Molecular Epidemiology and Variation of the BK Polyomavirus in the Population of Central and Eastern Europe Based on the Example of Poland
Abstract
1. Introduction
2. Materials and Methods
2.1. Study Population
2.2. DNA Extraction
2.3. PCR Amplification
2.4. Sequencing and Bioinformatic Processing
2.5. Quantitation of BK Virus DNA by Real-Time Polymerase Chain Reaction
2.6. Statistical Analysis
3. Results
4. Discussion
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Gardner, S.D.; Field, A.M.; Coleman, D.V.; Hulme, B. New Human Papovavirus (BK) Isolated from Urine after Renal Transplantation. Lancet 1971, 1, 1253–1257. [Google Scholar] [CrossRef] [Scilit]
- Kean, J.M.; Rao, S.; Wang, M.; Garcea, R.L. Seroepidemiology of Human Polyomaviruses. PLoS Pathog. 2009, 5, e1000363. [Google Scholar] [CrossRef] [Scilit]
- Egli, A.; Infanti, L.; Dumoulin, A.; Buser, A.; Samaridis, J.; Stebler, C.; Gosert, R.; Hirsch, H.H. Prevalence of Polyomavirus BK and JC Infection and Replication in 400 Healthy Blood Donors. J. Infect. Dis. 2009, 199, 837–846. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Dehcheshmeh, L.K.; Makvandi, M.; Timori, A. Prevalence of Human Polyomavirus JC and BK in Normal Population. Asian Pac. J. Cancer 2020, 21, 2877–2882. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Hirsch, H.H. BK virus: Opportunity makes a pathogen. Clin. Infect. Dis. 2005, 41, 354–360. [Google Scholar] [CrossRef] [Scilit]
- Wong, A.S.Y.; Cheng, V.C.C.; Yuen, K.Y.; Kwong, Y.L.; Leung, A.Y.H. High frequency of polyoma BK virus shedding in the gastrointestinal tract after hematopoietic stem cell transplantation: A prospective and quantitative analysis. Bone Marrow Transplant. 2009, 43, 43–47. [Google Scholar] [CrossRef] [Scilit]
- Dropulic, L.K.; Jones, R.J. Polyomavirus BK infection in blood and marrow transplant recipients. Bone Marrow Transplant. 2008, 41, 11–18. [Google Scholar] [CrossRef] [Scilit]
- Gonzalez, S.; Escobar-Serna, D.P.; Suarez, O.; Benavides, X.; Escobar-Serna, J.F.; Lozano, E. BK virus nephropathy in kidney transplantation: An approach proposal and update on risk factors, diagnosis, and treatment. Transplant. Proc. 2015, 47, 1777–1785. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Furmaga, J.; Kowalczyk, M.; Zapolski, T.; Furmaga, O.; Krakowski, L.; Rudzki, G.; Jaroszyński, A.; Jakubczak, A. BK Polyomavirus—Biology, Genomic Variation and Diagnosis. Viruses 2021, 13, 1502. [Google Scholar] [CrossRef] [Scilit]
- Umeda, K.; Kato, I.; Kawaguchi, K.; Tasaka, K.; Kamitori, T.; Ogata, H.; Mikami, T.; Hiramatsu, H.; Saito, R.; Ogawa, O.; et al. High incidence of BK virus-associated hemorrhagic cystitis in children after second or third allogeneic hematopoietic stem cell transplantation. Pediatr. Transplant. 2018, 22, e13183. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Sharma, R.; Tzetzo, S.; Patel, S.; Zachariah, M.; Sharma, S.; Melendy, T. BK Virus in Kidney Transplant: Current Concepts, Recent Advances, and Future Directions. Exp. Clin. Transplant. 2016, 14, 377–384. [Google Scholar] [CrossRef]
- Lee, Y.J.; Zheng, J.; Kolitsopoulos, Y.; Chung, D.; Amigues, I.; Son, T.; Choo, K.; Hester, J.; Giralt, S.A.; Glezerman, I.G.; et al. Relationship of BK Polyoma Virus (BKV) in the Urine with Hemorrhagic Cystitis and Renal Function in Recipients of T Cell-Depleted Peripheral Blood and Cord Blood Stem Cell Transplantations. Biol. Blood Marrow Transplant. 2014, 20, 1204–1210. [Google Scholar] [CrossRef] [Scilit]
