Genetic Evolution and Variation of Human Adenovirus Serotype 31 Epidemic Strains in Beijing, China, during 2010–2022
Abstract
1. Introduction
2. Materials and Methods
2.1. Sequencing of the Three Capsid Proteins of the HAdV-31 Endemic Strains and Complete Genome of the HAdV-31 Isolate
2.2. Phylogenetic and Evolutionary Analyses of HAdV-31 Genes
2.3. Selection Pressure Analysis of the Three Capsid Proteins of HAdV-31
3. Results
3.1. General Information of HAdV-31-Positive Children in This Study
3.2. Phylogenetic Analysis of the Three Capsid Protein Genes of HAdV31
3.3. Amino Acid Variation among the HAdV-31 Strains
3.4. The Selection Pressure Analysis of the Three Capsid Proteins of HAdV-31
3.5. Evolutionary Genetic Analysis of the HAdV-31 Strains
4. Discussion
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Jones, M.S., 2nd; Harrach, B.; Ganac, R.D.; Gozum, M.M.; Dela Cruz, W.P.; Riedel, B.; Pan, C.; Delwart, E.L.; Schnurr, D.P. New adenovirus species found in a patient presenting with gastroenteritis. J. Virol. 2007, 81, 5978–5984. [Google Scholar] [CrossRef] [PubMed]
- Madisch, I.; Harste, G.; Pommer, H.; Heim, A. Phylogenetic analysis of the main neutralization and hemagglutination determinants of all human adenovirus prototypes as a basis for molecular classification and taxonomy. J. Virol. 2005, 79, 15265–15276. [Google Scholar] [CrossRef] [PubMed]
- Crawford-Miksza, L.; Schnurr, D.P. Analysis of 15 adenovirus hexon proteins reveals the location and structure of seven hypervariable regions containing serotype-specific residues. J. Virol. 1996, 70, 1836–1844. [Google Scholar] [CrossRef] [PubMed]
- Russell, W.C. Adenoviruses: Update on structure and function. J. Gen. Virol. 2009, 90 Pt 1, 1–20. [Google Scholar] [CrossRef]
- Sirena, D.; Lilienfeld, B.; Eisenhut, M.; Kälin, S.; Boucke, K.; Beerli, R.R.; Vogt, L.; Ruedl, C.; Bachmann, M.F.; Greber, U.F.; et al. The human membrane cofactor CD46 is a receptor for species B adenovirus serotype 3. J. Virol. 2004, 78, 4454–4462. [Google Scholar] [CrossRef]
- Chroboczek, J.; Ruigrok, R.W.; Cusack, S. Adenovirus fiber. Curr. Top. Microbiol. Immunol. 1995, 199 Pt 1, 163–200. [Google Scholar]
- Hofmayer, S.; Madisch, I.; Darr, S.; Rehren, F.; Heim, A. Unique sequence features of the Human adenovirus 31 complete genomic sequence are conserved in clinical isolates. BMC Genom. 2009, 10, 557. [Google Scholar] [CrossRef]
- Hierholzer, J.C. Adenoviruses in the immunocompromised host. Clin. Microbiol. Rev. 1992, 5, 262–274. [Google Scholar] [CrossRef]
- Liu, L.; Qian, Y.; Zhang, Y.; Deng, J.; Jia, L.; Dong, H. Adenoviruses associated with acute diarrhea in children in Beijing, China. PLoS ONE 2014, 9, e88791. [Google Scholar] [CrossRef]
