The Genetic Stability, Replication Kinetics and Cytopathogenicity of Recombinant Avian Coronaviruses with a T16A or an A26F Mutation within the E Protein Is Cell-Type Dependent
Abstract
1. Introduction
2. Materials and Methods
2.1. Cells and Viruses
2.2. Construction of rIBVs Containing the T16A and A26F Mutations
2.3. Full Genome Sequencing of Viral Stocks
2.4. Titration of IBV via Plaque Assay and Quantification of Plaque Size
2.5. Assessment of Viral Release
2.6. Viral Replication Kinetics Assessment In Vitro
2.7. Ciliary Activity Assessment in Ex Vivo TOCs
2.8. Viral Replication Kinetics Assessment in Ex Vivo TOCs
2.9. Virus Replication Kinetics In Ovo
2.10. Serial Passaging of rIBVs in CK Cells
2.11. Sequencing the E Gene
2.12. Imaging of Cytopathic Effects (CPE)
2.13. Cell Viability Assay
2.14. Assessment of Innate Immune Response by Real Time Quantitative PCR (qRT-PCR)
2.15. Statistical Analysis
3. Results
3.1. The Generation of rIBVs Containing Either the T16A or A26F Mutation within the E Protein
3.2. Next-Generation Sequencing Identified an Additional Mutation in One Isolate of BeauR-T16A and One Isolate of BeauR-A26F
3.3. T16 and A26 Residues within the E Protein Are Not Essential for Virus Replication In Vitro
3.4. BeauR-T16A and BeauR-A26F Exhibit Reduced Plaque Size in CK Cells
3.5. BeauR-A26F May Exhibit Impaired Viral Release within Continuous Cell Lines but Not within CK Cells
3.6. Amino Acid Residues T16 and A26 Are Not Essential for Virus Replication in Ex Vivo TOCs
3.7. Both BeauR-T16A and BeauR-A26F Generate Revertant Mutations upon Passage in CK Cells Suggesting a Preference to Retain the T16 and A26 Residues In Vitro
3.8. High Selection Pressure to Maintain E Protein Activity to Facilitate Replication In Ovo
3.9. Infection with BeauR-T16A Results in Reduced CPE in Primary CK Cells
3.10. Neither Infection with BeauR-T16A or BeauR-A26F Impacts CK Cell Viability
3.11. rIBVs Upregulate Innate Immune Factors Comparably to Parental Beau-R
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Larson, H.; Reed, S.E.; Tyrrell, D. Isolation of rhinoviruses and coronaviruses from 38 colds in adults. J. Med. Virol. 1980, 5, 221–229. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Halim, A.A.; Alsayed, B.; Embarak, S.; Yaseen, T.; Dabbous, S. Clinical characteristics and outcome of ICU admitted MERS corona virus infected patients. Egypt. J. Chest Dis. Tuberc. 2015, 65, 81–87. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Lee, N.; Hui, D.; Wu, A.; Chan, P.; Cameron, P.; Joynt, G.M.; Ahuja, A.; Yung, M.Y.; Leung, C.; To, K.; et al. A Major Outbreak of Severe Acute Respiratory Syndrome in Hong Kong. N. Engl. J. Med. 2003, 348, 1986–1994. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Wu, P.; Hao, X.; Lau, E.H.Y.; Wong, J.Y.; Leung, K.S.M.; Wu, J.T.; Cowling, B.J.; Leung, G.M. Real-time tentative assessment of the epidemiological characteristics of novel coronavirus infections in Wuhan, China, as at 22 January 2020. Eurosurveillance 2020, 25, 2000044. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Woo, P.C.Y.; Lau, S.K.P.; Lam, C.S.F.; Lau, C.C.Y.; Tsang, A.K.L.; Lau, J.H.N.; Bai, R.; Teng, J.L.L.; Tsang, C.C.C.; Wang, M.; et al. Discovery of Seven Novel Mammalian and Avian Coronaviruses in the Genus Deltacoronavirus Supports Bat Coronaviruses as the Gene Source of Alphacoronavirus and Betacoronavirus and Avian Coronaviruses as the Gene Source of Gammacoronavirus and Deltacoronavirus. J. Virol. 2012, 86, 3995–4008. [Google Scholar] [CrossRef] [Scilit]