- Balba, G.P.; Javaid, B.; Timpone, J.G., Jr. BK Polyomavirus Infection in the Renal Transplant Recipient. Infect. Dis. Clin. N. Am. 2013, 27, 271–283. [Google Scholar] [CrossRef] [Scilit]
- Chen, P.; Lei, Y.; He, X.; Zhong, L.; Yu, X.; Huang, B. Sample Processing Effect on BK Virus Detection by Real-Time PCR in Urine Samples. Clin. Lab. 2016, 62, 833–837. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Jiang, M.X.; Abend, J.R.; Johnson, S.F.; Imperiale, M.J. The role of polyomaviruses in human disease. Virology 2009, 384, 266–273. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Imperiale, M.J.; Major, E.O. Polyomaviruses. In Fields Virology; Knipe, D.M., Howley, P.M., Eds.; Lippincott, Williams & Wilkins: Philadelphia, PA, USA, 2007; pp. 2263–2298. [Google Scholar]
- Abend, J.R.; Joseph, A.E.; Das, D.; Campbell-Cecen, D.B.; Imperiale, M.J. A truncated T antigen expressed from an alternatively spliced BK virus early mRNA. J. Gen. Virol. 2009, 90, 1238. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Saribas, A.S.; Coric, P.; Bouaziz, S.; Safak, M. Expression of novel proteins by polyomaviruses and recent advances in the structural and functional features of agnoprotein of JC virus, BK virus, and simian virus 40. J. Cell. Physiol. 2019, 234, 8295–8315. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Fang, C.Y.; Chen, H.Y.; Wang, M.L.; Chen, P.L.; Chang, C.F.; Chen, L.S.; Shen, C.H.; Ou, W.C.; Tsai, M.D.; Hsu, P.H.; et al. Global analysis of modifications of the human BK virus structural proteins by LC-MS/MS. Virology 2010, 402, 164–176. [Google Scholar] [CrossRef] [Scilit]
- Wang, Z.Y.; Hong, W.L.; Zhu, Z.H.; Chen, Y.H.; Ye, W.L.; Chu, G.Y.; Li, J.L.; Chen, B.C.; Xia, P. Phylogenetic reconstruction and polymorphism analysis of BK virus VP2 gene isolated from renal transplant recipients in China. Exp. Ther. Med. 2015, 10, 1759–1767. [Google Scholar] [CrossRef] [Scilit]
- Karalic, D.; Lazarevic, I.; Banko, A.; Cupic, M.; Jevtovic, D.; Jovanovic, T. Molecular characterization of BK virus in patients infected with human immunodeficiency virus. Med. Microbiol. Immunol. 2016, 205, 185–193. [Google Scholar] [CrossRef] [Scilit]
- Tremolada, S.; Delbue, S.; Larocca, S.; Carloni, C.; Elia, F.; Khalili, K.; Gordon, J.; Ferrante, P. Polymorphisms of the BK virus subtypes and their influence on viral in vitro growth efficiency. Virus Res. 2010, 149, 190–196. [Google Scholar] [CrossRef] [Scilit]
- Krumbholz, A.; Bininda-Emonds, O.R.P.; Wutzler, P.; Zell, R. Evolution of four BK virus subtypes. Infect. Genet. Evol. 2008, 8, 632–643. [Google Scholar] [CrossRef] [Scilit]
- Zheng, H.Y.; Nishimoto, Y.; Chen, Q.; Hasegawa, M.; Zhong, S.; Ikegaya, H.; Ohno, N.; Sugimoto, C.; Takasaka, T.; Kitamura, T.; et al. Relationships between BK virus lineages and human populations. Microbes. Infect. 2007, 9, 204–213. [Google Scholar] [CrossRef] [Scilit]
- Chen, Q.; Zheng, H.Y.; Zhong, S.; Ikegaya, H.; He, H.X.; Wei, W.; He, Y.Y.; Kobayashi, N.; Honjo, T.; Takasaka, T.; et al. Subtype IV of the BK polyomavirus is prevalent in East Asia. Arch. Virol. 2006, 151, 2419–2429. [Google Scholar] [CrossRef] [Scilit]
