HPV16 Intratypic Variants in Head and Neck Cancers: A North American Perspective
Abstract
1. Introduction
2. Materials and Methods
2.1. Southwestern Ontario (SWO) Cohort
2.2. DNA Extraction
2.2.1. Formalin-Fixed Paraffin-Embedded (FFPE) Samples
2.2.2. Fresh-Frozen (FF) Samples
2.3. HPV Typing, PCR, Sequencing, and Variant Identification
2.4. The Cancer Genome Atlas (TCGA) Cohort
2.5. Statistical Analysis
3. Results
3.1. Study Cohorts and Distribution of HPV16 Intratypic Variants in HNCs from North America
3.2. Impact of HPV16 Intratypic Variants in HNCs on Clinical Variables
3.3. Impact of HPV16 Intratypic Variants on Clinical Outcomes
3.4. Impact of HPV16 Intratypic Variants on Immune Characteristics
4. Discussion
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Doorbar, J.; Egawa, N.; Griffin, H.; Kranjec, C.; Murakami, I. Human papillomavirus molecular biology and disease association. Rev. Med. Virol. 2015, 25 (Suppl. S1), 2–23. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Burd, E.M. Human papillomavirus and cervical cancer. Clin. Microbiol. Rev. 2003, 16, 1–17. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Moody, C.A.; Laimins, L.A. Human papillomavirus oncoproteins: Pathways to transformation. Nat. Rev. Cancer 2010, 10, 550–560. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- zur Hausen, H. Papillomaviruses and cancer: From basic studies to clinical application. Nat. Rev. Cancer 2002, 2, 342–350. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Bray, F.; Ferlay, J.; Soerjomataram, I.; Siegel, R.L.; Torre, L.A.; Jemal, A. Global cancer statistics 2018: GLOBOCAN estimates of incidence and mortality worldwide for 36 cancers in 185 countries. CA Cancer J. Clin. 2018, 68, 394–424. [Google Scholar] [CrossRef] [Scilit]
- de Martel, C.; Georges, D.; Bray, F.; Ferlay, J.; Clifford, G.M. Global burden of cancer attributable to infections in 2018: A worldwide incidence analysis. Lancet Glob. Health 2020, 8, e180–e190. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Schiffman, M.; Doorbar, J.; Wentzensen, N.; de Sanjose, S.; Fakhry, C.; Monk, B.J.; Stanley, M.A.; Franceschi, S. Carcinogenic human papillomavirus infection. Nat. Rev. Dis. Primers 2016, 2, 16086. [Google Scholar] [CrossRef] [Scilit]
- Pesut, E.; Dukic, A.; Lulic, L.; Skelin, J.; Simic, I.; Milutin Gasperov, N.; Tomaic, V.; Sabol, I.; Grce, M. Human Papillomaviruses-Associated Cancers: An Update of Current Knowledge. Viruses 2021, 13, 2234. [Google Scholar] [CrossRef] [Scilit]
- de Martel, C.; Plummer, M.; Vignat, J.; Franceschi, S. Worldwide burden of cancer attributable to HPV by site, country and HPV type. Int. J. Cancer 2017, 141, 664–670. [Google Scholar] [CrossRef] [Scilit]
- Leemans, C.R.; Snijders, P.J.F.; Brakenhoff, R.H. The molecular landscape of head and neck cancer. Nat. Rev. Cancer 2018, 18, 269–282. [Google Scholar] [CrossRef] [Scilit]
- Gameiro, S.F.; Evans, A.M.; Mymryk, J.S. The tumor immune microenvironments of HPV+ and HPV− head and neck cancers. WIREs Mech. Dis. 2022, 14, e1539. [Google Scholar] [CrossRef] [Scilit]
- Kreimer, A.R.; Clifford, G.M.; Boyle, P.; Franceschi, S. Human papillomavirus types in head and neck squamous cell carcinomas worldwide: A systematic review. Cancer Epidemiol. Biomark. Prev. 2005, 14, 467–475. [Google Scholar] [CrossRef] [Scilit]
- Kang, H.; Kiess, A.; Chung, C.H. Emerging biomarkers in head and neck cancer in the era of genomics. Nat. Rev. Clin. Oncol. 2015, 12, 11–26. [Google Scholar] [CrossRef] [Scilit]
