Stromal Antigen 2 Deficiency Induces Interferon Responses and Restricts Porcine Deltacoronavirus Infection
Abstract
:1. Introduction
2. Materials and Methods
2.1. Cell Culture and Viruses
2.2. Plasmids and Antibodies
2.3. Virus Infection
2.4. Transfection
2.5. CRISPR-Cas9 Knockout Cells
2.6. IFA
2.7. Western Blot
2.8. Quantitative RT-PCR
2.9. TCID50 Assay
2.10. Cell Viability Assay
2.11. Statistical Analysis
3. Results
3.1. Establishment of STAG2-Knockout IPEC-J2 Cell Line
3.2. Confirmation of STAG2 as a Critical Host Factor for VSV Infection
3.3. Confirmation of STAG2 as a Critical Host Factor for PDCoV Infection
3.4. STAG2 Is Required for PDCoV Replication
3.5. Loss of STAG2 Activates IFN and ISG Expression
3.6. STAG2 Deletion Triggers IFN Production by Activating the Levels of Phosphorylated STAT1
4. Discussion
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Jung, K.; Hu, H.; Saif, L.J. Porcine deltacoronavirus infection: Etiology, cell culture for virus isolation and propagation, molecular epidemiology and pathogenesis. Virus Res. 2016, 226, 50–59. [Google Scholar] [CrossRef] [PubMed]
- Zhou, X.; Zhou, L.; Zhang, P.; Ge, X.; Guo, X.; Han, J.; Zhang, Y.; Yang, H. A strain of porcine deltacoronavirus: Genomic characterization, pathogenicity and its full-length cDNA infectious clone. Transbound. Emerg. Dis. 2020, 68, 2130–2146. [Google Scholar] [CrossRef]
- Xu, K.; Zhou, Y.; Mu, Y.; Liu, Z.; Hou, S.; Xiong, Y.; Fang, L.; Ge, C.; Wei, Y.; Zhang, X.; et al. CD163 and pAPN double-knockout pigs are resistant to PRRSV and TGEV and exhibit decreased susceptibility to PDCoV while maintaining normal production performance. eLife 2020, 9, e57132. [Google Scholar] [CrossRef] [PubMed]
- Zhang, J.; Chen, J.; Shi, D.; Shi, H.; Zhang, X.; Liu, J.; Cao, L.; Zhu, X.; Liu, Y.; Wang, X.; et al. Porcine deltacoronavirus enters cells via two pathways: A protease-mediated one at the cell surface and another facilitated by cathepsins in the endosome. J. Biol. Chem. 2019, 294, 9830–9843. [Google Scholar] [CrossRef] [PubMed]
- Yin, L.; Chen, J.; Li, L.; Guo, S.; Xue, M.; Zhang, J.; Liu, X.; Feng, L.; Liu, P. Aminopeptidase N Expression, Not Interferon Responses, Determines the Intestinal Segmental Tropism of Porcine Deltacoronavirus. J. Virol. 2020, 94, e00480-20. [Google Scholar] [CrossRef]
- Zhu, X.; Liu, S.; Wang, X.; Luo, Z.; Shi, Y.; Wang, D.; Peng, G.; Chen, H.; Fang, L.; Xiao, S. Contribution of porcine aminopeptidase N to porcine deltacoronavirus infection. Emerg. Microbes Infect. 2018, 7, 65. [Google Scholar] [CrossRef]
- Stoian, A.; Rowland, R.R.R.; Petrovan, V.; Sheahan, M.; Samuel, M.S.; Whitworth, K.M.; Wells, K.D.; Zhang, J.; Beaton, B.; Cigan, M.; et al. The use of cells from ANPEP knockout pigs to evaluate the role of aminopeptidase N (APN) as a receptor for porcine deltacoronavirus (PDCoV). Virology 2019, 541, 136–140. [Google Scholar] [CrossRef]
- Wang, B.; Liu, Y.; Ji, C.-M.; Yang, Y.-L.; Liang, Q.-Z.; Zhao, P.; Xu, L.-D.; Lei, X.-M.; Luo, W.-T.; Qin, P.; et al. Porcine Deltacoronavirus Engages the Transmissible Gastroenteritis Virus Functional Receptor Porcine Aminopeptidase N for Infectious Cellular Entry. J. Virol. 2018, 92, e00318-18. [Google Scholar] [CrossRef]
