Current Epidemiology and Co-Infections of Avian Immunosuppressive and Neoplastic Diseases in Chicken Flocks in Central China
Abstract
1. Introduction
2. Materials and Methods
2.1. Ethics Statement
2.2. Viruses and Cells
2.3. Sample Collection
2.4. Virus Isolation
2.5. PCR
2.6. RT-PCR
2.7. ELISA and Strip Tests
3. Results
3.1. Clinical Cases of Avian Neoplastic Diseases and Distribution in Central China
3.2. Infection Status of MDV, ALV, and REV in Birds with Suspected Neoplastic Diseases
3.3. Co-Infections of MDV, ALV, and REV in Chicken Flocks
3.4. Relationship between Breeding Scale, Chicken Breeds, and Virus Infection
3.5. Seasonal and Age Features Correlated to Current MD Outbreaks
4. Discussion
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Swayne, D.E.; Boulianne, M.; Logue, C.M.; McDougald, L.R.; Nair, V.; Suarez, D.L. Diseases of Poultry, 14th ed.; John Wiley & Sons, Inc.: Hoboken, NJ, USA, 2020; pp. 550–586. [Google Scholar]
- Davidson, I.; Borenshtain, R. In vivo events of retroviral long terminal repeat integration into Marek’s disease virus in commercial poultry detection of chimeric molecules as a marker. Avian Dis. 2001, 45, 102–121. [Google Scholar] [CrossRef] [PubMed]
- Teng, M.; Zheng, L.P.; Li, H.Z.; Ma, S.M.; Zhu, Z.J.; Chai, S.J.; Yao, Y.; Nair, V.; Zhang, G.P.; Luo, J. Pathogenicity and Pathotype Analysis of Henan Isolates of Marek’s Disease Virus Reveal Long-Term Circulation of Highly Virulent MDV Variant in China. Viruses. 2022, 14, 1651. [Google Scholar] [CrossRef] [PubMed]
- Song, B.L.; Zeb, J.; Hussain, S.; Aziz, M.U.; Circella, E.; Casalino, G.; Camarda, A.; Yang, G.; Buchon, N.; Sparagano, O. A Review on the Marek’s Disease Outbreak and Its Virulence-Related meq Genovariation in Asia between 2011 and 2021. Animals. 2022, 12, 540. [Google Scholar] [CrossRef]
- Witter, R.L. Increased Virulence of Marek’s Disease Virus Field Isolates. Avian Dis. 1997, 41, 149–163. [Google Scholar] [CrossRef]
- Kennedy, D.A.; Cairns, C.; Jones, M.J.; Bell, A.S.; Salathe, R.M.; Baigent, S.J.; Nair, V.K.; Dunn, P.A.; Read, A.F. Industry-Wide Surveillance of Marek’s Disease Virus on Commercial Poultry Farms. Avian Dis. 2017, 61, 153–164. [Google Scholar] [CrossRef] [PubMed]
- Gatherer, D.; Depledge, D.P.; Hartley, C.A.; Szpara, M.L.; Vaz, P.K.; Benko, M.; Brandt, C.R.; Bryant, N.A.; Dastjerdi, A.; Doszpoly, A.; et al. ICTV Virus Taxonomy Profile: Herpesviridae 2021. J. Gen. Virol. 2021, 102, 001673. [Google Scholar] [CrossRef] [PubMed]
- Conradie, A.M.; Bertzbach, L.D.; Trimpert, J.; Patria, J.N.; Murata, S.; Parcells, M.S.; Kaufer, B.B. Distinct polymorphisms in a single herpesvirus gene are capable of enhancing virulence and mediating vaccinal resistance. PLoS Pathog. 2020, 16, e1009104. [Google Scholar] [CrossRef] [PubMed]