- Chen, Q.; Gauger, P.; Stafne, M.; Thomas, J.; Arruda, P.; Burrough, E.; Madson, D.; Brodie, J.; Magstadt, D.; Derscheid, R.; et al. Pathogenicity and pathogenesis of a United States porcine deltacoronavirus cell culture isolate in 5-day-old neonatal piglets. Virology 2015, 482, 51–59. [Google Scholar] [CrossRef] [Scilit]
- Bennett, R.; Ijpelaar, J. Updated Estimates of the Costs Associated with Thirty Four Endemic Livestock Diseases in Great Britain: A Note. J. Agric. Econ. 2005, 56, 135–144. [Google Scholar] [CrossRef] [Scilit]
- Cavanagh, D. Coronavirus avian infectious bronchitis virus. Vet. Res. 2007, 38, 281–297. [Google Scholar] [CrossRef] [Scilit]
- Matthijs, M.G.R.; Van Eck, J.H.H.; Landman, W.J.M.; Stegeman, J.A. Ability of Massachusetts-type infectious bronchitis virus to increase colibacillosis susceptibility incommercial broilers: A comparison between vaccine and virulent field virus. Avian Pathol. 2003, 32, 473–481. [Google Scholar] [CrossRef] [Scilit]
- Boursnell, M.E.G.; Brown, T.D.K.; Foulds, I.J.; Green, P.F.; Tomley, F.M.; Binns, M.M. Completion of the Sequence of the Genome of the Coronavirus Avian Infectious Bronchitis Virus. J. Gen. Virol. 1987, 68, 57–77. [Google Scholar] [CrossRef] [Scilit]
- Liu, D.; Inglis, S. Association of the infectious bronchitis virus 3c protein with the virion envelope. Virology 1991, 185, 911–917. [Google Scholar] [CrossRef] [Scilit]
- Westerbeck, J.W.; Machamer, C.E. A Coronavirus E Protein Is Present in Two Distinct Pools with Different Effects on Assembly and the Secretory Pathway. J. Virol. 2015, 89, 9313–9323. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Wilson, L.; Gage, P.; Ewart, G. Hexamethylene amiloride blocks E protein ion channels and inhibits coronavirus replication. Virology 2006, 353, 294–306. [Google Scholar] [CrossRef] [Scilit]
- Fischer, F.; Stegen, C.F.; Masters, P.S.; Samsonoff, W.A. Analysis of Constructed E Gene Mutants of Mouse Hepatitis Virus Confirms a Pivotal Role for E Protein in Coronavirus Assembly. J. Virol. 1998, 72, 7885–7894. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Ye, Y.; Hogue, B.G. Role of the Coronavirus E Viroporin Protein Transmembrane Domain in Virus Assembly. J. Virol. 2007, 81, 3597–3607. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- To, J.; Surya, W.; Fung, T.S.; Li, Y.; Verdià-Bàguena, C.; Queralt-Martín, M.; Aguilella, V.; Liu, D.X.; Torres, J. Channel-Inactivating Mutations and Their Revertant Mutants in the Envelope Protein of Infectious Bronchitis Virus. J. Virol. 2017, 91. [Google Scholar] [CrossRef] [Scilit]
- Ruch, T.R.; Machamer, C.E. The Hydrophobic Domain of Infectious Bronchitis Virus E Protein Alters the Host Secretory Pathway and Is Important for Release of Infectious Virus. J. Virol. 2011, 85, 675–685. [Google Scholar] [CrossRef] [Scilit]
- Li, S.; Yuan, L.; Dai, G.; Chen, R.A.; Liu, D.X.; Fung, T.S. Regulation of the ER Stress Response by the Ion Channel Activity of the Infectious Bronchitis Coronavirus Envelope Protein Modulates Virion Release, Apoptosis, Viral Fitness, and Pathogenesis. Front. Microbiol. 2020, 10, 3022. [Google Scholar] [CrossRef] [Scilit]
- Stodola, J.K.; Dubois, G.; Le Coupanec, A.; Desforges, M.; Talbot, P.J. The OC43 human coronavirus envelope protein is critical for infectious virus production and propagation in neuronal cells and is a determinant of neurovirulence and CNS pathology. Virology 2017, 515, 134–149. [Google Scholar] [CrossRef] [Scilit]