- Nishimoto, Y.; Zheng, H.Y.; Zhong, S.; Ikegaya, H.; Chen, Q.; Sugimoto, C.; Kitamura, T.; Yogo, Y. An Asian origin for subtype IV BK virus based on phylogenetic analysis. J. Mol. Evol. 2007, 65, 103–111. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Yogo, Y.; Sugimoto, C.; Zhong, S.; Homma, Y. Evolution of the BK polyomavirus: Epidemiological, anthropological and clinical implications. Rev. Med. Virol. 2009, 19, 185–199. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Ikegaya, H.; Saukko, P.J.; Tertti, R.; Metsarinne, K.P.; Carr, M.J.; Crowley, B.; Sakurada, K.; Zheng, H.-Y.; Kitamura, T.; Yogo, Y. Identification of a genomic subgroup of BK polyomavirus spread in European populations. J. Gen.Virol. 2006, 87, 3201–3208. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Zhong, S.; Randhawa, P.S.; Ikegaya, H.; Chen, Q.; Zheng, H.Y.; Suzuki, M.; Takeuchi, T.; Shibuya, A.; Kitamura, T.; Yogo, Y. Distribution patterns of BK polyomavirus (BKV) subtypes and subgroups in American, European and Asian populations suggest co-migration of BKV and the human race. J. Gen. Virol. 2009, 90, 144–152. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Luo, C.Q.; Hirsch, H.H.; Kant, J.; Randhawa, P. VP-1 Quasispecies in Human Infection With Polyomavirus BK. J. Med. Virol. 2012, 84, 152–161. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- McIlroy, D.; Halary, F.; Bressollette-Bodin, C. Intra-patient viral evolution in polyomavirus-related diseases. Philos. Trans. R. Soc. Lond. B Biol. Sci. 2019, 374, 20180301. [Google Scholar] [CrossRef] [Scilit]
- Pinto, A.Y.D.; Valente, V.D.; Coura, J.R.; Valente, S.A.D.; Junqueira, A.C.V.; Santos, L.C.; Ferreira, A.G.; de Macedo, R.C. Clinical Follow-Up of Responses to Treatment with Benznidazol in Amazon: A Cohort Study of Acute Chagas Disease. PLoS ONE 2013, 8, e64450. [Google Scholar] [CrossRef] [Scilit]
- Takasaka, T.; Goya, N.; Tokumoto, T.; Tanabe, K.; Toma, H.; Ogawa, Y.; Hokama, S.; Momose, A.; Funyu, T.; Fujioka, T.; et al. Subtypes of BK virus prevalent in Japan and variation in their transcriptional control region. J. Gen. Virol. 2004, 85, 2821–2827. [Google Scholar] [CrossRef] [Scilit]
- Randhawa, P.S.; Khaleel-Ur-Rehman, K.; Swalsky, P.A.; Vats, A.; Scantlebury, V.; Shapiro, R.; Finkelstein, S. DNA sequencing of viral capsid protein VP-1 region in patients with BK virus interstitial nephritis. Transplantation 2002, 73, 1090–1094. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Morel, V.; Martin, E.; Francois, C.; Helle, F.; Faucher, J.; Mourez, T.; Choukroun, G.; Duverlie, G.; Castelain, S.; Brochot, E. A Simple and Reliable Strategy for BK Virus Subtyping and Subgrouping. J. Clin. Microbiol. 2017, 55, 1177–1185. [Google Scholar] [CrossRef] [Scilit]
- Cobos, M.; Aquilia, L.; Garay, E.; Ochiuzzi, S.; Alvarez, S.; Flores, D.; Raimondi, C. Epidemiologic study and genotyping of BK virus in renal transplant recipients. Transplant. Proc. 2018, 50, 458–460. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Ducharme-Smith, A.; Katz, B.Z.; Bobrowski, A.E.; Backer, C.L.; Rychlik, K.; Pahl, E. Prevalence of BK polyomavirus infection and association with renal dysfunction in pediatric heart transplant recipients. J. Heart Lung Transplant. 2015, 34, 222–226. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Zhong, S.; Zheng, H.Y.; Suzuki, M.; Chen, Q.; Ikegaya, H.; Aoki, N.; Usuku, S.; Kobayashi, N.; Nukuzuma, S.; Yasuda, Y.; et al. Age-related urinary excretion of BK polyomavirus by nonimmunocompromised individuals. J. Clin. Microbiol. 2007, 45, 193–198. [Google Scholar] [CrossRef] [Scilit]
