Redondoviridae: High Prevalence and Possibly Chronic Shedding in Human Respiratory Tract, But No Zoonotic Transmission
Abstract
:1. Introduction
2. Materials and Methods
2.1. The High-Risk Sentinel Cohort Study
2.2. Whole-Genome Amplification by Inverse PCR
2.3. PCR Screening and Genetic Characterization of Redondoviruses in Respiratory Samples and Animal Contacts
2.4. Phylogenetic Analysis
2.5. Nucleotide Sequence Accession Numbers
2.6. Statistics
2.7. Ethics
3. Results
3.1. Detection and Genetic Characterization of a Vientovirus
3.2. Detection of Redondoviruses in Respiratory Samples
3.3. The Genetic Diversity of Redondoviruses
3.4. Evidence of Possible Persistence of Redondoviruses in Nasopharynx
3.5. The Demographics of Participants with and without Redondoviruses Detected in at Least One of Their Longitudinal Samples Taken at Baseline and Disease Episodes
3.6. Clinical Symptoms of Redondovirus-Infected Patients during Disease Episodes
3.7. Coinfection in Samples Having Redondoviruses Detected with Other Respiratory Viruses
3.8. Detection of Redondoviruses in Respiratory Samples of Animals
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- WHO. Research Needs for the Battle Against Respiratory Viruses (BRaVe); WHO: Geneva, Switzerland, 2013; pp. 1–35. [Google Scholar]
- European Respiratory Society. The Global Impact of Respiratory Disease, 2nd ed.; European Respiratory Society: Lausanne, Switzerland, 2017. [Google Scholar]
- World Health Organisation. Coronavirus Disease (COVID-19) Situational Report 51. 2019. Available online: https://www.who.int/docs/default-source/coronaviruse/situation-reports/20200311-sitrep-51-covid-19.pdf?sfvrsn=1ba62e57_10 (accessed on 12 March 2020).
- Prasetyo, A.A.; Desyardi, M.N.; Tanamas, J.; Suradi; Reviono; Harsini; Kageyama, S.; Chikumi, H.; Shimizu, E. Respiratory Viruses and Torque Teno Virus in Adults with Acute Respiratory Infections. Intervirology 2015, 58, 57–68. [Google Scholar] [CrossRef] [PubMed]
- Vong, S.; Guillard, B.; Borand, L.; Rammaert, B.; Goyet, S.; Te, V.; Try, P.L.; Hem, S.; Rith, S.; Ly, S.; et al. Acute lower respiratory infections in ≥5 year -old hospitalized patients in Cambodia, a low-income tropical country: Clinical characteristics and pathogenic etiology. BMC Infect. Dis. 2013, 13, 97. [Google Scholar] [CrossRef] [Green Version]
- Tu, N.T.K.; The VIZIONS Consortium; Tue, N.T.; Vapalahti, O.; Virtala, A.-M.K.; Van Tan, L.; Rabaa, M.A.; Carrique-Mas, J.; Thwaites, G.E.; Baker, S. Occupational Animal Contact in Southern and Central Vietnam. EcoHealth 2019, 16, 759–771. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Anh, N.T.; Hong, N.T.T.; Nhu, L.N.T.; Thanh, T.T.; Lau, C.-Y.; Limmathurotsakul, D.; Deng, X.; Rahman, M.; Chau, N.V.V.; Van Doorn, H.R.; et al. Viruses in Vietnamese Patients Presenting with Community-Acquired Sepsis of Unknown Cause. J. Clin. Microbiol. 2019, 57, 1–13. [Google Scholar] [CrossRef] [Green Version]
- Abbas, A.A.; Taylor, L.J.; Dothard, M.I.; Leiby, J.S.; Fitzgerald, A.S.; Khatib, L.A.; Collman, R.G.; Bushman, F.D. Redondoviridae, a Family of Small, Circular DNA Viruses of the Human Oro-Respiratory Tract Associated with Periodontitis and Critical Illness. Cell Host Microbe 2019, 25, 719–729.e4. [Google Scholar] [CrossRef] [PubMed]
- International Committee on Taxonomy of Viruses (ICTV). Unclassified Viruses. Available online: https://talk.ictvonline.org/ictv-reports/ictv_online_report/unclassified-viruses/w/unclassified-viruses#Vertebrate (accessed on 17 April 2020).
