Construction of Attenuated Strains for Red-Spotted Grouper Nervous Necrosis Virus (RGNNV) via Reverse Genetic System
Abstract
1. Introduction
2. Materials and Methods
2.1. Cells and Virus
2.2. Antibodies and Reagents
2.3. Construction of RNA1 and RNA2 Expression Plasmids
2.4. In Vitro Site-Directed Mutagenesis
2.5. Reverse Genetics
2.6. Virus Infection, Titration and Kinetics of Viral Replication Assays
2.7. RNA Extraction, RT-PCR and RT-qPCR Assays
2.8. Western Blotting Assay
2.9. Immunofluorescence Assay
2.10. Cytopathic Effect Measurement and Expression Analysis on Endo-G and Mx1
2.11. Zebrafish Experiment
2.12. Statistics Analysis
3. Results
3.1. Construction of the Recombinant RGNNV (rRGNNV) Virus
3.2. Construction of the Recombinant RGNNV-B2-M1 (rRGNNV-B2-M1) and RGNNV-B2-M2 (rRGNNV-B2-M2) Viruses
3.3. rRGNNV-B2-M1 and rRGNNV-B2-M2 Viruses Were Attenuated to SSN-1 Cells Than Wild-Type RGNNV
3.4. rRGNNV-B2-M1 and rRGNNV-B2-M2 Viruses Were Attenuated to Zebrafish Than Wild-Type RGNNV
4. Discussion
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Liu, X.D.; Huang, J.N.; Weng, S.P.; Hu, X.Q.; Chen, W.J.; Qin, Z.D.; Dong, X.X.; Liu, X.L.; Zhou, Y.; Asim, M.; et al. Infections of nervous necrosis virus in wild and cage-reared marine fish from South China Sea with unexpected wide host ranges. J. Fish Dis. 2015, 38, 533–540. [Google Scholar] [CrossRef] [PubMed]
- Munday, B.L.; Kwang, J.; Moody, N.J. Betanodavirus infections of teleost fish: A review. J. Fish Dis. 2002, 25, 127–142. [Google Scholar] [CrossRef]
- Bandín, I.; Souto, S. Betanodavirus and VER Disease: A 30-year Research Review. Pathogens 2020, 9, 106. [Google Scholar] [CrossRef] [PubMed]
- Lin, L.; He, J.; Mori, K.-i.; Nishioka, T.; Wu, J.; Weng, S.; Mushiake, K.; Arimoto, M.; Nakai, T. Mass mortalities associated with viral nervous necrosis in hatchery-reared groupers in the People’s Republic of China. Fish Pathol. 2001, 36, 186–188. [Google Scholar] [CrossRef]
- Chi, S.; Lo, B.J.; Lin, S. Characterization of grouper nervous necrosis virus GNNV. J. Fish Dis. 2001, 24, 3–13. [Google Scholar] [CrossRef]
- Chi, S.C.; Lo, C.F.; Kou, G.H.; Chang, P.S.; Peng, S.E.; Chen, S.N. Mass mortalities associated with viral nervous necrosis (VNN) disease in two species of hatchery-reared grouper, Epinephelus fuscogutatus and Epinephelus akaara (Temminck & Schlegel). J. Fish Dis. 1997, 20, 185–193. [Google Scholar]
- Nagai, T.; Nishizawa, T. Sequence of the non-structural protein gene encoded by RNA1 of striped jack nervous necrosis virus. J. Gen. Virol. 1999, 80 Pt 11, 3019–3022. [Google Scholar] [CrossRef]
- Tan, C.; Huang, B.; Chang, S.F.; Ngoh, G.H.; Munday, B.; Chen, S.C.; Kwang, J. Determination of the complete nucleotide sequences of RNA1 and RNA2 from greasy grouper (Epinephelus tauvina) nervous necrosis virus, Singapore strain. J. Gen. Virol. 2001, 82 Pt 3, 647–653. [Google Scholar] [CrossRef]
- Fenner, B.J.; Thiagarajan, R.; Chua, H.K.; Kwang, J. Betanodavirus B2 is an RNA interference antagonist that facilitates intracellular viral RNA accumulation. J. Virol. 2006, 80, 85–94. [Google Scholar] [CrossRef]