- Gameiro, S.F.; Ghasemi, F.; Barrett, J.W.; Koropatnick, J.; Nichols, A.C.; Mymryk, J.S.; Maleki Vareki, S. Treatment-naive HPV+ head and neck cancers display a T-cell-inflamed phenotype distinct from their HPV- counterparts that has implications for immunotherapy. Oncoimmunology 2018, 7, e1498439. [Google Scholar] [CrossRef] [Scilit]
- Gameiro, S.F.; Ghasemi, F.; Zeng, P.Y.F.; Mundi, N.; Howlett, C.J.; Plantinga, P.; Barrett, J.W.; Nichols, A.C.; Mymryk, J.S. Low expression of NSD1, NSD2, and NSD3 define a subset of human papillomavirus-positive oral squamous carcinomas with unfavorable prognosis. Infect. Agents Cancer 2021, 16, 13. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Gameiro, S.F.; Ghasemi, F.; Barrett, J.W.; Nichols, A.C.; Mymryk, J.S. High Level Expression of MHC-II in HPV+ Head and Neck Cancers Suggests that Tumor Epithelial Cells Serve an Important Role as Accessory Antigen Presenting Cells. Cancers 2019, 11, 1129. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Gameiro, S.F.; Zhang, A.; Ghasemi, F.; Barrett, J.W.; Nichols, A.C.; Mymryk, J.S. Analysis of Class I Major Histocompatibility Complex Gene Transcription in Human Tumors Caused by Human Papillomavirus Infection. Viruses 2017, 9, 252. [Google Scholar] [CrossRef] [Scilit]
- Garset-Zamani, M.; Carlander, A.F.; Jakobsen, K.K.; Friborg, J.; Kiss, K.; Marvig, R.L.; Olsen, C.; Nielsen, F.C.; Andersen, E.; Gronhoj, C.; et al. Impact of specific high-risk human papillomavirus genotypes on survival in oropharyngeal cancer. Int. J. Cancer 2022, 150, 1174–1183. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Ziai, H.; Warner, A.; Mundi, N.; Patel, K.; Chung, E.J.; Howlett, C.J.; Plantinga, P.; Yoo, J.; MacNeil, S.D.; Fung, K.; et al. Does HPV Subtype Predict Outcomes in Head and Neck Cancers? Int. J. Otolaryngol. 2021, 2021, 6672373. [Google Scholar] [CrossRef] [Scilit]
- Bratman, S.V.; Bruce, J.P.; O’Sullivan, B.; Pugh, T.J.; Xu, W.; Yip, K.W.; Liu, F.F. Human Papillomavirus Genotype Association With Survival in Head and Neck Squamous Cell Carcinoma. JAMA Oncol. 2016, 2, 823–826. [Google Scholar] [CrossRef] [Scilit]
- Doorbar, J.; Quint, W.; Banks, L.; Bravo, I.G.; Stoler, M.; Broker, T.R.; Stanley, M.A. The biology and life-cycle of human papillomaviruses. Vaccine 2012, 30 (Suppl. S5), F55–F70. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Bodily, J.; Laimins, L.A. Persistence of human papillomavirus infection: Keys to malignant progression. Trends Microbiol. 2011, 19, 33–39. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Longworth, M.S.; Laimins, L.A. Pathogenesis of human papillomaviruses in differentiating epithelia. Microbiol. Mol. Biol. Rev. 2004, 68, 362–372. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Riva, G.; Albano, C.; Gugliesi, F.; Pasquero, S.; Pacheco, S.F.C.; Pecorari, G.; Landolfo, S.; Biolatti, M.; Dell’Oste, V. HPV Meets APOBEC: New Players in Head and Neck Cancer. Int. J. Mol. Sci. 2021, 22, 1402. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Ho, L.; Chan, S.Y.; Burk, R.D.; Das, B.C.; Fujinaga, K.; Icenogle, J.P.; Kahn, T.; Kiviat, N.; Lancaster, W.; Mavromara-Nazos, P.; et al. The genetic drift of human papillomavirus type 16 is a means of reconstructing prehistoric viral spread and the movement of ancient human populations. J. Virol. 1993, 67, 6413–6423. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Chan, S.Y.; Ho, L.; Ong, C.K.; Chow, V.; Drescher, B.; Durst, M.; ter Meulen, J.; Villa, L.; Luande, J.; Mgaya, H.N.; et al. Molecular variants of human papillomavirus type 16 from four continents suggest ancient pandemic spread of the virus and its coevolution with humankind. J. Virol. 1992, 66, 2057–2066. [Google Scholar] [CrossRef] [Scilit]