- Spezia, P.G.; Macera, L.; Mazzetti, P.; Curcio, M.; Biagini, C.; Sciandra, I.; Turriziani, O.; Lai, M.; Antonelli, G.; Pistello, M.; et al. Redondovirus DNA in human respiratory samples. J. Clin. Virol. 2020, 131, 104586. [Google Scholar] [CrossRef] [PubMed]
- Lázaro-Perona, F.; Dahdouh, E.; Román-Soto, S.; Jiménez-Rodríguez, S.; Rodríguez-Antolín, C.; De La Calle, F.; Agrifoglio, A.; Membrillo, F.J.; García-Rodríguez, J.; Mingorance, J. Metagenomic Detection of Two Vientoviruses in a Human Sputum Sample. Viruses 2020, 12, 327. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Cui, L.; Wu, B.; Zhu, X.; Guo, X.; Ge, Y.; Zhao, K.; Qi, X.; Shi, Z.; Zhu, F.; Sun, L.; et al. Identification and genetic characterization of a novel circular single-stranded DNA virus in a human upper respiratory tract sample. Arch. Virol. 2017, 162, 3305–3312. [Google Scholar] [CrossRef] [PubMed]
- Nguyen, T.T.K.; Ngo, T.T.; Tran, P.M.; Pham, T.T.T.; Vu, H.T.T.; Nguyen, N.T.H.; Thwaites, G.; Virtala, A.K.; Vapalahti, O.; Baker, S.; et al. Respiratory viruses in individuals with a high frequency of animal exposure in southern and highland Vietnam. J. Med Virol. 2019, 92, 971–981. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Salter, S.J.; Cox, M.J.; Turek, E.M.; Calus, S.T.; Cookson, W.O.; Moffatt, M.F.; Turner, P.; Parkhill, J.; Loman, N.J.; Walker, A.W. Reagent and laboratory contamination can critically impact sequence-based microbiome analyses. BMC Biol. 2014, 12, 1–12. [Google Scholar] [CrossRef] [Green Version]
- Asplund, M.; Kjartansdóttir, K.; Mollerup, S.; Vinner, L.; Fridholm, H.; Herrera, J.; Friis-Nielsen, J.; Hansen, T.; Jensen, R.; Nielsen, I.; et al. Contaminating viral sequences in high-throughput sequencing viromics: A linkage study of 700 sequencing libraries. Clin. Microbiol. Infect. 2019, 25, 1277–1285. [Google Scholar] [CrossRef] [Green Version]
- Thi Kha Tu, N.; Thi Thu Hong, N.; Thi Han Ny, N.; My Phuc, T.; Thi Thanh Tam, P.; Doorn, H.R.v.; Dang Trung Nghia, H.; Thao Huong, D.; An Han, D.; Thi Thu Ha, L.; et al. The Virome of Acute Respiratory Diseases in Individuals at Risk of Zoonotic Infections. Viruses 2020, 12, 960. [Google Scholar] [CrossRef] [PubMed]
- Benjamini, Y.; Hochberg, Y. Controlling the False Discovery Rate—A Practical and Powerful Approach to Multiple Testing. J. R. Stat. Soc. Ser. B Methodol. 1995, 57, 289–300. [Google Scholar] [CrossRef]
- Seed-Based d Mapping. FDR Online Calculator. 2020. Available online: https://www.sdmproject.com/utilities/?show=FDR (accessed on 15 December 2020).