- Lednicky, J.A.; Tagliamonte, M.S.; White, S.K.; Elbadry, M.A.; Alam, M.M.; Stephenson, C.J.; Bonny, T.S.; Loeb, J.C.; Telisma, T.; Chavannes, S.; et al. Emergence of porcine delta-coronavirus pathogenic infections among children in Haiti through independent zoonoses and convergent evolution. medRxiv 2021, 600, 133–137. [Google Scholar]
- Li, L.; Fu, F.; Xue, M.; Chen, W.; Liu, J.; Shi, H.; Chen, J.; Bu, Z.; Feng, L.; Liu, P. IFN-lambda preferably inhibits PEDV infection of porcine intestinal epithelial cells compared with IFN-alpha. Antivir. Res. 2017, 140, 76–82. [Google Scholar] [CrossRef]
- Lin, J.-D.; Feng, N.; Sen, A.; Balan, M.; Tseng, H.-C.; McElrath, C.; Smirnov, S.V.; Peng, J.; Yasukawa, L.L.; Durbin, R.K.; et al. Correction: Distinct Roles of Type I and Type III Interferons in Intestinal Immunity to Homologous and Heterologous Rotavirus Infections. PLoS Pathog. 2016, 12, e1005726. [Google Scholar] [CrossRef] [PubMed]
- Le Bon, A.; Tough, D.F. Links between innate and adaptive immunity via type I interferon. Curr. Opin. Immunol. 2002, 14, 432–436. [Google Scholar] [CrossRef]
- Fang, P.; Fang, L.; Ren, J.; Hong, Y.; Liu, X.; Zhao, Y.; Wang, D.; Peng, G.; Xiao, S. Porcine Deltacoronavirus Accessory Protein NS6 Antagonizes Interferon Beta Production by Interfering with the Binding of RIG-I/MDA5 to Double-Stranded RNA. J. Virol. 2018, 92, e00712-18. [Google Scholar] [CrossRef] [PubMed]
- Taniguchi, T.; Takaoka, A. The interferon-alpha/beta system in antiviral responses: A multimodal machinery of gene regulation by the IRF family of transcription factors. Curr. Opin. Immunol. 2002, 14, 111–116. [Google Scholar] [CrossRef]
- Perry, A.K.; Chen, G.; Zheng, D.; Tang, H.; Cheng, G. The host type I interferon response to viral and bacterial infections. Cell Res. 2005, 15, 407–422. [Google Scholar] [CrossRef]
- Schoggins, J.W.; Wilson, S.J.; Panis, M.; Murphy, M.Y.; Jones, C.T.; Bieniasz, P.; Rice, C.M. A diverse range of gene products are effectors of the type I interferon antiviral response. Nature 2011, 472, 481–485. [Google Scholar] [CrossRef]
- Guo, L.; Luo, X.; Li, R.; Xu, Y.; Zhang, J.; Ge, J.; Bu, Z.; Feng, L.; Wang, Y. Porcine Epidemic Diarrhea Virus Infection Inhibits Interferon Signaling by Targeted Degradation of STAT1. J. Virol. 2016, 90, 8281–8292. [Google Scholar] [CrossRef]
- O’Shea, J.J.; Plenge, R. JAK and STAT signaling molecules in immunoregulation and immune-mediated disease. Immunity 2012, 36, 542–550. [Google Scholar] [CrossRef]
- Peters, J.-M.; Tedeschi, A.; Schmitz, J. The cohesin complex and its roles in chromosome biology. Genes Dev. 2008, 22, 3089–3114. [Google Scholar] [CrossRef]
- Potts, P.R.; Porteus, M.H.; Yu, H. Human SMC5/6 complex promotes sister chromatid homologous recombination by recruiting the SMC1/3 cohesin complex to double-strand breaks. EMBO J. 2006, 25, 3377–3388. [Google Scholar] [CrossRef]