- Nieto-Torres, J.L.; DeDiego, M.L.; Verdiá-Báguena, C.; Guardeno, J.M.J.; Regla-Nava, J.A.; Fernandez-Delgado, R.; Castaño-Rodriguez, C.; Alcaraz, A.; Torres, J.; Aguilella, V.; et al. Severe Acute Respiratory Syndrome Coronavirus Envelope Protein Ion Channel Activity Promotes Virus Fitness and Pathogenesis. PLoS Pathog. 2014, 10, e1004077. [Google Scholar] [CrossRef] [Scilit]
- Jimenez-Guardeño, J.M.; Nieto-Torres, J.L.; DeDiego, M.L.; Regla-Nava, J.A.; Fernandez-Delgado, R.; Castaño-Rodriguez, C.; Enjuanes, L. The PDZ-Binding Motif of Severe Acute Respiratory Syndrome Coronavirus Envelope Protein Is a Determinant of Viral Pathogenesis. PLoS Pathog. 2014, 10, e1004320. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Cohen, J.R.; Lin, L.D.; Machamer, C.E. Identification of a Golgi Complex-Targeting Signal in the Cytoplasmic Tail of the Severe Acute Respiratory Syndrome Coronavirus Envelope Protein. J. Virol. 2011, 85, 5794–5803. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Corse, E.; Machamer, C.E. The cytoplasmic tails of infectious bronchitis virus E and M proteins mediate their interaction. Virology 2003, 312, 25–34. [Google Scholar] [CrossRef] [Scilit]
- Carrasco, L. Modification of membrane permeability induced by animal viruses early in infection. Virology 1981, 113, 623–629. [Google Scholar] [CrossRef] [Scilit]
- Liao, Y.; Lescar, J.; Tam, J.P.; Liu, D. Expression of SARS-coronavirus envelope protein in Escherichia coli cells alters membrane permeability. Biochem. Biophys. Res. Commun. 2004, 325, 374–380. [Google Scholar] [CrossRef] [Scilit]
- Torres, J.; Maheswari, U.; Parthasarathy, K.; Ng, L.; Liu, D.X.; Gong, X. Conductance and amantadine binding of a pore formed by a lysine-flanked transmembrane domain of SARS coronavirus envelope protein. Protein Sci. 2007, 16, 2065–2071. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Ruch, T.R.; Machamer, C.E. A Single Polar Residue and Distinct Membrane Topologies Impact the Function of the Infectious Bronchitis Coronavirus E Protein. PLoS Pathog. 2012, 8, e1002674. [Google Scholar] [CrossRef] [Scilit]
- Westerbeck, J.W.; Machamer, C.E. The Infectious Bronchitis Coronavirus Envelope Protein Alters Golgi pH To Protect the Spike Protein and Promote the Release of Infectious Virus. J. Virol. 2019, 93, e00015-19. [Google Scholar] [CrossRef] [Scilit]
- Casais, R.; Thiel, V.; Siddell, S.G.; Cavanagh, D.; Britton, P. Reverse Genetics System for the Avian Coronavirus Infectious Bronchitis Virus. J. Virol. 2001, 75, 12359–12369. [Google Scholar] [CrossRef] [Scilit]
- Hennion, R.M.; Hill, G. The Preparation of Chicken Kidney Cell Cultures for Virus Propagation; Springer: Berlin/Heidelberg, Germany, 2014; Volume 1282, pp. 57–62. [Google Scholar]
- Himly, M.; Foster, D.N.; Bottoli, I.; Iacovoni, J.S.; Vogt, P.K. The DF-1 Chicken Fibroblast Cell Line: Transformation Induced by Diverse Oncogenes and Cell Death Resulting from Infection by Avian Leukosis Viruses. Virology 1998, 248, 295–304. [Google Scholar] [CrossRef] [Scilit]
- Hennion, R.M. The Preparation of Chicken Tracheal Organ Cultures for Virus Isolation, Propagation, and Titration. Coronaviruses 2015, 1282, 51–56. [Google Scholar] [CrossRef] [Scilit]
- Keep, S.; Britton, P.; Bickerton, E. Transient Dominant Selection for the Modification and Generation of Recombinant Infectious Bronchitis. Coronaviruses 2020, 2203, 147–165. [Google Scholar] [CrossRef] [Scilit]