- Pientong, C.; Wongwarissara, P.; Ekalaksananan, T.; Swangphon, P.; Kleebkaow, P.; Kongyingyoes, B.; Siriaunkgul, S.; Tungsinmunkong, K.; Suthipintawong, C. Association of human papillomavirus type 16 long control region mutation and cervical cancer. Virol. J. 2013, 10, 30. [Google Scholar] [CrossRef] [Scilit]
- Yamada, T.; Manos, M.M.; Peto, J.; Greer, C.E.; Munoz, N.; Bosch, F.X.; Wheeler, C.M. Human papillomavirus type 16 sequence variation in cervical cancers: A worldwide perspective. J. Virol. 1997, 71, 2463–2472. [Google Scholar] [CrossRef] [Scilit]
- Mirabello, L.; Yeager, M.; Yu, K.; Clifford, G.M.; Xiao, Y.; Zhu, B.; Cullen, M.; Boland, J.F.; Wentzensen, N.; Nelson, C.W.; et al. HPV16 E7 Genetic Conservation Is Critical to Carcinogenesis. Cell 2017, 170, 1164–1174.e6. [Google Scholar] [CrossRef] [Scilit]
- Kessis, T.D.; Slebos, R.J.; Nelson, W.G.; Kastan, M.B.; Plunkett, B.S.; Han, S.M.; Lorincz, A.T.; Hedrick, L.; Cho, K.R. Human papillomavirus 16 E6 expression disrupts the p53-mediated cellular response to DNA damage. Proc. Natl. Acad. Sci. USA 1993, 90, 3988–3992. [Google Scholar] [CrossRef] [Scilit]
- Mantovani, F.; Banks, L. The human papillomavirus E6 protein and its contribution to malignant progression. Oncogene 2001, 20, 7874–7887. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- McLaughlin-Drubin, M.E.; Meyers, J.; Munger, K. Cancer associated human papillomaviruses. Curr. Opin. Virol. 2012, 2, 459–466. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Bernard, H.U.; Burk, R.D.; Chen, Z.; van Doorslaer, K.; zur Hausen, H.; de Villiers, E.M. Classification of papillomaviruses (PVs) based on 189 PV types and proposal of taxonomic amendments. Virology 2010, 401, 70–79. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Burk, R.D.; Harari, A.; Chen, Z. Human papillomavirus genome variants. Virology 2013, 445, 232–243. [Google Scholar] [CrossRef] [Scilit]
- Cornet, I.; Gheit, T.; Franceschi, S.; Vignat, J.; Burk, R.D.; Sylla, B.S.; Tommasino, M.; Clifford, G.M.; Group, I.H.V.S. Human papillomavirus type 16 genetic variants: Phylogeny and classification based on E6 and LCR. J. Virol. 2012, 86, 6855–6861. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Ho, L.; Chan, S.Y.; Chow, V.; Chong, T.; Tay, S.K.; Villa, L.L.; Bernard, H.U. Sequence variants of human papillomavirus type 16 in clinical samples permit verification and extension of epidemiological studies and construction of a phylogenetic tree. J. Clin. Microbiol. 1991, 29, 1765–1772. [Google Scholar] [CrossRef] [Scilit]
- Combes, J.D.; Franceschi, S. Human papillomavirus genome variants and head and neck cancers: A perspective. Infect. Agents Cancer 2018, 13, 13. [Google Scholar] [CrossRef] [Scilit]
- Yamada, T.; Wheeler, C.M.; Halpern, A.L.; Stewart, A.C.; Hildesheim, A.; Jenison, S.A. Human papillomavirus type 16 variant lineages in United States populations characterized by nucleotide sequence analysis of the E6, L2, and L1 coding segments. J. Virol. 1995, 69, 7743–7753. [Google Scholar] [CrossRef] [Scilit]
- Grodzki, M.; Besson, G.; Clavel, C.; Arslan, A.; Franceschi, S.; Birembaut, P.; Tommasino, M.; Zehbe, I. Increased risk for cervical disease progression of French women infected with the human papillomavirus type 16 E6-350G variant. Cancer Epidemiol. Biomark. Prev. 2006, 15, 820–822. [Google Scholar] [CrossRef] [Scilit]
- Zehbe, I.; Wilander, E.; Delius, H.; Tommasino, M. Human papillomavirus 16 E6 variants are more prevalent in invasive cervical carcinoma than the prototype. Cancer Res. 1998, 58, 829–833. [Google Scholar]