- Su, Y.C.; Chiu, H.W.; Hung, J.C.; Hong, J.R. Beta-nodavirus B2 protein induces hydrogen peroxide production, leading to Drp1-recruited mitochondrial fragmentation and cell death via mitochondrial targeting. Apoptosis Int. J. Program. Cell Death 2014, 19, 1457–1470. [Google Scholar] [CrossRef]
- Ou, M.-C.; Chen, Y.-M.; Jeng, M.-F.; Chu, C.-J.; Yang, H.-L.; Chen, T.-Y. Identification of critical residues in nervous necrosis virus B2 for dsRNA-binding and RNAi-inhibiting activity through by bioinformatic analysis and mutagenesis. Biochem. Biophys. Res. Commun. 2007, 361, 634–640. [Google Scholar] [CrossRef] [PubMed]
- Chao, J.A.; Lee, J.H.; Chapados, B.R.; Debler, E.W.; Schneemann, A.; Williamson, J.R. Dual modes of RNA-silencing suppression by Flock House virus protein B2. Nat. Struct. Mol. Biol. 2005, 12, 952–957. [Google Scholar] [CrossRef] [PubMed]
- Costa, J.Z.; Thompson, K.D. Understanding the interaction between Betanodavirus and its host for the development of prophylactic measures for viral encephalopathy and retinopathy. Fish Shellfish. Immunol. 2016, 53, 35–49. [Google Scholar] [CrossRef] [PubMed]
- Chen, Y.-M.; Wang, T.-Y.; Chen, T.-Y. Immunity to betanodavirus infections of marine fish. Dev. Comp. Immunol. 2014, 43, 174–183. [Google Scholar] [CrossRef]
- Chen, W.; Yi, L.; Feng, S.; Liu, X.; Asim, M.; Zhou, Y.; Lan, J.; Jiang, S.; Tu, J.; Lin, L. Transcriptomic profiles of striped snakehead fish cells (SSN-1) infected with red-spotted grouper nervous necrosis virus (RGNNV) with an emphasis on apoptosis pathway. Fish Shellfish. Immunol. 2017, 60, 346–354. [Google Scholar] [CrossRef]
- Bello-Perez, M.; Falco, A.; Medina-Gali, R.; Pereiro, P.; Encinar, J.A.; Novoa, B.; Perez, L.; Coll, J. Neutralization of viral infectivity by zebrafish c-reactive protein isoforms. Mol. Immunology 2017, 91, 145–155. [Google Scholar] [CrossRef]
- Bello-Perez, M.; Pereiro, P.; Coll, J.; Novoa, B.; Perez, L.; Falco, A. Zebrafish C-reactive protein isoforms inhibit SVCV replication by blocking autophagy through interactions with cell membrane cholesterol. Sci. Report 2020, 10, 566. [Google Scholar] [CrossRef]
- Nakahira, Y.; Mizuno, K.; Yamashita, H.; Tsuchikura, M.; Takeuchi, K.; Shiina, T.; Kawakami, H. Mass Production of Virus-Like Particles Using Chloroplast Genetic Engineering for Highly Immunogenic Oral Vaccine Against Fish Disease. Front. Plant Sci. 2021, 12, 717952. [Google Scholar] [CrossRef]
- Pascoli, F.; Guazzo, A.; Buratin, A.; Toson, M.; Buonocore, F.; Scapigliati, G.; Toffan, A. Lack of in vivo cross-protection of two different betanodavirus species RGNNV and SJNNV in European sea bass Dicentrachus labrax. Fish Shellfish. Immunol. 2019, 85, 85–89. [Google Scholar] [CrossRef]
- Luu, V.-T.; Moon, H.Y.; Hwang, J.Y.; Kang, B.-K.; Kang, H.A. Development of recombinant Yarrowia lipolytica producing virus-like particles of a fish nervous necrosis virus. J. Microbiol. 2017, 55, 655–664. [Google Scholar] [CrossRef]