- Yu, Z.H.; Teng, M.; Luo, J.; Wang, X.W.; Ding, K.; Yu, L.L.; Su, J.W.; Chi, J.Q.; Zhao, P.; Hu, B.; et al. Molecular characteristics and evolutionary analysis of field Marek’s disease virus prevalent in vaccinated chicken flocks in recent years in China. Virus Genes. 2013, 47, 282–291. [Google Scholar] [CrossRef]
- Zhang, Y.P.; Lv, H.C.; Bao, K.Y.; Gao, Y.L.; Gao, H.L.; le Qi, X.; Cui, H.Y.; Wang, Y.Q.; Li, K.; Gao, L.; et al. Molecular and pathogenicity characterization of Gallid herpesvirus 2 newly isolated in China from 2009 to 2013. Virus Genes. 2016, 52, 51–60. [Google Scholar] [CrossRef]
- Deng, Q.M.; Shi, M.Y.; Li, Q.H.; Wang, P.K.; Li, M.; Wang, W.W.; Gao, Y.L.; Li, H.J.; Lin, L.L.; Huang, T.; et al. Analysis of the evolution and transmission dynamics of the field MDV in China during the years 1995-2020, indicating the emergence of a unique cluster with the molecular characteristics of vv+ MDV that has become endemic in southern China. Transbound. Emerg. Dis. 2021, 68, 3574–3587. [Google Scholar] [CrossRef]
- Coffin, J.; Blomberg, J.; Fan, H.; Gifford, R.; Hatziioannou, T.; Lindemann, D.; Mayer, J.; Stoye, J.; Tristem, M.; Johnson, W.; et al. ICTV Virus Taxonomy Profile: Retroviridae 2021. J. Gen. Virol. 2021, 102, 001712. [Google Scholar] [CrossRef] [PubMed]
- Zhang, G.H.; Qu, Y.J.; Niu, Y.J.; Zhang, H.X.; Sun, Q.Q.; Liu, X.P.; Li, Y.; Zhang, H.; Liu, M.D. Difference in pathogenicity of 2 strains of avian leukosis virus subgroup J in broiler chicken. Poult. Sci. 2019, 98, 2772–2780. [Google Scholar] [CrossRef] [PubMed]
- Meng, F.F.; Li, Q.C.; Zhang, Y.B.; Cui, Z.Z.; Chang, S.; Zhao, P. Isolation and characterization of subgroup J Avian Leukosis virus associated with hemangioma in commercial Hy-Line chickens. Poult. Sci. 2018, 97, 2667–2674. [Google Scholar] [CrossRef] [PubMed]
- Shao, H.X.; Wang, L.; Sang, J.J.; Li, T.F.; Liu, Y.L.; Wan, Z.M.; Qian, K.; Qin, A.J.; Ye, J. Novel avian leukosis viruses from domestic chicken breeds in mainland China. Arch. Virol. 2017, 162, 2073–2076. [Google Scholar] [CrossRef]
- Zeghdoudi, M.; Aoun, L.; Merdaci, L.; Bouzidi, N. Epidemiological features and pathological study of avian leukosis in turkeys’ flocks. Vet. World. 2017, 10, 1135–1138. [Google Scholar] [CrossRef]
- Yu, M.M.; Bao, Y.L.; Wang, M.P.; Zhu, H.B.; Wang, X.Y.; Xing, L.X.; Chang, F.F.; Liu, Y.Z.; Farooque, M.; Wang, Y.Q.; et al. Development and application of a colloidal gold test strip for detection of avian leukosis virus. Appl. Microbiol. Biotechnol. 2019, 103, 427–435. [Google Scholar] [CrossRef] [PubMed]