- Keep, S.M.; Bickerton, E.; Britton, P. Partial Purification of IBV and Subsequent Isolation of Viral RNA for Next-Generation Sequencing. In Coronaviruses; Humana Press: New York, NY, USA, 2015; Volume 1282, pp. 109–112. [Google Scholar] [CrossRef] [Scilit]
- Freimanis, G.L.; Oade, M.S. Whole-Genome Sequencing Protocols for IBV and Other Coronaviruses Using High-Throughput Sequencing. In Coronaviruses; Humana Press: New York, NY, USA, 2020; Volume 2203, pp. 67–74. [Google Scholar] [CrossRef] [Scilit]
- Kint, J.; Maier, H.J.; Jagt, E. Quantification of Infectious Bronchitis Coronavirus by Titration In Vitro and In Ovo. In Coronaviruses; Humana Press: New York, NY, USA, 2015; Volume 1282, pp. 89–98. [Google Scholar] [CrossRef] [Scilit]
- Schneider, C.A.; Rasband, W.S.; Eliceiri, K.W. NIH Image to ImageJ: 25 Years of image analysis. Nat. Methods 2012, 9, 671–675. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Cavanagh, D.; Elus, M.M.; Cook, J.K.A. Relationship between sequence variation in the S1 spike protein of infectious bronchitis virus and the extent of cross-protection in vivo. Avian Pathol. 1997, 26, 63–74. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Cook, J.K.A.; Huggins, M.B.; Orbell, S.J.; Mawditt, K.; Cavanagh, D. Infectious bronchitis virus vaccine interferes with the replication of avian pneumovirus vaccine in domestic fowl. Avian Pathol. 2001, 30, 233–242. [Google Scholar] [CrossRef] [Scilit]
- Guy, J.S. Isolation and Propagation of Coronaviruses in Embryonated Eggs. Coronaviruses 2020, 2203, 107–117. [Google Scholar] [CrossRef] [Scilit]
- Riss, T.; Niles, A.; Moravec, R.; Karassina, N.; Vidugiriene, J. Cytotoxicity Assays: In Vitro Methods to Measure Dead Cells. In Assay Guidance Manual [Internet]; Markossian, S., Grossman, A., Brimacombe, K., Arkin, M., Auld, D., Austin, C., Baell, J., Chung, T.D.Y., Coussens, N.P., Dahlin, J.L., et al., Eds.; Eli Lilly & Company and the National Center for Advancing Translational Sciences: Bethesda, MD, USA, 2004. [Google Scholar]
- Batra, A.; Maier, H.J.; Fife, M.S. Selection of reference genes for gene expression analysis by real-time qPCR in avian cells infected with infectious bronchitis virus. Avian Pathol. 2016, 46, 173–180. [Google Scholar] [CrossRef] [Scilit]
- Ruch, T.R.; Machamer, C.E. The Coronavirus E Protein: Assembly and Beyond. Viruses 2012, 4, 363–382. [Google Scholar] [CrossRef] [Scilit]
- Casais, R.; Dove, B.; Cavanagh, D.; Britton, P. Recombinant Avian Infectious Bronchitis Virus Expressing a Heterologous Spike Gene Demonstrates that the Spike Protein Is a Determinant of Cell Tropism. J. Virol. 2003, 77, 9084–9089. [Google Scholar] [CrossRef] [Scilit]
- Bickerton, E.; Maier, H.J.; Stevenson-Leggett, P.; Armesto, M.; Britton, P. The S2 Subunit of Infectious Bronchitis Virus Beaudette Is a Determinant of Cellular Tropism. J. Virol. 2018, 92, e01044-18. [Google Scholar] [CrossRef] [Scilit]
- Montagnon, B.J.; Fanget, B.; Nicolas, A.J. The large-scale cultivation of VERO cells in micro-carrier culture for virus vaccine production. Preliminary results for killed poliovirus vaccine. Dev. Biol. Stand. 1981, 47, 55–64. [Google Scholar] [PubMed]
- Frazatti-Gallina, N.M.; Mourão-Fuches, R.M.; Paoli, R.L.; Silva, M.L.; Miyaki, C.; Valentini, E.J.; Raw, I.; Higashi, H.G. Vero-cell rabies vaccine produced using serum-free medium. Vaccine 2004, 23, 511–517. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Cook, J.K.A.; Darbyshire, J.H.; Peters, R.W. The use of chicken tracheal organ cultures for the isolation and assay of avian infectious bronchitis virus. Arch. Virol. 1976, 50, 109–118. [Google Scholar] [CrossRef] [Scilit]