- Godi, A.; Boampong, D.; Elegunde, B.; Panwar, K.; Fleury, M.; Li, S.; Zhao, Q.; Xia, N.; Christensen, N.D.; Beddows, S. Comprehensive Assessment of the Antigenic Impact of Human Papillomavirus Lineage Variation on Recognition by Neutralizing Monoclonal Antibodies Raised against Lineage A Major Capsid Proteins of Vaccine-Related Genotypes. J. Virol. 2020, 94, e01236-20. [Google Scholar] [CrossRef] [Scilit]
- Togtema, M.; Jackson, R.; Richard, C.; Niccoli, S.; Zehbe, I. The human papillomavirus 16 European-T350G E6 variant can immortalize but not transform keratinocytes in the absence of E7. Virology 2015, 485, 274–282. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Cornet, I.; Gheit, T.; Iannacone, M.R.; Vignat, J.; Sylla, B.S.; Del Mistro, A.; Franceschi, S.; Tommasino, M.; Clifford, G.M. HPV16 genetic variation and the development of cervical cancer worldwide. Br. J. Cancer 2013, 108, 240–244. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Londesborough, P.; Ho, L.; Terry, G.; Cuzick, J.; Wheeler, C.; Singer, A. Human papillomavirus genotype as a predictor of persistence and development of high-grade lesions in women with minor cervical abnormalities. Int. J. Cancer 1996, 69, 364–368. [Google Scholar] [CrossRef]
- Gheit, T.; Cornet, I.; Clifford, G.M.; Iftner, T.; Munk, C.; Tommasino, M.; Kjaer, S.K. Risks for persistence and progression by human papillomavirus type 16 variant lineages among a population-based sample of Danish women. Cancer Epidemiol. Biomark. Prev. Publ. Am. Assoc. Cancer Res. Cosponsored Am. Soc. Prev. Oncol. 2011, 20, 1315–1321. [Google Scholar] [CrossRef] [Scilit]
- Schiffman, M.; Rodriguez, A.C.; Chen, Z.; Wacholder, S.; Herrero, R.; Hildesheim, A.; Desalle, R.; Befano, B.; Yu, K.; Safaeian, M.; et al. A population-based prospective study of carcinogenic human papillomavirus variant lineages, viral persistence, and cervical neoplasia. Cancer Res. 2010, 70, 3159–3169. [Google Scholar] [CrossRef] [Scilit]
- Zuna, R.E.; Tuller, E.; Wentzensen, N.; Mathews, C.; Allen, R.A.; Shanesmith, R.; Dunn, S.T.; Gold, M.A.; Wang, S.S.; Walker, J.; et al. HPV16 variant lineage, clinical stage, and survival in women with invasive cervical cancer. Infect. Agents Cancer 2011, 6, 19. [Google Scholar] [CrossRef] [Scilit]
- Burk, R.D.; Terai, M.; Gravitt, P.E.; Brinton, L.A.; Kurman, R.J.; Barnes, W.A.; Greenberg, M.D.; Hadjimichael, O.C.; Fu, L.; McGowan, L.; et al. Distribution of human papillomavirus types 16 and 18 variants in squamous cell carcinomas and adenocarcinomas of the cervix. Cancer Res. 2003, 63, 7215–7220. [Google Scholar]
- Nichols, A.C.; Dhaliwal, S.S.; Palma, D.A.; Basmaji, J.; Chapeskie, C.; Dowthwaite, S.; Franklin, J.H.; Fung, K.; Kwan, K.; Wehrli, B.; et al. Does HPV type affect outcome in oropharyngeal cancer? J. Otolaryngol. Head Neck Surg. 2013, 42, 9. [Google Scholar] [CrossRef] [Scilit]
- Nichols, A.C.; Palma, D.A.; Dhaliwal, S.S.; Tan, S.; Theuer, J.; Chow, W.; Rajakumar, C.; Um, S.; Mundi, N.; Berk, S.; et al. The epidemic of human papillomavirus and oropharyngeal cancer in a Canadian population. Curr. Oncol. 2013, 20, 212–219. [Google Scholar] [CrossRef] [Scilit]