- Zhou, X.Y.; Wang, L.; Shen, A.N.; Shen, X.; Xu, M.R.; Qian, K.; Shao, H.X.; Yao, Y.X.; Nair, V.; Ye, J.Q.; et al. Detection of ALV p27 in cloacal swabs and virus isolation medium by sELISA. BMC Vet. Res. 2019, 15, 383. [Google Scholar] [CrossRef]
- Wang, X.Z.; Wang, B.; Zhang, P.P.; Cheng, H.G.; Song, S.H. The passage of cells can improve the detection rate of avian leukosis virus to facilitate the elimination of avian leukosis in chickens. SpringerPlus. 2013, 2, 138. [Google Scholar] [CrossRef][Green Version]
- Sun, G.R.; Zhang, Y.P.; Zhou, L.Y.; Lv, H.C.; Zhang, F.; Li, K.; Gao, Y.L.; Qi, X.L.; Cui, H.Y.; Wang, Y.Q.; et al. Co-Infection with Marek’s Disease Virus and Reticuloendotheliosis Virus Increases Illness Severity and Reduces Marek’s Disease Vaccine Efficacy. Viruses. 2017, 9, 158. [Google Scholar] [CrossRef]
- Li, L.; Zhuang, P.P.; Cheng, Z.Q.; Yang, J.; Bi, J.M.; Wang, G.H. Avian leukosis virus subgroup J and reticuloendotheliosis virus coinfection induced TRIM62 regulation of the actin cytoskeleton. J. Vet. Sci. 2020, 21, e49. [Google Scholar] [CrossRef]
- Shi, M.Y.; Li, M.; Wang, P.K.; Wang, W.W.; Li, H.J.; Gao, Y.L.; Lin, L.; Huang, T.; Wei, P. An outbreak in three-yellow chickens with clinical tumors of high mortality caused by the coinfection of reticuloendotheliosis virus and Marek’s disease virus: A speculated reticuloendotheliosis virus contamination plays an important role in the case. Poult. Sci. 2021, 100, 19–25. [Google Scholar] [CrossRef] [PubMed]
- Li, M.; Wang, P.K.; Li, Q.H.; Deng, Q.M.; Shi, M.Y.; Mo, M.L.; Wei, T.C.; Huang, T.; Wei, P. Reemergence of reticuloendotheliosis virus and Marek’s disease virus co-infection in Yellow-Chickens in Southern China. Poult. Sci. 2021, 100, 101099. [Google Scholar] [CrossRef] [PubMed]
- Li, M.; Xiong, H.F.; Wu, H.W.; Hu, D.M.; Lin, Y.; Huang, X.T.; Wang, J.; Qi, K.Z.; Liu, H.M. Pathologic Characterization of Coinfection with Histomonas meleagridis, Marek’s Disease Virus, and Subtype J Avian Leukosis Virus in Chickens. Avian Dis. 2021, 65, 237–240. [Google Scholar] [CrossRef]
- Witter, R.L.; Sharma, J.M.; Fadly, A.M. Pathogenicity of Variant Marek’s Disease Virus Isolants in Vaccinated and Unvaccinated Chickens. Avian Dis. 1980, 24, 210. [Google Scholar] [CrossRef]
- Su, J.W.; Teng, M.; Luo, J.; Chi, J.Q.; Yu, Z.H.; Yu, L.L.; Zhang, G.P. Co-infection of field Marek’s disease virus with reticuloendotheliosis virus prevalent in vaccinated chicken flocks. Acta Vet. Zootech. Sinica. 2016, 47, 128–134. [Google Scholar]