- Keep, S.; Stevenson-Leggett, P.; Steyn, A.; Oade, M.; Webb, I.; Stuart, J.; Vervelde, L.; Britton, P.; Maier, H.; Bickerton, E. Temperature Sensitivity: A Potential Method for the Generation of Vaccines against the Avian Coronavirus Infectious Bronchitis Virus. Viruses 2020, 12, 754. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Hodgson, T.; Casais, R.; Dove, B.; Britton, P.; Cavanagh, D. Recombinant Infectious Bronchitis Coronavirus Beaudette with the Spike Protein Gene of the Pathogenic M41 Strain Remains Attenuated but Induces Protective Immunity. J. Virol. 2004, 78, 13804–13811. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Daubenmire, R.F. The use of the terms coenocyte and syncytium in biology. Science 1936, 84, 533. [Google Scholar] [CrossRef] [Scilit]
- Churchill, A.E. The use of chicken kidney tissue culture in the study of the avian viruses of newcastle disease, infectious laryngo tracheitis and infectious bronchitis. Res. Vet. Sci. 1965, 6, 162–171. [Google Scholar] [CrossRef] [Scilit]
- Amarasinghe, A.; Abdul-Cader, M.S.; Almatrouk, Z.; van der Meer, F.; Cork, S.C.; Gomis, S.; Abdul-Careem, M.F. Induction of innate host responses characterized by production of interleukin (IL)-1β and recruitment of macrophages to the respiratory tract of chickens following infection with infectious bronchitis virus (IBV). Vet. Microbiol. 2018, 215, 1–10. [Google Scholar] [CrossRef] [Scilit]
- Asif, M.; Lowenthal, J.W.; Ford, M.E.; Schat, K.A.; Kimpton, W.; Bean, A.G. Interleukin-6 Expression after Infectious Bronchitis Virus Infection in Chickens. Viral Immunol. 2007, 20, 479–486. [Google Scholar] [CrossRef] [Scilit]
- Kint, J.; Fernandez-Gutierrez, M.M.; Maier, H.J.; Britton, P.; Langereis, M.A.; Koumans, J.; Wiegertjes, G.F.; Forlenza, M. Activation of the Chicken Type I Interferon Response by Infectious Bronchitis Coronavirus. J. Virol. 2015, 89, 1156–1167. [Google Scholar] [CrossRef] [Scilit]
- Yang, X.; Li, J.; Liu, H.; Zhang, P.; Chen, D.; Men, S.; Li, X.; Wang, H. Induction of innate immune response following introduction of infectious bronchitis virus (IBV) in the trachea and renal tissues of chickens. Microb. Pathog. 2018, 116, 54–61. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Davidson, A.D.; Williamson, M.K.; Lewis, S.; Shoemark, D.; Carroll, M.W.; Heesom, K.J.; Zambon, M.; Ellis, J.; Lewis, P.A.; Hiscox, J.A.; et al. Characterisation of the transcriptome and proteome of SARS-CoV-2 reveals a cell passage induced in-frame deletion of the furin-like cleavage site from the spike glycoprotein. Genome Med. 2020, 12, 1–15. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Cifuentes-Muñoz, N.; Dutch, R.E.; Cattaneo, R. Direct cell-to-cell transmission of respiratory viruses: The fast lanes. PLoS Pathog. 2018, 14, e1007015. [Google Scholar] [CrossRef] [Scilit]
- Desmyter, J.; Melnick, J.L.; Rawls, W.E. Defectiveness of Interferon Production and of Rubella Virus Interference in a Line of African Green Monkey Kidney Cells (Vero). J. Virol. 1968, 2, 955–961. [Google Scholar] [CrossRef] [Scilit]
- Schilling, M.A.; Katani, R.; Memari, S.; Cavanaugh, M.; Buza, J.; Radzio-Basu, J.; Mpenda, F.N.; Deist, M.S.; Lamont, S.J.; Kapur, V. Transcriptional Innate Immune Response of the Developing Chicken Embryo to Newcastle Disease Virus Infection. Front. Genet. 2018, 9, 61. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Davison, T. The immunologists’ debt to the chicken. Br. Poult. Sci. 2003, 44, 6–21. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Maier, H.J.; Cottam, E.M.; Stevenson-Leggett, P.; Wilkinson, J.A.; Harte, C.J.; Wileman, T.; Britton, P. Visualizing the autophagy pathway in avian cells and its application to studying infectious bronchitis virus. Autophagy 2013, 9, 496–509. [Google Scholar] [CrossRef] [Scilit]