- Hu, C.; Huang, Y.; Su, J.; Wang, M.; Zhou, Q.; Zhu, B. The prevalence and isolated subtypes of BK polyomavirus reactivation among patients infected with human immunodeficiency virus-1 in southeastern China. Arch. Virol. 2018, 163, 1463–1468. [Google Scholar] [CrossRef] [Scilit]
- Hirsch, H.H.; Randhawa, P.S.; AST Infectious Diseases Community of Practice. BK polyomavirus in solid organ transplantation—guidelines from the American Society of Transplantation Infectious Diseases Community of Practice. Clin. Transplant. 2019, 33, e13528. [Google Scholar] [CrossRef] [Scilit]
- Shen, C.-L.; Wu, B.-S.; Lien, T.-J.; Yang, A.-H.; Yang, C.-Y. BK Polyomavirus Nephropathy in Kidney Transplantation: Balancing Rejection and Infection. Viruses 2021, 13, 487. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Sharma, P.M.; Gupta, G.; Vats, A.; Shapiro, R.; Randhawa, P. Phylogenetic analysis of polyomavirus BK sequences. J. Virol. 2006, 80, 8869–8879. [Google Scholar] [CrossRef] [Scilit]
- Chen, Y.P.; Sharp, P.M.; Fowkes, M.; Kocher, O.; Joseph, J.T.; Koralnik, I.J. Analysis of 15 novel full-length BK virus sequences from three individuals: Evidence of a high intra-strain genetic diversity. J. Gen. Virol. 2004, 85, 2651–2663. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Gambarino, S.; Costa, C.; Astegiano, S.; Piasentin, E.A.; Segoloni, G.P.; Cavallo, R.; Bergallo, M. Genotyping of polyomavirus BK by Real time PCR for VP1 gene. Mol. Biotechnol. 2011, 49, 151–158. [Google Scholar] [CrossRef] [Scilit]
- Carr, M.J.; McCormack, G.P.; Mutton, K.J.; Crowley, B. Unique BK virus non-coding control region (NCCR) variants in hematopoietic stem cell transplant recipients with and without hemorrhagic cystitis. J. Med. Virol. 2006, 78, 485–493. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Jin, L.; Pietropaolo, V.; Booth, J.C.; Ward, K.H.; Brown, D.W. Prevalence and distribution of BK virus subtypes in healthy people and immunocompromised patients detected by PCR-restriction enzyme analysis. Clin. Diagvirol. 1995, 3, 285–295. [Google Scholar] [CrossRef] [Scilit]
- Krumbholz, A.; Zell, R.; Egerer, R.; Sauerbrei, A.; Helming, A.; Gruhry, B.; Wutzler, P. Prevalence of BK virus subtype I in Germany. J. Med. Virol. 2006, 78, 1588–1598. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Momynaliev, K.T.; Gorbatenko, E.V.; Shevtsov, A.B.; Gribanov, O.G.; Babenko, N.N.; Kaabak, M.M. Prevalence and subtypes of BK virus in pediatric renal transplant recipients in Russia. Pediatr. Transplant. 2012, 16, 151–159. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Zheng, H.Y.; Ikegaya, H.; Takasaka, T.; Matsushima-Ohno, T.; Sakurai, M.; Kanazawa, I.; Kishida, S.; Nagashima, K.; Kitamura, T.; Yogo, Y. Characterization of the VP1 loop mutations widespread among JC polyomavirus isolates associated with progressive multifocal leukoencephalopathy. Biochem. Biophys. Res. Commun. 2005, 333, 996–1002. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Pastrana, D.V.; Brennan, D.C.; Cuburu, N.; Storch, G.A.; Viscidi, R.P.; Randhawa, P.S.; Buck, C.B. Neutralization serotyping of BK polyomavirus infection in kidney transplant recipients. PLoS Pathog. 2012, 8, e1002650. [Google Scholar] [CrossRef] [Scilit] [PubMed]