- Liu, L.; Qian, Y.; Zhang, Y.; Zhao, L.; Jia, L.; Dong, H. Epidemiological aspects of rotavirus and adenovirus in hospitalized children with diarrhea: A 5-year survey in Beijing. BMC Infect. Dis. 2016, 16, 508. [Google Scholar] [CrossRef]
- Pereira, M.S.; Periera, H.G.; Clarke, S.K. Human adenovirus type 31. A new serotype with oncogenic properties. Lancet 1965, 1, 21–23. [Google Scholar] [CrossRef] [PubMed]
- Matsushima, Y.; Shimizu, H.; Phan, T.G.; Ushijima, H. Genomic characterization of a novel human adenovirus type 31 recombinant in the hexon gene. J. Gen. Virol. 2011, 92 Pt 12, 2770–2775. [Google Scholar] [CrossRef] [PubMed]
- Swartling, L.; Allard, A.; Törlen, J.; Ljungman, P.; Mattsson, J.; Sparrelid, E. Prolonged outbreak of adenovirus A31 in allogeneic stem cell transplant recipients. Transpl. Infect. Dis. 2015, 17, 785–794. [Google Scholar] [CrossRef]
- Fattouh, R.; Stapleton, P.J.; Eshaghi, A.; Thomas, A.D.; Science, M.E.; Schechter, T.; Streitenberger, L.; Hubacek, P.; Yau, Y.C.W.; Brown, M.; et al. A Prolonged Outbreak of Human Adenovirus A31 (HAdV-A31) Infection on a Pediatric Hematopoietic Stem Cell Transplantation Ward with Whole Genome Sequencing Evidence of International Linkages. J. Clin. Microbiol. 2022, 60, e0066522. [Google Scholar] [CrossRef]
- Götting, J.; Baier, C.; Panagiota, V.; Maecker-Kolhoff, B.; Dhingra, A.; Heim, A. High genetic stability of co-circulating human adenovirus type 31 lineages over 59 years. Virus Evol. 2022, 8, veac067. [Google Scholar] [CrossRef] [PubMed]
- Allard, A.; Girones, R.; Juto, P.; Wadell, G. Polymerase chain reaction for detection of adenoviruses in stool samples. J. Clin. Microbiol. 1990, 28, 2659–2667. [Google Scholar] [CrossRef] [PubMed]
- Liu, L.; Zhang, Y.; Deng, J.; Qian, Y. Developing of a method for detection and identification of entero-adenovirus in fecal specimens from infantile diarrhea. Chin. J. Lab. Med. 2009, 8, 857–860. [Google Scholar]
- Chen, S.; Zhou, Y.; Chen, Y.; Gu, J. fastp: An ultra-fast all-in-one FASTQ preprocessor. Bioinformatics 2018, 34, i884–i890. [Google Scholar] [CrossRef]
- Langmead, B.; Salzberg, S.L. Fast gapped-read alignment with Bowtie 2. Nat. Methods 2012, 9, 357–359. [Google Scholar] [CrossRef] [PubMed]
- Grabherr, M.G.; Haas, B.J.; Yassour, M.; Levin, J.Z.; Thompson, D.A.; Amit, I.; Adiconis, X.; Fan, L.; Raychowdhury, R.; Zeng, Q.; et al. Full-length transcriptome assembly from RNA-Seq data without a reference genome. Nat. Biotechnol. 2011, 29, 644–652. [Google Scholar] [CrossRef]
- Wood, D.E.; Salzberg, S.L. Kraken: Ultrafast metagenomic sequence classification using exact alignments. Genome Biol. 2014, 15, R46. [Google Scholar] [CrossRef] [PubMed]
- Katoh, K.; Rozewicki, J.; Yamada, K.D. MAFFT online service: Multiple sequence alignment, interactive sequence choice and visualization. Brief. Bioinform. 2019, 20, 1160–1166. [Google Scholar] [CrossRef] [PubMed]
