A Novel Recombinant FAdV-4 Virus with Fiber of FAdV-8b Provides Efficient Protection against Both FAdV-4 and FAdV-8b
Abstract
:1. Introduction
2. Materials and Methods
2.1. Cells, Viruses, Antibodies and Plasmids
2.2. Construction of sgRNA and Donor Plasmids
2.3. Generation of the Recombinant FA4-F8b
2.4. Identification the Stability and Growth Properties of the FA4-F8b in LMH Cells
2.5. Western Blot Assay
2.6. IFA
2.7. Pathogenicity of the Recombinant FA4-F8b in SPF Chickens
2.8. Preparation of Inactivated FA4-F8b Vaccine
2.9. Immunization and Challenge
2.10. Virus Neutralization Test (VNT)
2.11. Titration of Viral Titer in Organs and Cloacal Swabs
2.12. Statistical Analysis
3. Results
3.1. Generation of a Recombinant Virus FA4-F8b Expressing the Fiber of FAdV-8b
3.2. FA4-F8b Replicated Efficiently In Vitro and Was Highly Pathogenic In Vivo
3.3. Inactivated FA4-F8b Induced Efficiently Neutralizing Antibodies
3.4. Inactivated FA4-F8b Provides Efficient Protection against Both FAdV-8b and FAdV-4
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Data Availability Statement
Conflicts of Interest
References
- Harrach, B.; Benko, M. Phylogenetic analysis of adenovirus sequences. Methods Mol. Med. 2007, 131, 299–334. [Google Scholar] [PubMed]
- Asthana, M.; Chandra, R.; Kumar, R. Hydropericardium syndrome: Current state and future developments. Arch. Virol. 2013, 158, 921–931. [Google Scholar] [CrossRef] [PubMed]
- Balamurugan, V.; Kataria, J.M. The hydropericardium syndrome in poultry—A current scenario. Vet. Res. Commun. 2004, 28, 127–148. [Google Scholar] [CrossRef] [PubMed]
- Hess, M. Detection and differentiation of avian adenoviruses: A review. Avian Pathol. 2000, 29, 195–206. [Google Scholar] [CrossRef] [PubMed]
- Mase, M.; Hiramatsu, K.; Nishijima, N.; Iguchi, H.; Honda, S.; Hanyu, S.; Iseki, H.; Watanabe, S. Fowl Adenoviruses Type 8b Isolated from Chickens with Inclusion Body Hepatitis in Japan. Avian Dis. 2020, 64, 330–334. [Google Scholar] [CrossRef]
- Wells, R.J.; Harrigan, K. A fatal adenovirus infection of broiler chickens: Inclusion body hepatitis. Vet. Rec. 1974, 94, 481–482. [Google Scholar] [CrossRef]
- Ye, J.; Liang, G.; Zhang, J.; Wang, W.; Song, N.; Wang, P.; Zheng, W.; Xie, Q.; Shao, H.; Wan, Z.; et al. Outbreaks of serotype 4 fowl adenovirus with novel genotype, China. Emerg. Microbes Infect. 2016, 5, e50. [Google Scholar] [CrossRef]
- Pan, Q.; Liu, L.; Gao, Y.; Liu, C.; Qi, X.; Zhang, Y.; Wang, Y.; Li, K.; Gao, L.; Wang, X.; et al. Characterization of a hypervirulent fowl adenovirus 4 with the novel genotype newly prevalent in China and establishment of reproduction infection model of hydropericardium syndrome in chickens. Poult. Sci. 2017, 96, 1581–1588. [Google Scholar] [CrossRef]
- Mase, M.; Nakamura, K.; Minami, F. Fowl adenoviruses isolated from chickens with inclusion body hepatitis in Japan, 2009-2010. J. Vet. Med. Sci. 2012, 74, 1087–1089. [Google Scholar] [CrossRef] [Green Version]
- Lu, H.; Shao, H.; Chen, H.; Zhang, J.; Wang, W.; Li, T.; Xie, Q.; Qin, A.; Ye, J. Identification of novel B cell epitopes in the fiber protein of serotype 8 Fowl adenovirus. AMB Express 2019, 9, 172. [Google Scholar] [CrossRef]
- Pan, Q.; Yang, Y.; Gao, Y.; Qi, X.; Liu, C.; Zhang, Y.; Cui, H.; Wang, X. An Inactivated Novel Genotype Fowl Adenovirus 4 Protects Chickens against the Hydropericardium Syndrome That Recently Emerged in China. Viruses 2017, 9, 216. [Google Scholar] [CrossRef] [PubMed]