- Solomon, D.A.; Kim, T.; Diaz-Martinez, L.A.; Fair, J.; Elkahloun, A.G.; Harris, B.T.; Toretsky, J.A.; Rosenberg, S.A.; Shukla, N.; Ladanyi, M.; et al. Mutational inactivation of STAG2 causes aneuploidy in human cancer. Science 2011, 333, 1039–1043. [Google Scholar] [CrossRef] [PubMed]
- Zuin, J.; Dixon, J.R.; van der Reijden, M.I.J.A.; Ye, Z.; Kolovos, P.; Brouwer, R.W.W.; van de Corput, M.P.C.; van de Werken, H.J.G.; Knoch, T.A.; van Ijcken, W.F.J.; et al. Cohesin and CTCF differentially affect chromatin architecture and gene expression in human cells. Proc. Natl. Acad. Sci. USA 2013, 111, 996–1001. [Google Scholar] [CrossRef] [PubMed]
- Hill, V.K.; Kim, J.-S.; Waldman, T. Cohesin mutations in human cancer. Biochim. Biophys. Acta 2016, 1866, 1–11. [Google Scholar] [CrossRef] [PubMed]
- Kim, J.-S.; He, X.; Orr, B.; Wutz, G.; Hill, V.; Peters, J.-M.; Compton, D.A.; Waldman, T. Intact Cohesion, Anaphase, and Chromosome Segregation in Human Cells Harboring Tumor-Derived Mutations in STAG2. PLoS Genet. 2016, 12, e1005865. [Google Scholar] [CrossRef] [PubMed]
- Lara-Pezzi, E.; Pezzi, N.; Prieto, I.; Barthelemy, I.; Carreiro, C.; Martínez, A.; Maldonado-Rodríguez, A.; López-Cabrera, M.; Barbero, J.L. Evidence of a Transcriptional Co-activator Function of Cohesin STAG/SA/Scc3. J. Biol. Chem. 2004, 279, 6553–6559. [Google Scholar] [CrossRef]
- Ding, S.; Diep, J.; Feng, N.; Ren, L.; Li, B.; Ooi, Y.S.; Wang, X.; Brulois, K.F.; Yasukawa, L.L.; Li, X.; et al. STAG2 deficiency induces interferon responses via cGAS-STING pathway and restricts virus infection. Nat. Commun. 2018, 9, 1485. [Google Scholar] [CrossRef]
- Liu, F.; Li, G.; Wen, K.; Bui, T.; Cao, D.; Zhang, Y.; Yuan, L. Porcine Small Intestinal Epithelial Cell Line (IPEC-J2) of Rotavirus Infection As a New Model for the Study of Innate Immune Responses to Rotaviruses and Probiotics. Viral Immunol. 2010, 23, 135–149. [Google Scholar] [CrossRef]
- Tang, R.; Guo, L.; Fan, Q.; Zhang, L.; Wang, Y.; Zhang, X.; Shi, D.; Wu, Y.; Shi, H.; Liu, J.; et al. Porcine deltacoronavirus infection is inhibited by Griffithsin in cell culture. Vet. Microbiol. 2021, 264, 109299. [Google Scholar] [CrossRef]
- Su, M.; Li, C.; Guo, D.; Wei, S.; Wang, X.; Geng, Y.; Yao, S.; Gao, J.; Wang, E.; Zhao, X.; et al. A recombinant nucleocapsid protein-based indirect enzyme-linked immunosorbent assay to detect antibodies against porcine deltacoronavirus. J. Vet. Med. Sci. 2016, 78, 601–606. [Google Scholar] [CrossRef]
- Luo, X.; Guo, L.; Zhang, J.; Xu, Y.; Gu, W.; Feng, L.; Wang, Y. Tight Junction Protein Occludin Is a Porcine Epidemic Diarrhea Virus Entry Factor. J. Virol. 2017, 91, e00202-17. [Google Scholar] [CrossRef]
- Guo, L.; Niu, J.; Yu, H.; Gu, W.; Li, R.; Luo, X.; Huang, M.; Tian, Z.; Feng, L.; Wang, Y. Modulation of CD163 Expression by Metalloprotease ADAM17 Regulates Porcine Reproductive and Respiratory Syndrome Virus Entry. J. Virol. 2014, 88, 10448–10458. [Google Scholar] [CrossRef] [PubMed]
- Livak, K.J.; Schmittgen, T.D. Analysis of relative gene expression data using real-time quantitative PCR and the 2((-Delta Delta C(T)) Method. Methods 2001, 25, 402–408. [Google Scholar] [CrossRef] [PubMed]