- Kumar, S.; Stecher, G.; Tamura, K. MEGA7: Molecular Evolutionary Genetics Analysis Version 7.0 for Bigger Datasets. Mol. Biol. Evol. 2016, 33, 1870–1874. [Google Scholar] [CrossRef]
- Lole, K.S.; Bollinger, R.C.; Paranjape, R.S.; Gadkari, D.; Kulkarni, S.S.; Novak, N.G.; Ingersoll, R.; Sheppard, H.W.; Ray, S.C. Full-length human immunodeficiency virus type 1 genomes from subtype C-infected seroconverters in India, with evidence of intersubtype recombination. J. Virol. 1999, 73, 152–160. [Google Scholar] [CrossRef] [PubMed]
- Suchard, M.A.; Philippe, L.; Guy, B.; Ayres, D.L.; Drummond, A.J.; Andrew, R. Bayesian phylogenetic and phylodynamic data integration using BEAST 1.10. Virus Evol. 2018, 4, vey016. [Google Scholar] [CrossRef]
- Darriba, D.; Taboada, G.L.; Doallo, R.; Posada, D. jModelTest 2: More models, new heuristics and parallel computing. Nat. Methods 2012, 9, 772. [Google Scholar] [CrossRef]
- Andrew, R.; Drummond, A.J.; Xie, D.; Guy, B.; Suchard, M.A. Posterior Summarization in Bayesian Phylogenetics Using Tracer 1.7. Syst. Biol. 2018, 67, 901–904. [Google Scholar]
- Vaidya, G.; Lohman, D.J.; Meier, R. SequenceMatrix: Concatenation software for the fast assembly of multi-gene datasets with character set and codon information. Cladistics 2011, 27, 171–180. [Google Scholar] [CrossRef]
- Pond, S.L.; Frost, S.D. Datamonkey: Rapid detection of selective pressure on individual sites of codon alignments. Bioinformatics 2005, 21, 2531–2533. [Google Scholar] [CrossRef]
- Adrian, T.; Wigand, R.; Richter, J. Gastroenteritis in infants, associated with a genome type of adenovirus 31 and with combined rotavirus and adenovirus 31 infection. Eur. J. Pediatr. 1987, 146, 38–40. [Google Scholar] [CrossRef]
- Feghoul, L.; Chevret, S.; Cuinet, A.; Dalle, J.H.; Ouachée, M.; Yacouben, K.; Fahd, M.; Guérin-El Khourouj, V.; Roupret-Serzec, J.; Sterkers, G.; et al. Adenovirus infection and disease in paediatrichaematopoietic stem cell transplant patients: Clues for antiviral pre-emptive treatment. Clin. Microbiol. Infect. 2015, 21, 701–709. [Google Scholar] [CrossRef] [PubMed]
- Mynarek, M.; Ganzenmueller, T.; Mueller-Heine, A.; Mielke, C.; Gonnermann, A.; Beier, R.; Sauer, M.; Eiz-Vesper, B.; Kohstall, U.; Sykora, K.W.; et al. Patient, virus, and treatment-related risk factors in pediatric adenovirus infection after stem cell transplantation: Results of a routine monitoring program. Biol. Blood Marrow Transpl. 2014, 20, 250–256. [Google Scholar] [CrossRef] [PubMed]
- Liu, L.; Qian, Y.; Jia, L.; Dong, H.; Deng, L.; Huang, H.; Zhao, L.; Zhu, R. Genetic diversity and molecular evolution of human adenovirus serotype 41 strains circulating in Beijing, China, during 2010–2019. Infect. Genet. Evol. 2021, 95, 105056. [Google Scholar] [CrossRef] [PubMed]