- Zhang, Y.P.; Li, Z.J.; Bao, K.Y.; Lv, H.C.; Gao, Y.L.; Gao, H.L.; Qi, X.L.; Cui, H.Y.; Wang, Y.Q.; Ren, X.G.; et al. Pathogenic characteristics of Marek’s disease virus field strains prevalent in China and the effectiveness of existing vaccines against them. Vet. Microbiol. 2015, 177, 62–68. [Google Scholar] [CrossRef]
- Wang, P.K.; Niu, J.R.; Xue, C.; Han, Z.Q.; Abdelazez, A.; Zhang, X.L. Two novel recombinant avian leukosis virus isolates from Luxi gamecock chickens. Arch. Virol. 2020, 165, 2877–2881. [Google Scholar] [CrossRef] [PubMed]
- Lin, L.; Wang, P.K.; Yang, Y.L.; Li, H.J.; Huang, T.; Wei, P. Full-length genome sequence analysis of four subgroup J avian leukosis virus strains isolated from chickens with clinical hemangioma. Virus Genes. 2017, 53, 868–875. [Google Scholar] [CrossRef]
- Xu, A.H.; Huo, C.Y.; Zhong, Q.; Xu, M.Y.; Yang, Y.R.; Tian, H.Y.; Zhang, G.Z.; Hu, Y.X. Isolation and pathogenicity testing of avian reticuloendotheliosis virus from layer chickens in China. J. Vet. Diagn. Investig. 2020, 32, 389–393. [Google Scholar] [CrossRef]
- Cui, Z.Z.; Sun, S.H.; Zhang, Z.; Meng, S.S. Simultaneous endemic infections with subgroup J avian leukosis virus and reticuloendotheliosis virus in commercial and local breeds of chickens. Avian Pathol. 2009, 38, 443–448. [Google Scholar] [CrossRef]
- Meng, F.F.; Dong, G.W.; Zhang, Y.B.; Tian, S.B.; Cui, Z.Z.; Chang, S.; Zhao, P. Co-infection of fowl adenovirus with different immunosuppressive viruses in a chicken flock. Poult. Sci. 2018, 97, 1699–1705. [Google Scholar] [CrossRef]
- Zhang, Y.P.; Yu, Z.H.; Lan, X.G.; Zhang, F.; Wang, Q.; Li, K.; Pan, Q.; Gao, Y.L.; Qi, X.L.; Cui, H.Y.; et al. A high frequency of Gallid herpesvirus-2 co-infection with Reticuloendotheliosis virusis associated with high tumor rates in Chinese chicken farms. Vet. Microbiol. 2019, 237, 108418. [Google Scholar] [CrossRef] [PubMed]
- Zhou, J.; Zhao, G.L.; Wang, X.M.; Du, X.S.; Su, S.; Li, C.G.; Nair, V.; Yao, Y.X.; Cheng, Z.Q. Synergistic Viral Replication of Marek’s Disease Virus and Avian Leukosis Virus Subgroup J is Responsible for the Enhanced Pathogenicity in the Superinfection of Chickens. Viruses. 2018, 10, 271. [Google Scholar] [CrossRef] [PubMed]
- Wen, Y.W.; Huang, Q.; Yang, C.C.; Pan, L.; Wang, G.J.; Qi, K.Z.; Liu, H.M. Characterizing the histopathology of natural co-infection with Marek’s disease virus and subgroup J avian leucosis virus in egg-laying hens. Avian Pathol. 2018, 47, 83–89. [Google Scholar] [CrossRef] [PubMed]
- Cadmus, K.J.; Mete, A.; Harris, M.; Anderson, D.; Davison, S.; Sato, Y.; Helm, J.; Boger, L.; Odani, J.; Ficken, M.D.; et al. Causes of mortality in backyard poultry in eight states in the United States. J. Vet. Diagn. Investig. 2019, 31, 318–326. [Google Scholar] [CrossRef]
