Live Triple Gene-Deleted Pseudorabies Virus-Vectored Subunit PCV2b and CSFV Vaccine Undergoes an Abortive Replication Cycle in the TG Neurons following Latency Reactivation
Abstract
1. Introduction
2. Materials and Methods
2.1. Ethical Statement
2.2. Cells and Medium
2.3. Viruses
2.4. Animals and Experimental Design
2.5. Primary Virus Infection, Dexamethasone-Induced Latent Virus Reactivation, and Clinical Evaluation
2.6. Clinical Sample Collection and Processing
2.7. Euthanasia, Necropsy—Sample Collection and Processing
2.8. Serum Virus Neutralization Assay
2.9. DNA/RNA Isolation, cDNA Synthesis, and PRV-Specific Quantitative PCR (q-PCR)
2.10. Statistical Analysis
3. Results
3.1. Clinical Evaluation
3.2. Nasal Virus Shedding following Intranasal (IN) Administration of PRV wt and PRVtmv+
3.3. Following Dex-Induced Reactivation, Only the PRV wt-Infected Pigs Shed the Virus in Their Nasal Secretions
3.4. The PRV wt and PRVtmv+ Established Latency in the TG Neurons and Reactivated following Dex Injection, but Only PRV wt and Not PRVtmv+ Replicated in the TG Neurons
3.5. Following Dexamethasone (Dex)-Induced Latency Reactivation, Only PRV wt but Not PRVtmv+-Inoculated Pigs Had a Memory Serum Virus Neutralizing (SN) Antibody Response
4. Discussion
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Pavulraj, S.; Pannhorst, K.; Stout, R.W.; Paulsen, D.B.; Carossino, M.; Meyer, D.; Becher, P.; Chowdhury, S.I. A Triple Gene-Deleted Pseudorabies Virus-Vectored Subunit PCV2b and CSFV Vaccine Protects Pigs against PCV2b Challenge and Induces Serum Neutralizing Antibody Response against CSFV. Vaccines 2022, 10, 305. [Google Scholar] [CrossRef] [PubMed]
- Bech-Nielsen, S.; Miller, G.Y.; Bowman, G.L.; Dodaro, S.J.; Orloski-Snider, K.A. Economic impact of an epizootic of pseudorabies in a commercial swine herd in Ohio, achieving test negative status and quarantine release by use of vaccination and test and removal. J. Am. Vet. Med. Assoc. 1992, 200, 1817–1823. [Google Scholar]
- Wheeler, J.G.; Osorio, F.A. Investigation of sites of pseudorabies virus latency, using polymerase chain reaction. Am. J. Vet. Res. 1991, 52, 1799–1803. [Google Scholar] [PubMed]
- Deng, J.; Wu, Z.; Liu, J.; Ji, Q.; Ju, C. The Role of Latency-Associated Transcripts in the Latent Infection of Pseudorabies Virus. Viruses 2022, 14, 1379. [Google Scholar] [CrossRef] [PubMed]
- Chen, J.; Li, G.; Wan, C.; Li, Y.; Peng, L.; Fang, R.; Peng, Y.; Ye, C. A Comparison of Pseudorabies Virus Latency to Other alpha-Herpesvirinae Subfamily Members. Viruses 2022, 14, 1386. [Google Scholar] [CrossRef]
- Kit, S. Genetically engineered vaccines for control of Aujeszky’s disease (pseudorabies). Vaccine 1990, 8, 420–424. [Google Scholar] [CrossRef]
- Mettenleiter, T.C. Aujeszky’s Disease and the Development of the Marker/DIVA Vaccination Concept. Pathogens 2020, 9, 563. [Google Scholar] [CrossRef]
- van Oirschot, J.T. Diva vaccines that reduce virus transmission. J. Biotechnol. 1999, 73, 195–205. [Google Scholar] [CrossRef]