- Mao, N.; Zhu, Z.; Lei, Z.; Li, Y.; Tang, L.; Cui, A.; Li, Z.; Liu, T.; Xu, W. Continued circulation and phylogenetic analysis of human adenovirus-55 in China during 2006–2016. Chin. J. Exp. Clin. Virol. 2018, 32, 124–129. [Google Scholar]
- Li, H.; Mao, N.; Yu, P.; Yin, J.; Jiang, H.; Zhang, B.; Meng, T.; Sun, L.; Cui, A.; Xu, W.; et al. Genomic characteristic of human adenovirus type 4 isolated from four provinces in mainland china during 2013–2014. Chin. J. Virol. 2018, 34, 850–859. [Google Scholar]
- Lin, Y.C.; Lu, P.L.; Lin, K.H.; Chu, P.Y.; Wang, C.F.; Lin, J.H.; Liu, H.F.; Massimo, C. Molecular Epidemiology and Phylogenetic Analysis of Human Adenovirus Caused an Outbreak in Taiwan during 2011. PLoS ONE 2015, 10, e0127377. [Google Scholar] [CrossRef] [PubMed]
- Pring-Akerblom, P.; Adrian, T. Sequence characterization of the adenovirus 31 fibre and comparison with serotypes of subgenera A to F. Res. Virol. 1995, 146, 343–354. [Google Scholar] [CrossRef]
- Ghebremedhin, B. Human adenovirus: Viral pathogen with increasing importance. Eur. J. Microbiol. Immunol. 2014, 4, 26–33. [Google Scholar] [CrossRef]
- Bil-Lula, I.; Krzywonos-Zawadzka, A.; Sawicki, G.; Wozniak, M. An infection of human adenovirus 31 affects the differentiation of preadipocytes into fat cells, its metabolic profile and fat accumulation. J. Med. Virol. 2016, 88, 400–407. [Google Scholar] [CrossRef]
- Haddad-Boubaker, S.; Joffret, M.L.; Pérot, P.; Bessaud, M.; Meddeb, Z.; Touzi, H.; Delpeyroux, F.; Triki, H.; Eloit, M. Metagenomic analysis identifies human adenovirus 31 in children with acute flaccid paralysis in Tunisia. Arch. Virol. 2019, 164, 747–755. [Google Scholar] [CrossRef]




| Genes | Primer Pairs | Position a | Procedures | |||||
|---|---|---|---|---|---|---|---|---|
| 1 Cycle | 30 Cycles | 1 Cycle | ||||||
| Preheat | Denaturation | Annealing | Extension | Incubation | ||||
| Hexon | Forward | GATGGCCACTCCSTCGATG | 17,574–17,592 | 94 °C 4 min | 94 °C 40 s | 58 °C 30 s | 72 °C | 72 °C 7 min |
| Reverse | TCCTGYTCGCTTGAACCCAT | 20,370–20,389 | 3 min | |||||
| Penton | Forward | CGACCAGYGTTCGTC | 13,204–13,218 | 45 °C 30 s | 72 °C | |||
| Reverse | CYGTGTTRTTACTTGGC | 14,794–14,810 | 2 min | |||||
| Fiber 1 | Forward | TTTCCYTCTTCCCAACT | 29,038–29,054 | 45 °C 30 s | 72 °C | |||
| Reverse | GGAGTTGTCCACARYGT | 30,288–30,304 | 1 min 30 s | |||||
| Fiber 2 | Forward | TGGAACTTAACAACTGATAT | 30,096–30,115 | 40 °C 30 s | 72 °C | |||
| Reverse | TKTTTTTATTCTTGGG | 30,817–30,832 | 1 min | |||||
| Strains | Serotype | GenBank acc.no | Year | Country/Site | Annotation a |
|---|---|---|---|---|---|
| Ad31 | HAdV-31 | AM749299 | 1962 | UK | HAdV-A31 prototype(1a) |
| 60086806 | HAdV-31 | MZ983582 | 2019 | German/Hannover | 1b |
| 20334274 | HAdV-31 | MZ983563 | 2012 | German/Hannover | 2a |
| 20382908 | HAdV-31 | MZ983567 | 2014 | German/Hannover | 2b |