| Gene | Sequence (5′ to 3′) | |
|---|---|---|
| E gene | Forward | GGTAGAGCACTTCAAGCATTT |
| Reverse | CCGGATTGTTAAGTTTTCTACC | |
| Probe | CCAGGAGCTAAGGGTACAGCCT | |
| β-Actin | Forward | GCATACAGATCCTTACGGATATCCA |
| Reverse | CAGGTCATCACCATTGGCAAT | |
| Probe | CACAGGACTCCATACCCAAGAAAGATGGC | |
| IL-6 | Forward | GCTCGCCGGCTTCGA |
| Reverse | GGTAGGTCTGAAAGGCGAACAG | |
| Probe | AGGAGAAATGCCTGACGAAGCTCTCCA | |
| IL-1B | Forward | GCTCTACATGTCGTGTGTGATGAG |
| Reverse | TGTCGATGTCCCGCATGA | |
| Probe | CCACACTGCAGCTGGAGGAAGCC | |
| IFN-A | Forward | GACAGCCAACGCCAAAGC |
| Reverse | GTCGCTGCTGTCCAAGCATT | |
| Probe | CTCAACCGGATCCACCGCTACACC | |
| IFN-B | Forward | CCTCCAACACCTCTTCAACATG |
| Reverse | TGGCGTGTGCGGTCAAT | |
| Probe | TTAGCAGCCCACACACTCCAAAACACTG |
| rIBV | Isolate | Position | Ref. nt | Alt. nt | Depth | Freq. (%) | Aa | Gene |
|---|---|---|---|---|---|---|---|---|
| BeauR-T16A | 1 | 24246 | A | G | 22067 | 87.3023 | T16A | E |
| 2 | 13658 | T | C | 528 | 92.803 | Y451Y | Nsp12 | |
| 24246 | A | G | 16849 | 93.0382 | T16A | E | ||
| 3 | 24246 | A | G | 18270 | 94.4773 | T16A | E | |
| BeauR-A26F | 1 | 24276 | G | T | 8184 | 99.6823 | A26F | E |
| 24277 | C | T | 8052 | 99.6398 | A26F | E | ||
| 24278 | A | T | 8071 | 99.5787 | A26F | E | ||
| 2 | 2628 | T | C | 464 | 54.9569 | C29C | Nsp3 | |
| 24276 | G | T | 20386 | 99.6566 | A26F | E | ||
| 24277 | C | T | 20457 | 99.6432 | A26F | E | ||
| 24278 | A | T | 20603 | 99.6408 | A26F | E | ||
| 3 | 24276 | G | T | 18670 | 99.6358 | A26F | E | |
| 24277 | C | T | 18857 | 99.6288 | A26F | E | ||
| 24278 | A | T | 18639 | 99.6083 | A26F | E |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Webb, I.; Keep, S.; Littolff, K.; Stuart, J.; Freimanis, G.; Britton, P.; Davidson, A.D.; Maier, H.J.; Bickerton, E. The Genetic Stability, Replication Kinetics and Cytopathogenicity of Recombinant Avian Coronaviruses with a T16A or an A26F Mutation within the E Protein Is Cell-Type Dependent. Viruses 2022, 14, 1784. https://doi.org/10.3390/v14081784
Webb I, Keep S, Littolff K, Stuart J, Freimanis G, Britton P, Davidson AD, Maier HJ, Bickerton E. The Genetic Stability, Replication Kinetics and Cytopathogenicity of Recombinant Avian Coronaviruses with a T16A or an A26F Mutation within the E Protein Is Cell-Type Dependent. Viruses. 2022; 14(8):1784. https://doi.org/10.3390/v14081784
Chicago/Turabian StyleWebb, Isobel, Sarah Keep, Kieran Littolff, Jamie Stuart, Graham Freimanis, Paul Britton, Andrew D. Davidson, Helena J. Maier, and Erica Bickerton. 2022. "The Genetic Stability, Replication Kinetics and Cytopathogenicity of Recombinant Avian Coronaviruses with a T16A or an A26F Mutation within the E Protein Is Cell-Type Dependent" Viruses 14, no. 8: 1784. https://doi.org/10.3390/v14081784
APA StyleWebb, I., Keep, S., Littolff, K., Stuart, J., Freimanis, G., Britton, P., Davidson, A. D., Maier, H. J., & Bickerton, E. (2022). The Genetic Stability, Replication Kinetics and Cytopathogenicity of Recombinant Avian Coronaviruses with a T16A or an A26F Mutation within the E Protein Is Cell-Type Dependent. Viruses, 14(8), 1784. https://doi.org/10.3390/v14081784