- de Boer, M.A.; Peters, L.A.; Aziz, M.F.; Siregar, B.; Cornain, S.; Vrede, M.A.; Jordanova, E.S.; Kolkman-Uljee, S.; Fleuren, G.J. Human papillomavirus type 16 E6, E7, and L1 variants in cervical cancer in Indonesia, Suriname, and The Netherlands. Gynecol. Oncol. 2004, 94, 488–494. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Liu, J.; Lichtenberg, T.; Hoadley, K.A.; Poisson, L.M.; Lazar, A.J.; Cherniack, A.D.; Kovatich, A.J.; Benz, C.C.; Levine, D.A.; Lee, A.V.; et al. An Integrated TCGA Pan-Cancer Clinical Data Resource to Drive High-Quality Survival Outcome Analytics. Cell 2018, 173, 400–416.e11. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Thorsson, V.; Gibbs, D.L.; Brown, S.D.; Wolf, D.; Bortone, D.S.; Ou Yang, T.H.; Porta-Pardo, E.; Gao, G.F.; Plaisier, C.L.; Eddy, J.A.; et al. The Immune Landscape of Cancer. Immunity 2018, 48, 812–830.e14. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- The Cancer Genome Atlas Network. Comprehensive genomic characterization of head and neck squamous cell carcinomas. Nature 2015, 517, 576–582. [Google Scholar] [CrossRef] [Scilit]
- Yang, B.; Zhang, L.; Zhang, A.; Zhou, A.; Yuan, J.; Wang, Y.; Sun, L.; Cao, H.; Zheng, W. Variant sublineages of human papillomavirus type 16 predispose women to persistent infection characterized by a sequence analysis of the E6, L1, and LCR regions. Int. J. Clin. Exp. Pathol. 2019, 12, 337–343. [Google Scholar]
- Rader, J.S.; Tsaih, S.W.; Fullin, D.; Murray, M.W.; Iden, M.; Zimmermann, M.T.; Flister, M.J. Genetic variations in human papillomavirus and cervical cancer outcomes. Int. J. Cancer 2019, 144, 2206–2214. [Google Scholar] [CrossRef] [Scilit]
- Zhang, L.; Yang, B.; Zhang, A.; Zhou, A.; Yuan, J.; Wang, Y.; Sun, L.; Cao, H.; Wang, J.; Zheng, W. Association between human papillomavirus type 16 E6 and E7 variants with subsequent persistent infection and recurrence of cervical high-grade squamous intraepithelial lesion after conization. J. Med. Virol. 2016, 88, 1982–1988. [Google Scholar] [CrossRef] [Scilit]
- Mirabello, L.; Clarke, M.A.; Nelson, C.W.; Dean, M.; Wentzensen, N.; Yeager, M.; Cullen, M.; Boland, J.F.; Workshop, N.H.; Schiffman, M.; et al. The Intersection of HPV Epidemiology, Genomics and Mechanistic Studies of HPV-Mediated Carcinogenesis. Viruses 2018, 10, 80. [Google Scholar] [CrossRef] [Scilit]
- Mirabello, L.; Yeager, M.; Cullen, M.; Boland, J.F.; Chen, Z.; Wentzensen, N.; Zhang, X.; Yu, K.; Yang, Q.; Mitchell, J.; et al. HPV16 Sublineage Associations with Histology-Specific Cancer Risk Using HPV Whole-Genome Sequences in 3200 Women. J. Natl. Cancer Inst. 2016, 108, djw100. [Google Scholar] [CrossRef] [Scilit]
- Lou, H.; Boland, J.F.; Torres-Gonzalez, E.; Albanez, A.; Zhou, W.; Steinberg, M.K.; Diaw, L.; Mitchell, J.; Roberson, D.; Cullen, M.; et al. The D2 and D3 Sublineages of Human Papilloma Virus 16-Positive Cervical Cancer in Guatemala Differ in Integration Rate and Age of Diagnosis. Cancer Res. 2020, 80, 3803–3809. [Google Scholar] [CrossRef] [Scilit]
- Clifford, G.M.; Tenet, V.; Georges, D.; Alemany, L.; Pavon, M.A.; Chen, Z.; Yeager, M.; Cullen, M.; Boland, J.F.; Bass, S.; et al. Human papillomavirus 16 sub-lineage dispersal and cervical cancer risk worldwide: Whole viral genome sequences from 7116 HPV16-positive women. Papillomavirus Res. 2019, 7, 67–74. [Google Scholar] [CrossRef] [Scilit]
- Zacapala-Gomez, A.E.; Del Moral-Hernandez, O.; Villegas-Sepulveda, N.; Hidalgo-Miranda, A.; Romero-Cordoba, S.L.; Beltran-Anaya, F.O.; Leyva-Vazquez, M.A.; Alarcon-Romero Ldel, C.; Illades-Aguiar, B. Changes in global gene expression profiles induced by HPV 16 E6 oncoprotein variants in cervical carcinoma C33-A cells. Virology 2016, 488, 187–195. [Google Scholar] [CrossRef] [Scilit]