| M-23172 | HAdV-31 | MZ983607 | 2016 | German/Munich | 2c |
| Pt6_S1 | HAdV-31 | MW686759 | 2012 | UK | 2d |
| UL-E83731 | HAdV-31 | MZ983608 | 2014 | German/Ulm | 3 |
| HAdV-Tn2012 | HAdV-31 | MG872324 | 2012 | Tunis | 4 |
| Pt68_S1 | HAdV-31 | MW686774 | 2019 | UK | 5-1 |
| 60256333 | HAdV-31 | MZ983596 | 2021 | German/Hannover | 5-2 |
| 60222008 | HAdV-31 | MZ983592 | 2021 | German/Hannover | 6-1 |
| 60346255 | HAdV-31 | OM372572 | 2021 | German/Hannover | 6-2 |
| JPN/2004/5082 | HAdV-61 | JF964962 | 2004 | Japan | HAdV-A61 prototype |
| A61ONP01 | HAdV-61 | MN901806 | 2018 | Canada/Toronto | |
| A12ONP02 | HAdV-12 | MN901805 | 2018 | Canada/Toronto | |
| GyK010 | HAdV-12 | KX868289 | 1978 | Sweden | HAdV-A12 prototype |
| D.C | HAdV-18 | GU191019 | 1954 | USA/Washington D.C | HAdV-A18 prototype |
| SAdv-ch1 | SAdV-ch1 | KF360047 | 2012 | China | Chimpanzee adenovirus |
| 37 Endemic Strains of HAdV-31 | 37 Endemic Strains and 12 Reference Strains of HAdV-31 | ||||||
|---|---|---|---|---|---|---|---|
| P | H | F | P | H | F | ||
| Homology | DNA | 99.60–100% | 99.64–100% | 99.04–100% | 98.75–100% | 99.06–100% | 94.54–100% |
| AA | 99.60–100% | 99.56–100% | 98.32–100% | 99.19–100% | 99.45–100% | 92.96–100% | |
| Average Evolutionary Divergence | DNA | 0.0013 | 0.0011 | 0.0032 | 0.0040 | 0.0030 | 0.0095 |
| AA | 0.0011 | 0.0012 | 0.0050 | 0.0020 | 0.0014 | 0.0118 | |
| Protein | Positive Selection Sites | Negative Selection Sites |
|---|---|---|
| Penton | 298(G/N) | 28(Q), 248(F), 51(I), 55(E) |
| Hexon | 855(L/V) | 820(L), 453(D), 613(F), 716(K), 431(E), 657(E), 424(K), 900(Q), 827(Q) |
| Fiber | 556(E/K), 441(Q/R/P), 554(T/A), 431(A/T/S) | 553(I), 34(F),77(K), 27(Y), 157(L),134(L) |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Liu, L.; Qian, Y.; Han, Z.; Jia, L.; Dong, H.; Zhao, L.; Zhu, R. Genetic Evolution and Variation of Human Adenovirus Serotype 31 Epidemic Strains in Beijing, China, during 2010–2022. Viruses 2023, 15, 1240. https://doi.org/10.3390/v15061240
Liu L, Qian Y, Han Z, Jia L, Dong H, Zhao L, Zhu R. Genetic Evolution and Variation of Human Adenovirus Serotype 31 Epidemic Strains in Beijing, China, during 2010–2022. Viruses. 2023; 15(6):1240. https://doi.org/10.3390/v15061240
Chicago/Turabian StyleLiu, Liying, Yuan Qian, Zhenzhi Han, Liping Jia, Huijin Dong, Linqing Zhao, and Runan Zhu. 2023. "Genetic Evolution and Variation of Human Adenovirus Serotype 31 Epidemic Strains in Beijing, China, during 2010–2022" Viruses 15, no. 6: 1240. https://doi.org/10.3390/v15061240
APA StyleLiu, L., Qian, Y., Han, Z., Jia, L., Dong, H., Zhao, L., & Zhu, R. (2023). Genetic Evolution and Variation of Human Adenovirus Serotype 31 Epidemic Strains in Beijing, China, during 2010–2022. Viruses, 15(6), 1240. https://doi.org/10.3390/v15061240