- Cho, S.Y.; Kim, H.J.; Lan, N.T.; Han, H.-J.; Lee, D.-C.; Hwang, J.Y.; Kwon, M.-G.; Kang, B.K.; Han, S.Y.; Moon, H.; et al. Oral vaccination through voluntary consumption of the convict grouper Epinephelus septemfasciatus with yeast producing the capsid protein of red-spotted grouper nervous necrosis virus. Vet. Microbiol. 2017, 204, 159–164. [Google Scholar] [CrossRef]
- Wi, G.R.; Hwang, J.Y.; Kwon, M.-G.; Kim, H.J.; Kang, H.A.; Kim, H.-J. Protective immunity against nervous necrosis virus in convict grouper Epinephelus septemfasciatus following vaccination with virus-like particles produced in yeast Saccharomyces cerevisiae. Vet. Microbiol. 2015, 177, 214–218. [Google Scholar] [CrossRef]
- Fang, X.; Qi, B.; Ma, Y.; Zhou, X.; Zhang, S.; Sun, T. Assessment of a novel recombinant vesicular stomatitis virus with triple mutations in its matrix protein as a vaccine for pigs. Vaccine 2015, 33, 6268–6276. [Google Scholar] [CrossRef]
- Nakagawa, K.; Kobayashi, Y.; Ito, N.; Suzuki, Y.; Okada, K.; Makino, M.; Goto, H.; Takahashi, T.; Sugiyama, M. Molecular Function Analysis of Rabies Virus RNA Polymerase L Protein by Using an L Gene-Deficient Virus. J. Virol. 2017, 91, e00826-e17. [Google Scholar] [CrossRef]
- Schnell, M.J.; Mebatsion, T.; Conzelmann, K.K. Infectious rabies viruses from cloned cDNA. EMBO J. 1994, 13, 4195–4203. [Google Scholar] [CrossRef]
- Ammayappan, A.; Kurath, G.; Thompson, T.M.; Vakharia, V.N. A reverse genetics system for the Great Lakes strain of viral hemorrhagic septicemia virus: The NV gene is required for pathogenicity. Mar. Biotechnol. 2011, 13, 672–683. [Google Scholar] [CrossRef]
- Ammayappan, A.; Lapatra, S.E.; Vakharia, V.N. A vaccinia-virus-free reverse genetics system for infectious hematopoietic necrosis virus. J. Virol. Methods 2010, 167, 132–139. [Google Scholar] [CrossRef]
- Moriette, C.; Leberre, M.; Lamoureux, A.; Lai, T.-L.; Brémont, M. Recovery of a recombinant salmonid alphavirus fully attenuated and protective for rainbow trout. J. Virol. 2006, 80, 4088–4098. [Google Scholar] [CrossRef]
- Feng, S.; Su, J.; Lin, L.; Tu, J. Development of a reverse genetics system for snakehead vesiculovirus (SHVV). Virology 2019, 526, 32–37. [Google Scholar] [CrossRef]
- Ball, L.A.; Amann, J.M.; Garrett, B.K. Replication of nodamura virus after transfection of viral RNA into mammalian cells in culture. J. Virol. 1992, 66, 2326–2334. [Google Scholar] [CrossRef]
- Dasmahapatra, B.; Dasgupta, R.; Saunders, K.; Selling, B.; Gallagher, T.; Kaesberg, P. Infectious RNA derived by transcription from cloned cDNA copies of the genomic RNA of an insect virus. Proc. Natl. Acad. Sci. USA 1986, 83, 63–66. [Google Scholar] [CrossRef]
- Johnson, K.N.; Zeddam, J.L.; Ball, L.A. Characterization and construction of functional cDNA clones of Pariacoto virus, the first Alphanodavirus isolated outside Australasia. J. Virol. 2000, 74, 5123–5132. [Google Scholar] [CrossRef]