- Zehbe, I.; Tachezy, R.; Mytilineos, J.; Voglino, G.; Mikyskova, I.; Delius, H.; Marongiu, A.; Gissmann, L.; Wilander, E.; Tommasino, M. Human papillomavirus 16 E6 polymorphisms in cervical lesions from different European populations and their correlation with human leukocyte antigen class II haplotypes. Int. J. Cancer 2001, 94, 711–716. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Schrank, T.P.; Landess, L.; Stepp, W.H.; Rehmani, H.; Weir, W.H.; Lenze, N.; Lal, A.; Wu, D.; Kothari, A.; Hackman, T.G.; et al. Comprehensive Viral Genotyping Reveals Prognostic Viral Phylogenetic Groups in HPV16-Associated Squamous Cell Carcinoma of the Oropharynx. Mol. Cancer Res. 2022, 20, 1489–1501. [Google Scholar] [CrossRef] [Scilit]
- Lang Kuhs, K.A.; Faden, D.L.; Chen, L.; Smith, D.K.; Pinheiro, M.; Wood, C.B.; Davis, S.; Yeager, M.; Boland, J.F.; Cullen, M.; et al. Genetic variation within the human papillomavirus type 16 genome is associated with oropharyngeal cancer prognosis. Ann. Oncol. 2022, 33, 638–648. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Lewis, J.S., Jr.; Mirabello, L.; Liu, P.; Wang, X.; Dupont, W.D.; Plummer, W.D.; Pinheiro, M.; Yeager, M.; Boland, J.F.; Cullen, M.; et al. Oropharyngeal Squamous Cell Carcinoma Morphology and Subtypes by Human Papillomavirus Type and by 16 Lineages and Sublineages. Head Neck Pathol. 2021, 15, 1089–1098. [Google Scholar] [CrossRef] [Scilit]
- Lechner, A.; Schlosser, H.A.; Thelen, M.; Wennhold, K.; Rothschild, S.I.; Gilles, R.; Quaas, A.; Siefer, O.G.; Huebbers, C.U.; Cukuroglu, E.; et al. Tumor-associated B cells and humoral immune response in head and neck squamous cell carcinoma. Oncoimmunology 2019, 8, 1535293. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Wieland, A.; Patel, M.R.; Cardenas, M.A.; Eberhardt, C.S.; Hudson, W.H.; Obeng, R.C.; Griffith, C.C.; Wang, X.; Chen, Z.G.; Kissick, H.T.; et al. Defining HPV-specific B cell responses in patients with head and neck cancer. Nature 2021, 597, 274–278. [Google Scholar] [CrossRef] [Scilit]



| Primers | Sequences (5′–3′) | Position (nt) | Product Size (bp) |
|---|---|---|---|
| E6-1 Forward | TTGAACCGAAACCGGTTAGT | 46–65 | 211 |
| E6-1 Reverse | GCATAAATCCCGAAAAGCAA | 237–256 | |
| E6-2 Forward | GCAACAGTTACTGCGACGTG | 204–224 | 235 |
| E6-2 Reverse | GGACACAGTGGCTTTTGACA | 419–438 | |
| E6-3 Forward | CAGCAATACAACAAACCGTTG | 371–391 | 220 |
| E6-3 Reverse | TCATGCAATGTAGGTGTATCTCC | 568–590 |
| Lineage | Sublineage | Variant Genome ID | GenBank Accession Numbers | E6 Nucleotide Position | |||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| 1 0 9 | 1 3 1 | 1 3 2 | 1 4 3 | 1 4 5 | 1 7 8 | 2 7 6 | 2 8 6 | 2 8 9 | 3 3 5 | 3 5 0 | 4 0 3 | 4 3 3 | 5 3 2 | ||||
| A | A1 | Ref | K02718 | T | A | G | C | G | T | A | T | A | C | T | A | G | A |
| A2 | W0122 | AF536179 | — | —/G | — | — | — | — | — | — | — | — | —/G | — | — | — | |
| A3 | AS411 | HQ644236 | — | — | — | — | — | — | G | — | — | — | — | — | — | — | |
| A4 | W0724 | AF534061 | — | — | — | — | — | G/A | — | — | — | — | — | — | — | — | |
| B | B1 | W0236 | AF536180 | — | — | C | G | T | — | — | A | G | T | — | — | — | — |
| B2 | Z109 | HQ644298 | — | G | — | G | T | — | — | A | G | T | — | — | — | — | |
| C | R460 | AF472509 | C | — | T | G | T | — | — | A | G | T | — | G | — | — | |
| D | D1 | QV00512 | HQ644257 | — | — | — | — | T | — | — | A | G | T | G | — | — | — |
| D2 | QV15321 | AY686579 | — | — | — | — | T | — | — | A | G | T | G | — | — | G | |
| D3 | QV00995 | AF402678 | — | — | — | — | T | — | — | A | G | T | G | — | A | G | |
| Clinical Variables | SWO Cohort | TCGA Cohort | CANUSA Cohort |
|---|---|---|---|
| n = 94 a | n = 55 | n = 149 | |
| Age at diagnosis | |||
| Median (IQR) | 57 (52–66) | 57 (50.5–61) | 57 (50.5–66) |