- Liu, Q.; Kuang, Y.; Li, Y.; Guo, H.; Zhou, C.; Guo, S.; Tan, C.; Wu, B.; Chen, H.; Wang, X. The Epidemiology and Variation in Pseudorabies Virus: A Continuing Challenge to Pigs and Humans. Viruses 2022, 14, 1463. [Google Scholar] [CrossRef]
- Maresch, C.; Lange, E.; Teifke, J.P.; Fuchs, W.; Klupp, B.; Muller, T.; Mettenleiter, T.C.; Vahlenkamp, T.W. Oral immunization of wild boar and domestic pigs with attenuated live vaccine protects against Pseudorabies virus infection. Vet. Microbiol. 2012, 161, 20–25. [Google Scholar] [CrossRef]
- Mettenleiter, T.C.; Schreurs, C.; Zuckermann, F.; Ben-Porat, T. Role of pseudorabies virus glycoprotein gI in virus release from infected cells. J. Virol. 1987, 61, 2764–2769. [Google Scholar] [CrossRef] [PubMed]
- Mettenleiter, T.C.; Zsak, L.; Kaplan, A.S.; Ben-Porat, T.; Lomniczi, B. Role of a structural glycoprotein of pseudorabies in virus virulence. J. Virol. 1987, 61, 4030–4032. [Google Scholar] [CrossRef] [PubMed]
- Viejo-Borbolla, A.; Munoz, A.; Tabares, E.; Alcami, A. Glycoprotein G from pseudorabies virus binds to chemokines with high affinity and inhibits their function. J. Gen. Virol. 2010, 91, 23–31. [Google Scholar] [CrossRef]
- Tenser, R.B.; Ressel, S.J.; Fralish, F.A.; Jones, J.C. The role of pseudorabies virus thymidine kinase expression in trigeminal ganglion infection. J. Gen. Virol. 1983, 64 Pt 6, 1369–1373. [Google Scholar] [CrossRef] [PubMed]
- Chowdhury, S.I.; Silva, E.; Pavulraj, S.; Ray, A.; Medina-Ramirez, E.; Gladue, D.P.; Stout, R.W.; Paulsen, D.B.; Borca, M. A PRV Vectored PCV2/CSFV-Sub Vaccine Protects Pigs against Lethal CSFV Challenge; Department of Pathobiological Sciences and Louisiana Animal Disease Diagnostic Laboratory, School of Veterinary Medicine, Louisiana State University: Baton Rouge, LA, USA, 2023; in preparation. [Google Scholar]
- Platt, K.B.; Mare, C.J.; Hinz, P.N. Differentiation of vaccine strains and field isolates of pseudorabies (Aujeszky’s disease) virus: Thermal sensitivity and rabbit virulence markers. Arch. Virol. 1979, 60, 13–23. [Google Scholar] [CrossRef]
- Chowdhury, S.I.; Pannhorst, K.; Sangewar, N.; Pavulraj, S.; Wen, X.; Stout, R.W.; Mwangi, W.; Paulsen, D.B. BoHV-1-Vectored BVDV-2 Subunit Vaccine Induces BVDV Cross-Reactive Cellular Immune Responses and Protects against BVDV-2 Challenge. Vaccines 2021, 9, 46. [Google Scholar] [CrossRef]
- Tham, K.M.; Motha, M.X.; Horner, G.W.; Ralston, J.C. Polymerase chain reaction amplification of latent Aujeszky’s disease virus in dexamethasone treated pigs. Arch. Virol. 1994, 136, 197–205. [Google Scholar] [CrossRef]
- Balasch, M.; Pujols, J.; Segales, J.; Plana-Duran, J.; Pumarola, M. Study of the persistence of Aujeszky’s disease (pseudorabies) virus in peripheral blood mononuclear cells and tissues of experimentally infected pigs. Vet. Microbiol. 1998, 62, 171–183. [Google Scholar] [CrossRef]
- Rziha, H.J.; Mettenleiter, T.C.; Ohlinger, V.; Wittmann, G. Herpesvirus (pseudorabies virus) latency in swine: Occurrence and physical state of viral DNA in neural tissues. Virology 1986, 155, 600–613. [Google Scholar] [CrossRef]