- Gupta, A.; Ahmed, K.A.; Ayalew, L.E.; Popowich, S.; Kurukulasuriya, S.; Goonewardene, K.; Gunawardana, T.; Karunarathna, R.; Ojkic, D.; Tikoo, S.K.; et al. Immunogenicity and protective efficacy of virus-like particles and recombinant fiber proteins in broiler-breeder vaccination against fowl adenovirus (FAdV)-8b. Vaccine 2017, 35, 2716–2722. [Google Scholar] [CrossRef] [PubMed]
- Meng, K.; Yuan, X.; Yu, J.; Zhang, Y.; Ai, W.; Wang, Y. Identification, Pathogenicity of Novel Fowl Adenovirus Serotype 4 SDJN0105 in Shandong, China and Immunoprotective Evaluation of the Newly Developed Inactivated Oil-emulsion FAdV-4 Vaccine. Viruses 2019, 11, 627. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Li, P.H.; Zheng, P.P.; Zhang, T.F.; Wen, G.Y.; Shao, H.B.; Luo, Q.P. Fowl adenovirus serotype 4: Epidemiology, pathogenesis, diagnostic detection, and vaccine strategies. Poult. Sci. 2017, 96, 2630–2640. [Google Scholar] [CrossRef] [PubMed]
- Shah, M.S.; Ashraf, A.; Khan, M.I.; Rahman, M.; Habib, M.; Chughtai, M.I.; Qureshi, J.A. Fowl adenovirus: History, emergence, biology and development of a vaccine against hydropericardium syndrome. Arch. Virol. 2017, 162, 1833–1843. [Google Scholar] [CrossRef] [PubMed]
- Schachner, A.; Matos, M.; Grafl, B.; Hess, M. Fowl adenovirus-induced diseases and strategies for their control—A review on the current global situation. Avian Pathol. 2018, 47, 111–126. [Google Scholar] [CrossRef]
- De Luca, C.; Schachner, A.; Mitra, T.; Heidl, S.; Liebhart, D.; Hess, M. Fowl adenovirus (FAdV) fiber-based vaccine against inclusion body hepatitis (IBH) provides type-specific protection guided by humoral immunity and regulation of B and T cell response. Vet. Res. 2020, 51, 143. [Google Scholar] [CrossRef]
- Fingerut, E.; Gutter, B.; Gallili, G.; Michael, A.; Pitcovski, J. A subunit vaccine against the adenovirus egg-drop syndrome using part of its fiber protein. Vaccine 2003, 21, 2761–2766. [Google Scholar] [CrossRef]
- Pitcovski, J.; Fingerut, E.; Gallili, G.; Eliahu, D.; Finger, A.; Gutter, B. A subunit vaccine against hemorrhagic enteritis adenovirus. Vaccine 2005, 23, 4697–4702. [Google Scholar] [CrossRef]
- Xie, Q.; Cao, S.; Zhang, W.; Wang, W.; Li, L.; Kan, Q.; Fu, H.; Geng, T.; Li, T.; Wan, Z.; et al. A novel fiber-2-edited live attenuated vaccine candidate against the highly pathogenic serotype 4 fowl adenovirus. Vet. Res. 2021, 52, 35. [Google Scholar] [CrossRef]
- Doudna, J.A.; Charpentier, E. Genome editing. The new frontier of genome engineering with CRISPR-Cas9. Science 2014, 346, 1258096. [Google Scholar] [CrossRef] [PubMed]
- Ran, F.A.; Hsu, P.D.; Wright, J.; Agarwala, V.; Scott, D.A.; Zhang, F. Genome engineering using the CRISPR-Cas9 system. Nat. Protoc. 2013, 8, 2281–2308. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Schachner, A.; Marek, A.; Jaskulska, B.; Bilic, I.; Hess, M. Recombinant FAdV-4 fiber-2 protein protects chickens against hepatitis-hydropericardium syndrome (HHS). Vaccine 2014, 32, 1086–1092. [Google Scholar] [CrossRef] [PubMed]
- Li, H.; Wang, J.; Qiu, L.; Han, Z.; Liu, S. Fowl adenovirus species C serotype 4 is attributed to the emergence of hepatitis-hydropericardium syndrome in chickens in China. Infect. Genet. Evol. J. Mol. Epidemiol. Evol. Genet. Infect. Dis. 2016, 45, 230–241. [Google Scholar] [CrossRef] [PubMed]