- Iwamoto, T.; Mise, K.; Mori, K.-I.; Arimoto, M.; Nakai, T.; Okuno, T. Establishment of an infectious RNA transcription system for striped jack nervous necrosis virus, the type species of the betanodaviruses. J. Gen. Virol. 2001, 82 Pt 11, 2653–2662. [Google Scholar] [CrossRef]
- Takizawa, N.; Adachi, K.; Kobayashi, N. Establishment of reverse genetics system of betanodavirus for the efficient recovery of infectious particles. J. Virol. Methods 2008, 151, 271–276. [Google Scholar] [CrossRef]
- Moreno, P.; Souto, S.; Leiva-Rebollo, R.; Borrego, J.J.; Bandín, I.; Alonso, M.C. Capsid amino acids at positions 247 and 270 are involved in the virulence of betanodaviruses to European sea bass. Sci. Rep. 2019, 9, 14068. [Google Scholar] [CrossRef]
- Souto, S.; Mérour, E.; Biacchesi, S.; Brémont, M.; Olveira, J.G.; Bandín, I. In vitro and in vivo characterization of molecular determinants of virulence in reassortant betanodavirus. J. Gen. Virol. 2015, 96 Pt 6, 1287–1296. [Google Scholar] [CrossRef]
- Souto, S.; Olveira, J.G.; Vázquez-Salgado, L.; Dopazo, C.P.; Bandín, I. Betanodavirus infection in primary neuron cultures from sole. Vet. Res. 2018, 49, 86. [Google Scholar] [CrossRef]
- Osakada, F.; Mori, T.; Cetin, A.H.; Marshel, J.H.; Virgen, B.; Callaway, E.M. New rabies virus variants for monitoring and manipulating activity and gene expression in defined neural circuits. Neuron 2011, 71, 617–631. [Google Scholar] [CrossRef]
- Livak, K.J.; Schmittgen, T.D. Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)). Method. Methods 2001, 25, 402–408. [Google Scholar] [CrossRef]
- Schmittgen, T.D.; Livak, K.J. Analyzing real-time PCR data by the comparative C(T) method. Nat. Protoc. 2008, 3, 1101–1108. [Google Scholar] [CrossRef]
- Gutzman, J.H.; Sive, H. Zebrafish brain ventricle injection. J. Vis. Exp. JoVE 2009, 26, e1218. [Google Scholar] [CrossRef] [PubMed]
- Vladimirov, N.; Mu, Y.; Kawashima, T.; Bennett, D.V.; Yang, C.T.; Looger, L.L.; Keller, P.J.; Freeman, J.; Ahrens, M.B. Light-sheet functional imaging in fictively behaving zebrafish. Nat. Methods 2014, 11, 883–884. [Google Scholar] [CrossRef] [PubMed]
- Eckerle, L.D.; Albariño, C.G.; Ball, L.A. Flock House virus subgenomic RNA3 is replicated and its replication correlates with transactivation of RNA2. Virology 2003, 317. [Google Scholar]
- Ma, J.; Bruce, T.J.; Jones, E.M.; Cain, K.D. A Review of Fish Vaccine Development Strategies: Conventional Methods and Modern Biotechnological Approaches. Microorganisms 2019, 7, 569. [Google Scholar] [CrossRef]
- Cárdenas, C.; Guzmán, F.; Carmona, M.; Muñoz, C.; Nilo, L.; Labra, A.; Marshall, S.H. Synthetic Peptides as a Promising Alternative to Control Viral Infections in Atlantic Salmon. Pathogens 2020, 9, 600. [Google Scholar] [CrossRef]
- Zeng, R.; Pan, W.; Lin, Y.; He, J.; Luo, Z.; Li, Z.; Weng, S.; He, J.; Guo, C. Development of a gene-deleted live attenuated candidate vaccine against fish virus (ISKNV) with low pathogenicity and high protection. iScience 2021, 24, 102750. [Google Scholar] [CrossRef]