- Romero, C.H.; Meade, P.N.; Homer, B.L.; Shultz, J.E.; Lollis, G. Potential sites of virus latency associated with indigenous pseudorabies viruses in feral swine. J. Wildl. Dis. 2003, 39, 567–575. [Google Scholar] [CrossRef]
- Enquist, L.W. Exploiting circuit-specific spread of pseudorabies virus in the central nervous system: Insights to pathogenesis and circuit tracers. J. Infect. Dis. 2002, 186 (Suppl. 2), S209–S214. [Google Scholar] [CrossRef] [PubMed]
- Brockmeier, S.L.; Lager, K.M.; Mengeling, W.L. Comparison of in vivo reactivation, in vitro reactivation, and polymerase chain reaction for detection of latent pseudorabies virus infection in swine. J. Vet. Diagn. Invest. 1993, 5, 505–509. [Google Scholar] [CrossRef] [PubMed]
- Mengeling, W.L. Virus reactivation in pigs latently infected with a thymidine kinase negative vaccine strain of pseudorabies virus. Arch. Virol. 1991, 120, 57–70. [Google Scholar] [CrossRef] [PubMed]
- Daniel, G.R.; Sollars, P.J.; Pickard, G.E.; Smith, G.A. Pseudorabies Virus Fast Axonal Transport Occurs by a pUS9-Independent Mechanism. J. Virol. 2015, 89, 8088–8091. [Google Scholar] [CrossRef] [PubMed]
- Antinone, S.E.; Smith, G.A. Retrograde axon transport of herpes simplex virus and pseudorabies virus: A live-cell comparative analysis. J. Virol. 2010, 84, 1504–1512. [Google Scholar] [CrossRef] [PubMed]
- Shapira, M.; Homa, F.L.; Glorioso, J.C.; Levine, M. Regulation of the herpes simplex virus type 1 late (gamma 2) glycoprotein C gene: Sequences between base pairs −34 to +29 control transient expression and responsiveness to transactivation by the products of the immediate early (alpha) 4 and 0 genes. Nucleic Acids Res. 1987, 15, 3097–3111. [Google Scholar] [CrossRef]
- Andreau, K.; Lemaire, C.; Souvannavong, V.; Adam, A. Induction of apoptosis by dexamethasone in the B cell lineage. Immunopharmacology 1998, 40, 67–76. [Google Scholar] [CrossRef]
- Schang, L.M.; Kutish, G.F.; Osorio, F.A. Correlation between precolonization of trigeminal ganglia by attenuated strains of pseudorabies virus and resistance to wild-type virus latency. J. Virol. 1994, 68, 8470–8476. [Google Scholar] [CrossRef]







| Clinical Scoring Criteria | Rectal Temperature (°C) | Nasal Discharge | Lethargy | Dyspnea | Anorexia | Cough |
|---|---|---|---|---|---|---|
| Normal (0) | <39.7 | None | Normal in attitude | Normal breathing | Normal appetite | None |
| Mild (1) | 39.8–40.3 | Serous | Moves slowly, head down | Slight difficulty breathing | Slightly off feed | <3 occasional cough |
| Moderate (2) | 40.4–40.8 | Mucopurulent | Tends to lie down, moves reluctantly | Labored breathing | Moderately off feed | >3 repeated cough |
| Severe (3) | 40.9–41.1 | Copious mucopurulent | Difficult to stand, little response to stimuli | Very labored breathing | Not eating | NA |
| (4) | >41.2 | NA | NA | NA | NA | NA |
| Primer/Probe/ds-Gblock | Name | Sequence |
|---|---|---|
| PRV-ICP0 | Forward | 5′-atcccgtgctcctggataatctcg-3′ |
| Reverse | 5′-tccccgtcttcaactggctttatg-3′ | |
| Probe | 5′Fam-atgttgtccacgacggcctcgcgga-3′ Tamra | |