| Sex | |||
| Female | 15 | 6 | 21 |
| Male | 79 | 49 | 128 |
| Subsite | |||
| Tonsil | 61 | 30 | 91 |
| BOT | 28 | 10 | 38 |
| Other | 5 | 15 | 20 |
| T Stage b | |||
| T1 | 14 | 5 | 19 |
| T2 | 36 | 28 | 64 |
| T3 | 17 | 9 | 26 |
| T4 | 19 | 12 | 31 |
| N Stage c | |||
| N0 | 10 | 15 | 25 |
| N1 | 14 | 4 | 18 |
| N2 | 54 | 33 | 87 |
| N3 | 8 | 2 | 10 |
| O Stage d | |||
| I | 0 | 1 | 1 |
| II | 6 | 9 | 15 |
| III | 11 | 6 | 17 |
| IV | 58 | 39 | 97 |
| Smoking Status | |||
| Never | 28 | 19 | 47 |
| Former | 26 | 26 | 52 |
| Current | 40 | 10 | 50 |
| Smoking Frequency e | |||
| Non-Smoker | 28 | 19 | 47 |
| Light Smoker | 22 | 10 | 32 |
| Heavy Smoker | 39 | 20 | 59 |
| HPV16 Sublineages | |||
| A1 | 38 | 20 | 58 |
| A2 | 54 | 20 | 74 |
| A3 | 0 | 0 | 0 |
| A4 | 0 | 4 | 4 |
| B1 | 0 | 3 | 3 |
| B2 | 0 | 1 | 1 |
| C | 0 | 1 | 1 |
| D1 | 0 | 0 | 0 |
| D2/D3 | 2 | 6 | 8 |
| D3 | 0 | 0 | 0 |
| HPV16 E6 | |||
| 350T | 33 | 16 | 49 |
| 350G | 40 | 9 | 49 |
| Clinical Variables | Sublineage A1 | Sublineage A2 | Total | p Value | |
|---|---|---|---|---|---|
| Age | ≤60 | 41 | 43 | 84 | 0.149 |
| >60 | 17 | 31 | 48 | ||
| Sex | Female | 10 | 10 | 20 | 0.628 |
| Male | 48 | 64 | 112 | ||
| Subsite | Tonsil | 34 | 46 | 80 | 0.907 |
| BOT | 16 | 18 | 34 | ||
| Other | 8 | 10 | 18 | ||
| T Stage | T1 | 8 | 9 | 17 | 0.210 |
| T2 | 27 | 28 | 55 | ||
| T3 | 6 | 17 | 23 | ||
| T4 | 15 | 13 | 28 | ||
| N Stage | N0 | 11 | 11 | 22 | 0.165 |
| N1 | 4 | 14 | 18 | ||
| N2 | 35 | 38 | 73 | ||
| N3 | 6 | 4 | 10 | ||
| O Stage | I | 1 | 0 | 1 | 0.055 |
| II | 9 | 4 | 13 | ||
| III | 4 | 12 | 16 | ||
| IV | 41 | 42 | 83 | ||
| Smoking Status | Never | 24 | 19 | 43 | 0.029 |
| Former | 20 | 21 | 41 | ||
| Current | 14 | 34 | 48 | ||
| Smoking Frequency | Non-Smoker | 24 | 19 | 43 | 0.089 |
| Light Smoker | 11 | 14 | 25 | ||
| Heavy Smoker | 18 | 36 | 54 | ||
| Clinical Variables | E6 350T | E6 350G | Total | p Value | |
|---|---|---|---|---|---|
| Age | ≤60 | 34 | 27 | 61 | 0.211 |
| >60 | 15 | 22 | 37 | ||
| Sex | Female | 9 | 7 | 16 | 0.785 |
| Male | 40 | 42 | 82 | ||
| Subsite | Tonsil | 28 | 31 | 59 | 0.840 |
| BOT | 14 | 12 | 26 | ||
| Other | 7 | 6 | 13 | ||
| T Stage | T1 | 7 | 7 | 14 | 0.011 |
| T2 | 22 | 15 | 37 | ||
| T3 | 4 | 16 | 20 | ||
| T4 | 14 | 7 | 21 | ||
| N Stage | N0 | 8 | 3 | 11 | 0.004 |
| N1 | 2 | 13 | 15 | ||
| N2 | 31 | 27 | 58 | ||
| N3 | 6 | 2 | 8 | ||
| O Stage | I | 1 | 0 | 1 | 0.001 |
| II | 6 | 0 | 6 | ||
| III | 2 | 10 | 12 | ||
| IV | 37 | 28 | 65 | ||
| Smoking Status | Never | 20 | 15 | 35 | 0.017 |
| Former | 20 | 12 | 32 | ||
| Current | 9 | 22 | 31 | ||
| Smoking Frequency | Non-Smoker | 20 | 15 | 35 | 0.346 |
| Light Smoker | 10 | 9 | 19 | ||
| Heavy Smoker | 15 | 22 | 37 | ||
| Variable | Univariable Analysis | Multivariable Analysis | ||
|---|---|---|---|---|
| HR (95% CI) | p Value | HR (95% CI) | p Value | |
| Age at diagnosis | 1.02 (0.97–1.07) | 0.423 | ||
| Sex | ||||
| Male vs. Female | 0.41 (0.12–1.32) | 0.134 | ||
| Subsite | ||||
| Tonsil vs. base-of-tongue | 0.74 (0.22–2.52) | 0.629 | ||
| Other vs. base-of-tongue | 1.06 (0.19–5.77) | 0.950 | ||
| T stage | ||||
| T3–T4 vs. T1–T2 | 4.62 (1.27–16.8) | 0.020 | ||
| N stage | ||||
| N2–N3 vs. N0–N1 | 0.43 (0.14–1.27) | 0.126 | ||
| Overall Stage | ||||
| III–IV vs. I–II | 7.59 × 107 (0–Inf) | 0.998 | 4.62 (1.27–16.8) | 0.020 |
| Smoking status | ||||
| Former vs. Never | 0.47 (0.09–2.40) | 0.360 | ||
| Current vs. Never | 1.35 (0.41–4.45) | 0.620 | ||
| Smoking Frequency | ||||
| Light vs. Never | 0.66 (0.13–3.40) | 0.619 | ||
