167 | y, ym, lf, cp, st | 95.00 | 44.75 |
Wonosobo (Central Java) | 1326 | y, lf | 69.00 | 22.50 |
Karanganyar (Central Java) | 848 | y, ym, lf, cp | 88.00 | 31.75 |
Malang (East Java) | 1185 | y, ym, gm, lf, cp | 94.00 | 49.50 |
Batu (East Java) | 881 | y, ym, gm, lf, cp | 92.00 | 34.75 |
Magetan (East Java) | 1024 | y, ym, gm, lf, cp | 92.00 | 34.00 |
Mean | 88.78 a | 38.11 b |
Location (District) | Biotype of B. tabaci | |||||
---|---|---|---|---|---|---|
A | B | AN | Q | Nauru | S | |
Lowlands | ||||||
Cirebon (West Java) | + | - | - | + | - | - |
Pangandaran 1 (West Java) | - | - | - | + | - | - |
Pangandaran 2 (West Java) | - | + | - | - | - | - |
Bantul (Yogyakarta) | - | + | - | - | - | - |
Kulon Progo (Yogyakarta) | - | + | - | - | - | - |
Sragen (Central Java) | - | + | - | - | - | - |
Banyuwangi 1 (East Java) | - | + | - | - | - | - |
Banyuwangi 2 (East Java) | + | - | - | - | - | - |
Kediri (East Java) | + | - | + | - | - | - |
Highlands | ||||||
Sukabumi (West Java) | - | - | - | + | - | - |
Bandung Barat (West Java) | - | + | - | - | - | - |
Garut (West Java) | - | - | - | - | - | - |
Banjarnegara (Central Java) | - | + | - | - | - | - |
Wonosobo (Central Java) | - | - | - | - | - | - |
Karanganyar (Central Java) | - | - | - | - | - | - |
Malang (East Java) | + | - | - | - | - | - |
Batu (East Java) | - | + | - | - | - | - |
Magetan (East Java) | - | - | - | + | - | - |
Location (District) | Results of PCR Detection | Percentage of Virus-Infected Plants (%) * | |||||||
---|---|---|---|---|---|---|---|---|---|
No Detectable Product | Single Infection | Mixed Infections | |||||||
PepYLCIV | ToLCNDV | TYLCKaV | PepYLCIV–ToLCNDV | PepYLCIV–TYLCKaV | ToLCNDV–TYLCKaV | PepYLCIV–ToLCNDV–TYLCKaV | |||
Lowlands | |||||||||
Cirebon (West Java) | 20 | 100.00 | |||||||
Pangandaran 1 (West Java) | 18 | 2 | 100.00 | ||||||
Pangandaran 2 (West Java) | 18 | 2 | 100.00 | ||||||
Bantul (Yogyakarta) | 20 | 100.00 | |||||||
Kulon Progo (Yogyakarta) | 11 | 6 | 1 | 2 | 100.00 | ||||
Sragen (Central Java) | 1 | 19 | 95.00 | ||||||
Banyuwangi 1 (East Java) | 4 | 16 | 80.00 | ||||||
Banyuwangi 2 (East Java) | 8 | 12 | 60.00 | ||||||
Kediri (East Java) | 5 | 3 | 1 | 8 | 3 | 75.00 | |||
Mean | 90.00 a | ||||||||
Highlands | |||||||||
Sukabumi (West Java) | 15 | 5 | 100.00 | ||||||
Bandung Barat (West Java) | 20 | 100.00 | |||||||
Garut (West Java) | 20 | 100.00 | |||||||
Banjarnegara (Central Java) | 19 | 1 | 100.00 | ||||||
Wonosobo (Central Java) | 1 | 19 | 95.00 | ||||||
Karanganyar (Central Java) | 1 | 19 | 95.00 | ||||||
Malang (East Java) | 1 | 19 | 95.00 | ||||||
Batu (East Java) | 1 | 19 | 95.00 | ||||||
Magetan (East Java) | 9 | 10 | 1 | 55.00 | |||||
Mean | 92.78 a |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Wahyono, A.; Murti, R.H.; Hartono, S.; Nuringtyas, T.R.; Wijonarko, A.; Mulyantoro, M.; Firmansyah, D.; Afifuddin, A.; Purnama, I.C.G. Current Status and Complexity of Three Begomovirus Species in Pepper Plants in Lowlands and Highlands in Java Island, Indonesia. Viruses 2023, 15, 1278. https://doi.org/10.3390/v15061278
Wahyono A, Murti RH, Hartono S, Nuringtyas TR, Wijonarko A, Mulyantoro M, Firmansyah D, Afifuddin A, Purnama ICG. Current Status and Complexity of Three Begomovirus Species in Pepper Plants in Lowlands and Highlands in Java Island, Indonesia. Viruses. 2023; 15(6):1278. https://doi.org/10.3390/v15061278
Chicago/Turabian StyleWahyono, Andi, Rudi Hari Murti, Sedyo Hartono, Tri Rini Nuringtyas, Arman Wijonarko, Mulyantoro Mulyantoro, Deni Firmansyah, Ahmad Afifuddin, and Innez Candri Gilang Purnama. 2023. "Current Status and Complexity of Three Begomovirus Species in Pepper Plants in Lowlands and Highlands in Java Island, Indonesia" Viruses 15, no. 6: 1278. https://doi.org/10.3390/v15061278
APA StyleWahyono, A., Murti, R. H., Hartono, S., Nuringtyas, T. R., Wijonarko, A., Mulyantoro, M., Firmansyah, D., Afifuddin, A., & Purnama, I. C. G. (2023). Current Status and Complexity of Three Begomovirus Species in Pepper Plants in Lowlands and Highlands in Java Island, Indonesia. Viruses, 15(6), 1278. https://doi.org/10.3390/v15061278