- Meng, F.F.; Li, Q.C.; Zhang, Y.W.; Zhang, Z.H.; Tian, S.B.; Cui, Z.Z.; Chang, S.; Zhao, P. Characterization of subgroup J avian Leukosis virus isolated from Chinese indigenous chickens. Virol. J. 2018, 15, 33. [Google Scholar] [CrossRef]
- Xu, M.; Mu, X.H.; Qian, K.; Shao, H.X.; Yao, Y.X.; Nair, V.; Wang, J.; Ye, J.Q.; Qin, A.J. Novel mutation of avian leukosis virus subgroup J from Tibetan chickens. Poult. Sci. 2021, 100, 100931. [Google Scholar] [CrossRef]
- Zhuang, X.Y.; Zou, H.T.; Shi, H.Y.; Shao, H.X.; Ye, J.Q.; Miao, J.; Wu, G.H.; Qin, A.J. Outbreak of Marek’s disease in a vaccinated broiler breeding flock during its peak egg-laying period in China. BMC Vet. Res. 2015, 11, 157. [Google Scholar] [CrossRef]
No. | Poultry Farms | Breeds | Category | Geographical Location * | Bird Nos. | Age for Sample Collection (Days) | Mortality | Year & Month |
---|---|---|---|---|---|---|---|---|
1 | HNZMD | Liangfenghua | Broiler | Henan, Zhumadian | 5000 | 120 | 50.0% | 2020, November |
2 | HNXZ1 | Partridge chicken | Layer | Henan, Xinzheng | 60,000 | 90 | 50.0% | 2021, February |
3 | HNZM | Partridge chicken | Broiler | Henan, Zhongmu | 8000 | 17 | 37.5% | 2021, March |
4 | HNXZ2 | Liangfenghua | Breeder | Henan, Xinzheng | 15,000 | 190 | UA | 2021, April |
5 | HNYY1 | Jinghong | Layer | Henan, Yuanyang | 15,000 | 90 | 50.0% | 2021, April |
6 | HNLK1 | Hyline Brown | Layer | Henan, Lankao | 20,000 | 150 | 12.5% | 2021, April |
7 | HNLK2 | Jinghong | Layer | Henan, Lankao | 15,000 | 160 | 5.0% | 2021, April |
8 | HNZC1 | Jinghong | Layer | Henan, Zhecheng | 20,000 | 90 | 38.3% | 2021, April |
9 | HNSQ1 | Jinghong | Layer | Henan, Shangqiu | 16,800 | 100 | 40.0% | 2021, April |
10 | HNLY1 | Jinghong | Layer | Henan, Luyi | 42,000 | 120 | 50.0% | 2021, April |
11 | HNYC1 | Jinghong | Layer | Henan, Yucheng | 7000 | 61 | 10.0% | 2021, April |
12 | SDCX1 | Jinghong | Layer | Shandong, Caoxian | 2000 | 100 | 30.0% | 2021, April |
13 | SDSX | Jinghong | Layer | Shandong, Shanxian | 10,000 | 65 | 15.0% | 2021, April |
14 | SDCW | Hyline Brown | Layer | Shandong, Chengwu | 10,000 | 70 | 20.0% | 2021, May |
15 | SDCX2 | Jinghong | Layer | Shandong, Caoxian | 5400 | 80 | 6.50% | 2021, May |
16 | HNSQ2 | Jinghong | Layer | Henan, Shangqiu | 9000 | 70 | 11.0% | 2021, May |
17 | HNSC | Hyline Brown | Layer | Henan, Shangcai | 11,000 | 80 | 13.6% | 2021, May |
18 | HNYC2 | Jinghong | Layer | Henan, Yucheng | 5200 | 65 | 28.0% | 2021, May |
19 | HNZC2 | Jinghong | Layer | Henan, Zhecheng | 11,000 | 70 | 8.0% | 2021, May |
20 | HNXZ3 | Partridge chicken | Breeder | Henan, Xinzheng | 20,000 | 80 | 4.0% | 2021, May |
21 | HNQX | Jinghong | Layer | Henan, Qixian | 10,000 | 65 | 12.5% | 2021, May |