- Stark, G.R.; Kerr, I.M.; Williams, B.R.G.; Silverman, R.H.; Schreiber, R.D. How cells respond to interferons. Annu. Rev. Biochem. 1998, 67, 227–264. [Google Scholar] [PubMed]
- Chathuranga, K.; Weerawardhana, A.; Dodantenna, N.; Lee, J.-S. Regulation of antiviral innate immune signaling and viral evasion following viral genome sensing. Exp. Mol. Med. 2021, 53, 1647–1668. [Google Scholar] [CrossRef] [PubMed]
- Scutigliani, E.M.; Kikkert, M. Interaction of the innate immune system with positive-strand RNA virus replication organelles. Cytokine Growth Factor Rev. 2017, 37, 17–27. [Google Scholar] [CrossRef] [PubMed]
- Zhang, S.; Wang, L.; Cheng, G. The battle between host and SARS-CoV-2: Innate immunity and viral evasion strategies. Mol. Ther. 2022, 30, 1869–1884. [Google Scholar] [CrossRef] [PubMed]
- Kasuga, Y.; Zhu, B.; Jang, K.-J.; Yoo, J.-S. Innate immune sensing of coronavirus and viral evasion strategies. Exp. Mol. Med. 2021, 53, 723–736. [Google Scholar] [CrossRef]
- Koonpaew, S.; Teeravechyan, S.; Frantz, P.N.; Chailangkarn, T.; Jongkaewwattana, A. PEDV and PDCoV Pathogenesis: The Interplay Between Host Innate Immune Responses and Porcine Enteric Coronaviruses. Front. Vet. Sci. 2019, 6, 34. [Google Scholar] [CrossRef]
- Lum, K.K.; Cristea, I.M. Host Innate Immune Response and Viral Immune Evasion During Alphaherpesvirus Infection. Curr. Issues Mol. Biol. 2022, 42, 635–686. [Google Scholar] [CrossRef]
- Bajaj, V.; Gadi, N.; Spihlman, A.P.; Wu, S.C.; Choi, C.H.; Moulton, V.R. Aging, Immunity, and COVID-19: How Age Influences the Host Immune Response to Coronavirus Infections? Front. Physiol. 2020, 11, 571416. [Google Scholar] [CrossRef]
- Shen, Z.; Wang, G.; Yang, Y.; Shi, J.; Fang, L.; Li, F.; Xiao, S.; Fu, Z.F.; Peng, G. A conserved region of nonstructural protein 1 from alphacoronaviruses inhibits host gene expression and is critical for viral virulence. J. Biol. Chem. 2019, 294, 13606–13618. [Google Scholar] [CrossRef] [PubMed]
- Jauregui, A.R.; Savalia, D.; Lowry, V.K.; Farrell, C.M.; Wathelet, M.G. Identification of residues of SARS-CoV nsp1 that differentially affect inhibition of gene expression and antiviral signaling. PLoS ONE 2013, 8, e62416. [Google Scholar] [CrossRef] [PubMed]
- Narayanan, K.; Huang, C.; Lokugamage, K.; Kamitani, W.; Ikegami, T.; Tseng, C.-T.K.; Makino, S. Severe Acute Respiratory Syndrome Coronavirus nsp1 Suppresses Host Gene Expression, Including That of Type I Interferon, in Infected Cells. J. Virol. 2008, 82, 4471–4479. [Google Scholar] [CrossRef] [PubMed]
- Wang, D.; Fang, L.; Shi, Y.; Zhang, H.; Gao, L.; Peng, G.; Chen, H.; Li, K.; Xiao, S. Porcine Epidemic Diarrhea Virus 3C-Like Protease Regulates Its Interferon Antagonism by Cleaving NEMO. J. Virol. 2015, 90, 2090–2101. [Google Scholar] [CrossRef] [PubMed]
- Zhu, X.; Fang, L.; Wang, D.; Yang, Y.; Chen, J.; Ye, X.; Foda, M.F.; Xiao, S. Porcine deltacoronavirus nsp5 inhibits interferon-beta production through the cleavage of NEMO. Virology 2017, 502, 33–38. [Google Scholar] [CrossRef]