| Primer Name | Primer Sequence | Product Length | References | |
|---|---|---|---|---|
| BKPyV | 327-1PST | CAAGTGCCAAAACTACTAAT | 327 bp | [28,33] |
| 327-2HIN | GCATGAAGGTTAAGCATGC | |||
| β-globin | PC03_F | ACACAACTGTGTTCACTAGC | 110 bp | [32] |
| PC04_R | CAACTTCATCCACGTTCACC | |||
| Reaction Mix Composition | BKPyV | β-Globin | ||
|---|---|---|---|---|
| Water | to 25 µL | to 25 µL | ||
| Buffer 10× | 1× concentrated | 1× concentrated | ||
| GC enhancer | 0.04 in final concentration | 0.04 in final concentration | ||
| Mg2+ | 2.5 mM | 2.5 mM | ||
| dNTP | 0.8 mM | 0.8 mM | ||
| Forward primer | 0.8 µM | 0.8 µM | ||
| Reverse primer | 0.8 µM | 0.8 µM | ||
| Polymerase | 1U | 1U | ||
| Temperature profile | Temperature | Time | Temperature | Time |
| Initial denaturation | 95 °C | 10 min | 95 °C | 10 min |
| Denaturation | 95 °C | 45 s | 95 °C | 45 s |
| Annealing | 54 °C | 45 s | 56 °C | 45 s |
| Elongation | 72 °C | 45 s | 72 °C | 45 s |
| Final elongation | 72 °C | 10 min | 72 °C | 10 min |
| Without BK | Confirmed Presence of BKPyV | Total | ||||
|---|---|---|---|---|---|---|
| Sex | Number | Age | Number | Age | Number | Age |
| Women | 36 | 56 (29–72) | 22 | 53 (27–67) | 58 | 55 (27–75) |
| Men | 71 | 47 (21–73) | 39 | 53 (25–75) | 110 | 49 (21–75) |
| Total | 107 | 61 | 168 | |||
| NC_001538.1_BK_DUN | Ib-2_POL_K | Ib-2_POL_F | POL-IV | |
|---|---|---|---|---|
| 1687 | G | C | C | |
| 1698 | T | A | A | A |
| 1704 | G | A | ||
| 1716 | C | T | ||
| 1722 | C | T | ||
| 1744 | G | A | ||
| 1746 | A | T | ||
| 1747 | A | G | ||
| 1760 | T | A | ||
| 1769 | A | G | ||
| 1770 | G | A | ||
| 1775 | G | C | ||
| 1784 | A | C | ||
| 1787 | A | C | ||
| 1792 | A | G | ||
| 1793 | G | A | ||
| 1809 | G | A | C | C |
| 1848 | C | A | ||
| 1851 | C | A | ||
| 1854 | C | T | ||
| 1860 | A | G | ||
| 1869 | C | T | ||
| 1890 | G | A | ||
| 1905 | A | G | ||
| 1908 | T | A | A | |
| 1912 | C | A | ||
| 1923 | T | C | C |
| Sex | Age | Number | Average Number of Copies | Type | ||
|---|---|---|---|---|---|---|
| Ib-2_POL_K | Ib-2_POL_F | POL-IV | ||||
| M | 21–30 | 2 | 7.81 × 103 | 0 | 1 | 1 |
| 31–40 | 6 | 1.55 × 106 | 2 | 3 | 1 | |
| 41–50 | 8 | 2.27 × 104 | 4 | 2 | 2 | |
| 51–60 | 9 | 2.82 × 103 | 5 | 2 | 2 | |
| 61–70 | 9 | 5.63 × 104 | 4 | 1 | 4 | |
| 71+ | 5 | 6.65 × 103 | 1 | 2 | 2 | |
| Total | 39 | 16 (41.02%) | 11 (28.21%) | 12 (30.77%) | ||
| F | 21–30 | 2 | 1.18 × 104 | 1 | 0 | 1 |
| 31–40 | 1 | 8.00 × 102 | 1 | 0 | 0 | |
| 41–50 | 7 | 1.50 × 104 | 2 | 1 | 4 | |
| 51–60 | 3 | 6.56 × 104 | 1 | 1 | 1 | |
| 61–70 | 9 | 3.10 × 105 | 3 | 2 | 4 | |
| Total | 22 | 8 (36.36%) | 4 (18.18%) | 10 (45.45%) | ||
| M and F | 21–30 | 4 | 9.78 × 103 | 1 | 1 | 2 |
| 31–40 | 7 | 1.33 × 106 | 3 | 3 | 1 | |
| 41–50 | 15 | 1.91 × 104 | 6 | 3 | 6 | |
| 51–60 | 12 | 1.85 × 104 | 6 | 3 | 3 | |
| 61–70 | 18 | 1.83 × 105 | 7 | 3 | 8 | |
| 71+ | 5 | 6.65 × 103 | 1 | 2 | 2 | |