22 | HNZC3 | Jinghong | Layer | Henan, Zhecheng | 2800 | 65 | UA | 2021, May |
23 | HNYY2 | Jinghong | Layer | Henan, Yuanyang | 44,000 | 65 | 2.4% | 2021, May |
24 | HNPDS | Hyline Brown | Layer | Henan, Pingdingshan | 5000 | 65 | 12.0% | 2021, May |
25 | HNLY2 | Jinghong | Layer | Henan, Luyi | 17,000 | 90 | 0.3% | 2021, June |
26 | HNZC4 | Hyline Brown | Layer | Henan, Zhecheng | 2700 | 90 | 14.8% | 2021, June |
27 | HNSX | Jinghong | Layer | Henan, Shanxian | 8000 | 90 | 8.0% | 2021, June |
28 | HNZC5 | Jinghong | Layer | Henan, Zhecheng | 6000 | 200 | UA | 2021, August |
29 | HNFQ | Hyline Brown | Layer | Henan, Fengqou | 12,000 | 70 | UA | 2021, September |
30 | HNWS | Muyuan Red | Layer | Henan, Weishi | 18,000 | 70 | 40.0% | 2021, September |
Virus | Target | Primer | Sequences ( 5′-3′) | Amplicon (bp) |
---|---|---|---|---|
MDV | meq | MDV-meq-F | ATGTCTCAGGAGCCAGAG | 1020 |
MDV-meq-R | TCAGGGTCTCCCGTCACC | |||
REV | LTR | REV-LTR-F | CATGCTTGCTTGCCTTAGC | 367 |
REV-LTR-R | CCTCTCACTGCCAATCTGAG | |||
gag | REV-gag-F | TCAGGCTGCCATAGTCATTC | 309 | |
REV-gag-R | TTCTTCTTCCAATGTCCCTC | |||
pol | REV-pol-F | AGCCTCTAAACTTACCTTCG | 475 | |
REV-pol-R | GTTGACGCTCTTGTCCTTGC |
No. | Poultry Farms | Breeds | Category | Positive rates of Three Pathogens | Diagnosis Results # | ||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|
MDV | ALV | REV | MDV | ALV | REV | M+A | M+R | A+R | M+A+R | ||||
1 | HNZMD | Liangfenghua | Broiler | 100% (12/12) | 100% (6/6) | 100% (6/6) | * | ||||||
2 | HNXZ1 | Partridge chicken | Layer | 100% (6/6) | 0% (0/6) | 0% (0/6) | * | ||||||
3 | HNZM | Partridge chicken | Broiler | 33.3% (4/12) | 16.7% (2/12) | 0% (0/12) | * | ||||||
4 | HNXZ2 | Liangfenghua | Breeder | 0% (0/7) | 71.4% (5/7) | 0% (0/7) | * | ||||||
5 | HNYY1 | Jinghong | Layer | 86.7% (13/15) | 0% (0/15) | 6.7% (1/15) | * | ||||||
6 | HNLK1 | Hyline Brown | Layer | 20% (3/15) | 0% (0/15) | 0% (0/15) | * | ||||||
7 | HNLK2 | Jinghong | Layer | 12.5% (1/8) | 0% (0/15) | 0% (0/8) | * | ||||||
8 | HNZC1 | Jinghong | Layer | 50% (3/6) | 0% (0/6) | 0% (0/6) | * | ||||||
9 | HNSQ1 | Jinghong | Layer | 92.7% (11/12) | 0% (0/12) | 0% (0/12) | * | ||||||
10 | HNLY1 | Jinghong | Layer | 75% (3/4) | 0% (0/4) | 25% (1/4) | * | ||||||
11 | HNYC1 | Jinghong | Layer | 100% (14/14) | 0% (0/14) | 0% (0/12) | * | ||||||
12 | SDCX1 | Jinghong | Layer | 100% (9/9) | 22.2% (2/9) | 0% (0/9) | * | ||||||
13 | SDSX | Jinghong | Layer | 54.5% (6/11) | 0% (0/11) | 0% (0/11) | * | ||||||
14 | SDCW | Hyline Brown | Layer | 94.1% (16/17) | 0% (0/17) | 0% (0/17) | * | ||||||
15 | SDCX2 | Jinghong | Layer | 100% (8/8) | 25% (1/4) | 0% (0/4) | * | ||||||