| Heavy vs. Never | 1.05 (0.32–3.45) | 0.938 | ||
| HPV16 T350G | ||||
| 350G vs. 350T | 2.91 (0.89–9.46) | 0.076 | ||
| Treatment | ||||
| Chemotherapy + Radiation | 8.98 × 10−1 (0.27–2.95) | 0.859 | ||
| Surgery + Chemotherapy + Radiation | 1.29 × 10−8 (0–Inf) | 0.999 | ||
| Surgery + Radiation | 1.30 × 10−8 (0–Inf) | 0.999 | ||
| Surgery Alone | 1.11 (0.34–3.66) | 0.859 | ||
| Radiation Alone | 1.29 × 10−8 (0–Inf) | 0.999 | ||
| Variable | Univariable Analysis | Multivariable Analysis | ||
|---|---|---|---|---|
| HR (95% CI) | p Value | HR (95% CI) | p Value | |
| Age at diagnosis | 1.04 (0.99–1.08) | 0.124 | 1.03 (0.99–1.08) | 0.144 |
| Sex | ||||
| Male vs. Female | 0.47 (0.15–1.48) | 0.198 | ||
| Subsite | ||||
| Tonsil vs. base-of-tongue | 0.70 (0.23–2.14) | 0.530 | ||
| Other vs. base-of-tongue | 0.89 (0.17–4.58) | 0.888 | ||
| T stage | ||||
| T3–T4 vs. T1–T2 | 3.86 (1.23–12.14) | 0.021 | 2.86 (0.88–9.35) | 0.082 |
| N stage | ||||
| N2–N3 vs. N0–N1 | 0.74 (0.25–2.17) | 0.586 | ||
| Overall Stage | ||||
| III–IV vs. I–II | 7.63 × 107 (0–Inf) | 0.998 | ||
| Smoking status | ||||
| Former vs. Never | 0.79 (0.22–2.80) | 0.712 | ||
| Current vs. Never | 0.98 (0.30–3.21) | 0.968 | ||
| Smoking Frequency | ||||
| Light vs. Never | 0.84 (0.21–3.35) | 0.799 | ||
| Heavy vs. Never | 0.91 (0.29–2.82) | 0.867 | ||
| HPV16 T350G | ||||
| 350G vs. 350T | 3.55 (1.13–11.17) | 0.030 | 2.78 (0.85–9.05) | 0.090 |
| Treatment | ||||
| Chemotherapy + Radiation | 6.17 × 10−1 (0.22–1.77) | 0.369 | ||
| Surgery + Chemotherapy + Radiation | 1.38 × 10−8 (0–Inf) | 0.998 | ||
| Surgery + Radiation | 1.42 × 10−8 (0–Inf) | 0.999 | ||
| Surgery Alone | 1.62 (0.57–4.64) | 0.369 | ||
| Radiation Alone | 1.41 × 10−8 (0–Inf) | 0.999 | ||
| Study | CANUSA | Vanderbilt [66] | North Carolina [64] | Vanderbilt/Pittsburgh [65] | |||||
|---|---|---|---|---|---|---|---|---|---|
| HPV16 Variant | A | 136 (91.3%) | A1: 58 (42.6%) | 191 (90.1%) | A1: 112 (58.33%) | 91 (85%) | A1: 77 (84.6%) | 347 (90.4%) | A1: 215 (62%) |
| A2: 74 (54.4) | A2: 63 (32.8%) | A2: 9 (9.89%) | A2: 107 (30.8%) | ||||||
| A3: 0 (0%) | A3: 3 (1.56%) | A3: 3 (3.3%) | A3: 3 (0.865%) | ||||||
| A4: 4 (2.94%) | A4: 14 (7.29%) | A4: 2 (2.2%) | A4: 22 (6.34%) | ||||||
| B | 4 (2.68%) | 1 (0.472%) | 1 (0.934%) | 1 (0.26%) | |||||
| C | 1 (0.671%) | 4 (1.89%) | 2 (1.87%) | 6 (1.56%) | |||||
| D | 8 (5.37%) | 16 (7.55%) | 13 (12.1%) | 30 (7.81%) | |||||
| Total | 149 (100%) | 136 (100%) | 212 (100%) | 192 (100%) | 107 (100%) | 91 (100%) | 384 (100%) | 347 (100%) | |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Gameiro, S.F.; Salnikov, M.Y.; Zeng, P.Y.F.; Barrett, J.W.; Nichols, A.C.; Mymryk, J.S. HPV16 Intratypic Variants in Head and Neck Cancers: A North American Perspective. Viruses 2023, 15, 2411. https://doi.org/10.3390/v15122411
Gameiro SF, Salnikov MY, Zeng PYF, Barrett JW, Nichols AC, Mymryk JS. HPV16 Intratypic Variants in Head and Neck Cancers: A North American Perspective. Viruses. 2023; 15(12):2411. https://doi.org/10.3390/v15122411
Chicago/Turabian StyleGameiro, Steven F., Mikhail Y. Salnikov, Peter Y. F. Zeng, John W. Barrett, Anthony C. Nichols, and Joe S. Mymryk. 2023. "HPV16 Intratypic Variants in Head and Neck Cancers: A North American Perspective" Viruses 15, no. 12: 2411. https://doi.org/10.3390/v15122411
APA StyleGameiro, S. F., Salnikov, M. Y., Zeng, P. Y. F., Barrett, J. W., Nichols, A. C., & Mymryk, J. S. (2023). HPV16 Intratypic Variants in Head and Neck Cancers: A North American Perspective. Viruses, 15(12), 2411. https://doi.org/10.3390/v15122411