| Total | 61 | 24 (39.34%) | 15 (24.59%) | 22 (36.07%) | ||
| Sequence | Ib-2_POL_K | Ib-2_POL_F | POL-IV | Type |
|---|---|---|---|---|
| AB276214.1_CAF-9 | 97.90% | 97.90% | 91.60% | Ia |
| AB263938.1_ZAF-1 | 97.90% | 97.90% | 91.60% | |
| AB365157.1_SAU-3 | 96.80% | 96.80% | 91.20% | |
| NC_001538.1_DUN | 98.20% | 98.20% | 91.60% | |
| AB211369.1_Dik | 99.30% | 98.90% | 91.60% | Ib-1 |
| AB211371.1_WW | 98.90% | 98.60% | 91.20% | |
| AB263927.1_KEN-3 | 99.30% | 98.90% | 91.60% | |
| AB369090.1_A-43H | 99.30% | 98.90% | 91.60% | |
| AB211370.1_JL | 100.00% | 99.60% | 90.90% | Ib-2 |
| AB276160.1_HUN-2 | 100.00% | 99.60% | 90.90% | |
| AB276157.1_CZE-4 | 100.00% | 99.60% | 90.90% | |
| AB260029.1_FIN-11 | 99.60% | 100.00% | 91.20% | |
| AB260028.1_FIN-13 | 99.60% | 100.00% | 91.20% | |
| FR720321.1_RU16 | 99.60% | 100.00% | 91.20% | |
| AB211372.1_MT | 97.90% | 97.90% | 91.90% | Ic |
| AB211381.1_TW-1 | 97.50% | 97.50% | 91.60% | |
| AB211377.1_RYU-2 | 97.20% | 97.20% | 91.90% | |
| AB369099.1_FUJ-31 | 97.90% | 97.90% | 92.60% | |
| JN793996.1_KT40 | 93.70% | 94.00% | 94.70% | II |
| AB263916.1_ETH-3 | 94.40% | 94.70% | 94.00% | |
| DQ457411.1_SJH16 | 93.70% | 94.00% | 94.70% | |
| AB301101.1_J2B-11 | 93.70% | 94.00% | 94.70% | |
| AB365139.1_NEA-27 | 91.60% | 91.90% | 93.30% | III |
| M23122.1_AS | 91.90% | 92.30% | 92.60% | |
| AB211386.1_KOM-3 | 91.20% | 91.60% | 93.00% | |
| JN192440.1_SJH-LG-310 | 92.30% | 92.60% | 92.30% | |
| DQ457412.1__SJH185 | 90.90% | 91.20% | 100.00% | IV |
| AB269859.1_PHL-8 | 90.90% | 91.20% | 98.90% | |
| AB365150.1_OKN-22 | 90.20% | 90.50% | 99.30% | |
| AB269834.1_JPN-15 | 89.80% | 90.20% | 98.90% | |
| AB269863.1_SWC-1 | 91.20% | 91.60% | 99.60% | |
| AB269846.1_MON-1 | 90.90% | 91.20% | 100.00% | |
| AB269830.1_GRC-4 | 90.50% | 90.90% | 99.60% | |
| AB269833.1_ITA-4 | 90.90% | 91.20% | 100.00% | |
| AB269864.1_SWC-2 | 91.20% | 91.60% | 99.60% | |
| AB269831.1_GRC-5 | 90.50% | 90.90% | 99.60% |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Furmaga, J.; Kowalczyk, M.; Furmaga, O.; Rokos, C.A.; Zapolski, T.; Krakowski, L.; Jakubczak, A.; Rudzki, S. Molecular Epidemiology and Variation of the BK Polyomavirus in the Population of Central and Eastern Europe Based on the Example of Poland. Viruses 2022, 14, 209. https://doi.org/10.3390/v14020209
Furmaga J, Kowalczyk M, Furmaga O, Rokos CA, Zapolski T, Krakowski L, Jakubczak A, Rudzki S. Molecular Epidemiology and Variation of the BK Polyomavirus in the Population of Central and Eastern Europe Based on the Example of Poland. Viruses. 2022; 14(2):209. https://doi.org/10.3390/v14020209
Chicago/Turabian StyleFurmaga, Jacek, Marek Kowalczyk, Olga Furmaga, Christos A. Rokos, Tomasz Zapolski, Leszek Krakowski, Andrzej Jakubczak, and Sławomir Rudzki. 2022. "Molecular Epidemiology and Variation of the BK Polyomavirus in the Population of Central and Eastern Europe Based on the Example of Poland" Viruses 14, no. 2: 209. https://doi.org/10.3390/v14020209
APA StyleFurmaga, J., Kowalczyk, M., Furmaga, O., Rokos, C. A., Zapolski, T., Krakowski, L., Jakubczak, A., & Rudzki, S. (2022). Molecular Epidemiology and Variation of the BK Polyomavirus in the Population of Central and Eastern Europe Based on the Example of Poland. Viruses, 14(2), 209. https://doi.org/10.3390/v14020209