- Krafcikova, P.; Silhan, J.; Nencka, R.; Boura, E. Structural analysis of the SARS-CoV-2 methyltransferase complex involved in RNA cap creation bound to sinefungin. Nat. Commun. 2020, 11, 3717. [Google Scholar] [CrossRef]
- Lu, M.; Zhang, Z.; Xue, M.; Zhao, B.S.; Harder, O.; Li, A.; Liang, X.; Gao, T.Z.; Xu, Y.; Zhou, J.; et al. N6-methyladenosine modification enables viral RNA to escape recognition by RNA sensor RIG-I. Nat. Microbiol. 2020, 5, 584–598. [Google Scholar] [CrossRef]
- Gonzales-van Horn, S.R.; Sarnow, P. Making the Mark: The Role of Adenosine Modifications in the Life Cycle of RNA Viruses. Cell Host Microbe 2017, 21, 661–669. [Google Scholar] [CrossRef]
- Hyde, J.L.; Diamond, M.S. Innate immune restriction and antagonism of viral RNA lacking 2׳-O methylation. Virology 2015, 479–480, 66–74. [Google Scholar] [CrossRef]
- Hirrlinger, J.; Scheller, A.; Hirrlinger, P.G.; Kellert, B.; Tang, W.; Wehr, M.C.; Goebbels, S.; Reichenbach, A.; Sprengel, R.; Rossner, M.J.; et al. Split-cre complementation indicates coincident activity of different genes in vivo. PLoS ONE 2009, 4, e4286. [Google Scholar] [CrossRef]




| Primer | Sequence (5′-3′) |
|---|---|
| RdRp-RT-F | cagccaagtactgtgtccggagag |
| RdRp-RT-R | caggtttgaacggcaagttgc |
| Cp-RT-F | cgtgtcagtgctgtgtcgct |
| Cp-RT-R | cgagtcaaccctggtgcaga |
| qPCR-Mx1-F | gttcatcacaagacaagaaaccatc |
| qPCR-Mx1-R | cacctcctgtgccatcttca |
| qPCR-EndoG-F | gcttcccgtctctgtctcac |
| qPCR-EndoG-R | cctccttaaagtcgcacagc |
| qPCR-18S-F | gacggacgaaagcgaaagcatt |
| qPCR-18S-R | agttggcatcgtttatggtcgg |
| qPCR-Cp-F | tgacgcacctgtgtctaagg |
| qPCR-Cp-R | acagcgtatcgctggaagat |
| qPCR-CRP-F | tcgatagggaggtcatcctg |
| qPCR-CRP-R | gacgcacaggtgagtctgaa |
| qPCR-TNF-α-F | gcgcttttctgaatcctacg |
| qPCR-TNF-α-R | tgcccagtctgtctccttct |
| qPCR-actin-F | atggatgaggaaatcgctg |
| qPCR-actin-R | atgccaaccatcactccctg |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Lei, Y.; Xiong, Y.; Tao, D.; Wang, T.; Chen, T.; Du, X.; Cao, G.; Tu, J.; Dai, J. Construction of Attenuated Strains for Red-Spotted Grouper Nervous Necrosis Virus (RGNNV) via Reverse Genetic System. Viruses 2022, 14, 1737. https://doi.org/10.3390/v14081737
Lei Y, Xiong Y, Tao D, Wang T, Chen T, Du X, Cao G, Tu J, Dai J. Construction of Attenuated Strains for Red-Spotted Grouper Nervous Necrosis Virus (RGNNV) via Reverse Genetic System. Viruses. 2022; 14(8):1737. https://doi.org/10.3390/v14081737
Chicago/Turabian StyleLei, Yingying, Yu Xiong, Dagang Tao, Tao Wang, Tianlun Chen, Xufei Du, Gang Cao, Jiagang Tu, and Jinxia Dai. 2022. "Construction of Attenuated Strains for Red-Spotted Grouper Nervous Necrosis Virus (RGNNV) via Reverse Genetic System" Viruses 14, no. 8: 1737. https://doi.org/10.3390/v14081737
APA StyleLei, Y., Xiong, Y., Tao, D., Wang, T., Chen, T., Du, X., Cao, G., Tu, J., & Dai, J. (2022). Construction of Attenuated Strains for Red-Spotted Grouper Nervous Necrosis Virus (RGNNV) via Reverse Genetic System. Viruses, 14(8), 1737. https://doi.org/10.3390/v14081737