- Deng, L.; Sharif, S.; Nagy, E. Oral inoculation of chickens with a candidate fowl adenovirus 9 vector. Clin. Vaccine Immunol. CVI 2013, 20, 1189–1196. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Valdivia-Olarte, H.; Requena, D.; Ramirez, M.; Saravia, L.E.; Izquierdo, R.; Falconi-Agapito, F.; Zavaleta, M.; Best, I.; Fernández-Díaz, M.; Zimic, M. Design of a predicted MHC restricted short peptide immunodiagnostic and vaccine candidate for Fowl adenovirus C in chicken infection. Bioinformation 2015, 11, 460–465. [Google Scholar] [CrossRef] [Green Version]
- Shah, M.S.; Ashraf, A.; Khan, M.I.; Rahman, M.; Habib, M.; Qureshi, J.A. Molecular cloning, expression and characterization of 100K gene of fowl adenovirus-4 for prevention and control of hydropericardium syndrome. Biol. J. Int. Assoc. Biol. Stand. 2016, 44, 19–23. [Google Scholar] [CrossRef]
- Sarfraz, M.; Suleman, M.; Tikoo, S.K.; Wheler, C.; Potter, A.A.; Gerdts, V.; Dar, A. Immune responses to in ovo vaccine formulations containing inactivated fowl adenovirus 8b with poly[di(sodium carboxylatoethylphenoxy)]phosphazene (PCEP) and avian beta defensin as adjuvants in chickens. Vaccine 2017, 35, 981–986. [Google Scholar] [CrossRef]




| Sequences of Primers (5′–3′) | |
|---|---|
| sgRNA-L | F: CACCGGGTTACGTCTACTCCCCCAA |
| R: AAACTTGGGGGAGTAGACGTAACCC | |
| sgRNA-R | F: CACCGTCTTTATTTGACACGCGGTG |
| R: AAACCACCGCGTGTCAAATAAAGAC |
| PCR Products | Sequences of Primers (5′–3′) |
|---|---|
| Linear pMD19- HAL-EGFP-F2-HAR | F: CACCGGGTTACGTCTACTCCCCCAA |
| R: AAACTTGGGGGAGTAGACGTAACCC | |
| Fiber gene of FAdV-8b | F: CACCGTCTTTATTTGACACGCGGTG |
| R: AAACCACCGCGTGTCAAATAAAGAC |
| Group | Designation | Vaccination | Challenge |
|---|---|---|---|
| 1 | Negative control | Adjuvant only | - * |
| 2 | Vaccine/challenge FAdV-8b | Inactivated FA4-F8b | FAdV-8b |
| 3 | Challenge control FAdV-8b | Adjuvant only | |
| 4 | Vaccine/challenge FAdV-8a | Inactivated FA4-F8b | FAdV-8a |
| 5 | Challenge control FAdV-8a | Adjuvant only | |
| 6 | Vaccine/challenge FAdV-4 | Inactivated FA4-F8b | FAdV-4 |
| 7 | Challenge control FAdV-4 | Adjuvant only |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Lu, H.; Xie, Q.; Zhang, W.; Zhang, J.; Wang, W.; Lian, M.; Zhao, Z.; Ren, D.; Xie, S.; Lin, Y.; et al. A Novel Recombinant FAdV-4 Virus with Fiber of FAdV-8b Provides Efficient Protection against Both FAdV-4 and FAdV-8b. Viruses 2022, 14, 376. https://doi.org/10.3390/v14020376
Lu H, Xie Q, Zhang W, Zhang J, Wang W, Lian M, Zhao Z, Ren D, Xie S, Lin Y, et al. A Novel Recombinant FAdV-4 Virus with Fiber of FAdV-8b Provides Efficient Protection against Both FAdV-4 and FAdV-8b. Viruses. 2022; 14(2):376. https://doi.org/10.3390/v14020376
Chicago/Turabian StyleLu, Hao, Quan Xie, Wei Zhang, Jianjun Zhang, Weikang Wang, Mingjun Lian, Zhehong Zhao, Dan Ren, Songhua Xie, Yun Lin, and et al. 2022. "A Novel Recombinant FAdV-4 Virus with Fiber of FAdV-8b Provides Efficient Protection against Both FAdV-4 and FAdV-8b" Viruses 14, no. 2: 376. https://doi.org/10.3390/v14020376
APA StyleLu, H., Xie, Q., Zhang, W., Zhang, J., Wang, W., Lian, M., Zhao, Z., Ren, D., Xie, S., Lin, Y., Li, T., Mu, Y., Wan, Z., Shao, H., Qin, A., & Ye, J. (2022). A Novel Recombinant FAdV-4 Virus with Fiber of FAdV-8b Provides Efficient Protection against Both FAdV-4 and FAdV-8b. Viruses, 14(2), 376. https://doi.org/10.3390/v14020376