| ds-gblock | 5′-ggcctcggtcacgcgctggcggttcatcccgtgctcctggataatctcgacg Atgttgtccacgacggcctcgcggatggggtcgctctcgatgaccgtcgagacct gcccataaagccagttgaagacggggactctggggcgggcgcgagacccaga-3′ | |
| PRV–Major Capsid Protein | Forward | 5′-ccatccagtttgaggtgcag-3′ |
| Reverse | 5′-cgaggcgcttgatcatgtag-3′ | |
| Probe | 5′Fam-cccgtcgcgcgcgatcatcg-3′ Tamra | |
| ds-gblock | 5′-ctcagctacgtggccgagggcaccatccagtttgaggtgcagcagccgatg atcgcgcgcgacgggccgcacccggccgaccagcccgtgcacaactacatgatca agc gcctcgatcgccgctccctcaacgccgc-3′ | |
| PRV–Glycoprotein C | Forward | 5′-gtcgtccgcgactactacc-3′ |
| Reverse | 5′-tcacgttcaccacggagac-3′ | |
| Probe | 5′Fam-cgtccgcgaaccagcgcagg-3′ Tamra | |
| ds-gblock | 5′-agcccttccgggcggtgtgcgtcgtccgcgactactacccgcggcgcagcgtg cgcctgcgctggttcgcggacgagcacccggtggacgccgccttcgtgaccaa cagcaccgtggccgacgagctcgggcgccgcacgcgcgtctccgtggtgaac gtgacgcgcgcggacgtcccgggc-3′ | |
| Swine Glyceraldehyde 3-Phosphate Dehydrogenase (GAPDH) | Forward | 5′-atgacaacttcggcatcgtg-3′ |
| Reverse | 5′-ccatccacagtcttctgggt-3′ | |
| Probe | 5′Fam-accacagtccatgccatcactgcc-3′ Tamra | |
| ds-gblock | 5′-gcacccctggccaaggtcatccatgacaacttcggcatcgtggaaggactca tgaccacagtccatgccatcactgccacccagaagactgtggatggc ccctctgggaaacgtggcgt-3′ |
| Group | Animal # | Virus Isolation (PFU/mL) | PRV Genome Copies per 100 ng of DNA (Days Post-Infection) | |||||
|---|---|---|---|---|---|---|---|---|
| Day 3 | Day 5 | Day 3 | Day 5 | Day 15 | Day 21 | Day 28 | ||
| PRV wild-type | 2303 | 4.0 × 104 | 0 | 3.1 × 106 | 1.9 × 104 | 5.7 × 102 | 2.0 × 102 | 0 |
| 2306 | 7.6 × 104 | 0 | 6.7 × 106 | 4.1 × 104 | 3.6 × 102 | 3.8 × 102 | 0 | |
| PRVtmv+ | 2309 | 0 | 0 | 2.9 × 101 | 5.2 × 101 | 0 | 0 | 0 |
| 2312 | 0 | 0 | 2.4 × 102 | 1.4 × 102 | 0 | 0 | 0 | |
| 2315 | 0 | 0 | 8.1 × 101 | 1.8 × 102 | 0 | 0 | 0 | |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Pavulraj, S.; Stout, R.W.; Paulsen, D.B.; Chowdhury, S.I. Live Triple Gene-Deleted Pseudorabies Virus-Vectored Subunit PCV2b and CSFV Vaccine Undergoes an Abortive Replication Cycle in the TG Neurons following Latency Reactivation. Viruses 2023, 15, 473. https://doi.org/10.3390/v15020473
Pavulraj S, Stout RW, Paulsen DB, Chowdhury SI. Live Triple Gene-Deleted Pseudorabies Virus-Vectored Subunit PCV2b and CSFV Vaccine Undergoes an Abortive Replication Cycle in the TG Neurons following Latency Reactivation. Viruses. 2023; 15(2):473. https://doi.org/10.3390/v15020473
Chicago/Turabian StylePavulraj, Selvaraj, Rhett W. Stout, Daniel B. Paulsen, and Shafiqul I. Chowdhury. 2023. "Live Triple Gene-Deleted Pseudorabies Virus-Vectored Subunit PCV2b and CSFV Vaccine Undergoes an Abortive Replication Cycle in the TG Neurons following Latency Reactivation" Viruses 15, no. 2: 473. https://doi.org/10.3390/v15020473
APA StylePavulraj, S., Stout, R. W., Paulsen, D. B., & Chowdhury, S. I. (2023). Live Triple Gene-Deleted Pseudorabies Virus-Vectored Subunit PCV2b and CSFV Vaccine Undergoes an Abortive Replication Cycle in the TG Neurons following Latency Reactivation. Viruses, 15(2), 473. https://doi.org/10.3390/v15020473