- Zhu, X.; Wang, D.; Zhou, J.; Pan, T.; Chen, J.; Yang, Y.; Lv, M.; Ye, X.; Peng, G.; Fang, L.; et al. Porcine Deltacoronavirus nsp5 Antagonizes Type I Interferon Signaling by Cleaving STAT2. J. Virol. 2017, 91, e00003-17. [Google Scholar] [CrossRef]
- Xue, W.; Ding, C.; Qian, K.; Liao, Y. The Interplay Between Coronavirus and Type I IFN Response. Front. Microbiol. 2022, 12, 805472. [Google Scholar] [CrossRef]
- De Koninck, M.; Lapi, E.; Badía-Careaga, C.; Cossío, I.; Giménez-Llorente, D.; Rodríguez-Corsino, M.; Andrada, E.; Hidalgo, A.; Manzanares, M.; Real, F.X.; et al. Essential Roles of Cohesin STAG2 in Mouse Embryonic Development and Adult Tissue Homeostasis. Cell Rep. 2020, 32, 108014. [Google Scholar] [CrossRef]
- Surdez, D.; Zaidi, S.; Grossetête, S.; Laud-Duval, K.; Ferre, A.S.; Mous, L.; Vourc’H, T.; Tirode, F.; Pierron, G.; Raynal, V.; et al. STAG2 mutations alter CTCF-anchored loop extrusion, reduce cis-regulatory interactions and EWSR1-FLI1 activity in Ewing sarcoma. Cancer Cell 2021, 39, 810–826.e9. [Google Scholar] [CrossRef]
- Richart, L.; Lapi, E.; Pancaldi, V.; Cuenca-Ardura, M.; Pau, E.C.-D.; Madrid-Mencía, M.; Neyret-Kahn, H.; Radvanyi, F.; Rodríguez, J.A.; Cuartero, Y.; et al. STAG2 loss-of-function affects short-range genomic contacts and modulates the basal-luminal transcriptional program of bladder cancer cells. Nucleic Acids Res. 2021, 49, 11005–11021. [Google Scholar] [CrossRef]
Primer | Forward (5’→3’) | Reverse (5’→3’) |
---|---|---|
qIFNβ | CCATCTATGAGATGCTCCAG | TCCTTAGGATTTCCACTCTG |
qIFNλ1 | CCACGTCGAACTTCAGGCTT | ATGTGCAAGTCTCCACTGGT |
qIFNλ3 | CCAAGGATGCCTTTGAAGAGT | CTGCTGTGCAGGGATGAGTT |
qISG15 | ATCACCCAGAAGATCGGCG | TCGAAGGTCAGCCAGAACAG |
qISG54 | CATTGACCCTCTGAGGCAAG | AGCGTGTCCTATTAGTTCC |
qISG56 | CATACATTTCCACTATGG | TACTCCAGGGCTTCATTCA |
qOAS1 | CTAGTCAAGCACTGGTACCA | ATCACAGGCCTGGGTTTCGT |
qOASL | TCCCTGGGAAGAATGTGCAG | CCCTGGCAAGAGCATAGTGT |
qSTAT1 | CAGAACGGAGGCGAACCTTA | AGGTTCTGGGGCTTCCTTTG |
qPDCoV | AGCAACCACTCGTGTTACTTG | CAACTCTGAAACCTTGAGCTG |
qGAPDH | CCTTCCGTGTCCCTACTGCCAAC | GACGCCTGCTTCACCACCTTCT |
STAG2-sgRNA | CACCGGTTAATTGTATATACTGTGG | AAACCCACAGTATATACAATTAACC |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Wu, Y.; Zhang, H.; Chen, J.; Shi, Z.; Li, M.; Zhao, Y.; Shi, H.; Shi, D.; Guo, L.; Feng, L. Stromal Antigen 2 Deficiency Induces Interferon Responses and Restricts Porcine Deltacoronavirus Infection. Viruses 2022, 14, 1783. https://doi.org/10.3390/v14081783
Wu Y, Zhang H, Chen J, Shi Z, Li M, Zhao Y, Shi H, Shi D, Guo L, Feng L. Stromal Antigen 2 Deficiency Induces Interferon Responses and Restricts Porcine Deltacoronavirus Infection. Viruses. 2022; 14(8):1783. https://doi.org/10.3390/v14081783
Chicago/Turabian StyleWu, Yang, Hongling Zhang, Jianfei Chen, Zhaorong Shi, Mingwei Li, Ying Zhao, Hongyan Shi, Da Shi, Longjun Guo, and Li Feng. 2022. "Stromal Antigen 2 Deficiency Induces Interferon Responses and Restricts Porcine Deltacoronavirus Infection" Viruses 14, no. 8: 1783. https://doi.org/10.3390/v14081783