16 | HNSQ2 | Jinghong | Layer | 80% (4/5) | 0% (0/2) | 0% (0/2) | * | ||||||
17 | HNSC | Hyline Brown | Layer | 100% (14/14) | 14.3% (2/14) | 21.4% (3/14) | * | ||||||
18 | HNYC2 | Jinghong | Layer | 100% (14/14) | 0% (0/14) | 7.1% (1/14) | * | ||||||
19 | HNZC2 | Jinghong | Layer | 92.3% (12/13) | 15.4% (2/13) | 7.7% (1/13) | * | ||||||
20 | HNXZ3 | Partridge chicken | Breeder | 87.5% (7/8) | 0% (0/9) | 0% (0/8) | * | ||||||
21 | HNQX | Jinghong | Layer | 100% (9/9) | 0% (0/10) | 0% (0/9) | * | ||||||
22 | HNZC3 | Jinghong | Layer | 40% (2/5) | 0% (0/5) | 0% (0/5) | * | ||||||
23 | HNYY2 | Jinghong | Layer | 40% (2/5) | 0% (0/5) | 0% (0/5) | * | ||||||
24 | HNPDS | Hyline Brown | Layer | 16.7% (1/6) | 16.7% (1/6) | 0% (0/6) | * | ||||||
25 | HNLY2 | Jinghong | Layer | 100% (6/6) | 0% (0/6) | 0% (0/6) | * | ||||||
26 | HNZC4 | Hyline Brown | Layer | 100% (8/8) | 12.5% (1/8) | 0% (0/8) | * | ||||||
27 | HNSX | Jinghong | Layer | 100% (5/5) | 0% (0/5) | 0% (0/5) | * | ||||||
28 | HNZC5 | Jinghong | Layer | 71.4% (5/7) | 0% (0/7) | 0% (0/7) | * | ||||||
29 | HNFQ | Hyline Brown | Layer | 18.2% (2/11) | 18.2% (2/11) | 0% (0/11) | * | ||||||
30 | HNWS | Muyuan Red | Layer | 15% (3/20) | 90% (18/20) | 0% (0/20) | * | ||||||
Total | NA | NA | NA | 69.5% (203/292) | 14.4% (42/292) | 4.7% (13/277) | 53.3% (16/30) | 3.3% (1/30) | 0% (0/30) | 23.3% (7/30) | 10.0% (3/30) | 0% (0/30) | 10.0% (3/30) |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Zheng, L.-P.; Teng, M.; Li, G.-X.; Zhang, W.-K.; Wang, W.-D.; Liu, J.-L.; Li, L.-Y.; Yao, Y.; Nair, V.; Luo, J. Current Epidemiology and Co-Infections of Avian Immunosuppressive and Neoplastic Diseases in Chicken Flocks in Central China. Viruses 2022, 14, 2599. https://doi.org/10.3390/v14122599
Zheng L-P, Teng M, Li G-X, Zhang W-K, Wang W-D, Liu J-L, Li L-Y, Yao Y, Nair V, Luo J. Current Epidemiology and Co-Infections of Avian Immunosuppressive and Neoplastic Diseases in Chicken Flocks in Central China. Viruses. 2022; 14(12):2599. https://doi.org/10.3390/v14122599
Chicago/Turabian StyleZheng, Lu-Ping, Man Teng, Gui-Xi Li, Wen-Kai Zhang, Wei-Dong Wang, Jin-Ling Liu, Lin-Yan Li, Yongxiu Yao, Venugopal Nair, and Jun Luo. 2022. "Current Epidemiology and Co-Infections of Avian Immunosuppressive and Neoplastic Diseases in Chicken Flocks in Central China" Viruses 14, no. 12: 2599. https://doi.org/10.3390/v14122599
APA StyleZheng, L.-P., Teng, M., Li, G.-X., Zhang, W.-K., Wang, W.-D., Liu, J.-L., Li, L.-Y., Yao, Y., Nair, V., & Luo, J. (2022). Current Epidemiology and Co-Infections of Avian Immunosuppressive and Neoplastic Diseases in Chicken Flocks in Central China. Viruses, 14(12), 2599. https://doi.org/10.3390/v14122599