- Carrique-Mas, J.J.; Tue, N.T.; Bryant, J.E.; Saylors, K.; Cuong, N.V.; Hoa, N.T.; An, N.N.; Hien, V.B.; Lao, P.V.; Tu, N.C.; et al. The baseline characteristics and interim analyses of the high-risk sentinel cohort of the Vietnam Initiative on Zoonotic InfectiONS (VIZIONS). Sci. Rep. 2015, 5, 17965. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Li, L.; Shan, T.; Soji, O.B.; Alam, M.M.; Kunz, T.H.; Zaidi, S.Z.; Delwart, E. Possible cross-species transmission of circoviruses and cycloviruses among farm animals. J. Gen. Virol. 2010, 92, 768–772. [Google Scholar] [CrossRef] [PubMed]
- Li, L.; Kapoor, A.; Slikas, B.; Bamidele, O.S.; Wang, C.; Shaukat, S.; Alam Masroor, M.; Wilson, M.L.; Ndjango, J.-B.N.; Peeters, M.; et al. Multiple Diverse Circoviruses Infect Farm Animals and Are Commonly Found in Human and Chimpanzee Feces. J. Virol. 2009, 84, 1674–1682. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Hetzel, U.; Szirovicza, L.; Smura, T.; Prähauser, B.; Vapalahti, O.; Kipar, A.; Hepojoki, J. Identification of a Novel Deltavirus in Boa Constrictors. mBio 2019, 10, e00014-19. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Szirovicza, L.; Hetzel, U.; Kipar, A.; Martinez-Sobrido, L.; Vapalahti, O.; Hepojoki, J. Snake Deltavirus Utilizes Envelope Proteins of Different Viruses To Generate Infectious Particles. mBio 2020, 11. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Brunborg, I.M.; Moldal, T.; Jonassen, C.M. Quantitation of porcine circovirus type 2 isolated from serum/plasma and tissue samples of healthy pigs and pigs with postweaning multisystemic wasting syndrome using a TaqMan-based real-time PCR. J. Virol. Methods 2004, 122, 171–178. [Google Scholar] [CrossRef] [PubMed]
- Cuong, N.V.; Carrique-Mas, J.; Thu, H.T.V.; Hien, N.D.; Hoa, N.T.; Nguyet, L.A.; Anh, P.H.; Bryant, J. Serological and virological surveillance for porcine reproductive and respiratory syndrome virus, porcine circovirus type 2, and influenza A viruses among smallholder swine farms of the Mekong Delta, Vietnam. J. Swine Health Prod. 2014, 22, 224–231. [Google Scholar]
Primer Name | For Purpose | Sequence | PCR Products (bp) | Target (Regions) | Thermal Cycles |
---|---|---|---|---|---|
Vientovirus VZ-inverse_F | Whole genome | TATTTGTGGCCTTACTCCTTGT | 3000 | Replication gene (2628–2649′) | 95 °C for 2 m; 45 cycles of 95 °C for 15 s, 52 °C for 30 s, 72 °C for 2 m 45 s; 72 °C for 5 m |
Vientovirus VZ-inverse_R | Whole genome | GGACATATAGCAGAAAAAGGTGATG | Replication gene (2577–2552′) | ||
Vientovirus VZ-walking_F | Whole genome | AGACTTGCTTCTATGGTTTGTAGT | 1400 | Capsid gene (268–291′) | 95 °C for 2 m; 45 cycles of 95 °C for 15 s, 48 °C for 30 s, 72 °C for 2 m; 72 °C for 5 m |
Vientovirus VZ-walking_R | Whole genome | TGATACACAATTCTTTTACCGTTGT | Capsid gene (1777–1752′) | ||
Vientovirus VZ-close gap_F | Whole genome | GGGGCCCTTGAACCACATTA | 750 | Replication gene (2352–2372′) | 95 °C for 2 m; 45 cycles of 95 °C for 15 s, 52 °C for 30 s, 72 °C for 1 m 15 s; 72 °C for 5 m |
Vientovirus VZ-close gap_R | Whole genome | GCAGCCCTCTTAAGCCTGTA | Replication gene (132–112′) | ||
Redondovirus-capsid gene_F | PCR screening | GGCTTAAGAGGGCTGCTAGG | 460 | Capsid gene (116–136′) | 95 °C for 5 m; 45 cycles of 95 °C for 20 s, 52 °C for 30 s, 72 °C for 1 m; 72 °C for 5 m |
Redondovirus-capsid gene_R | TCCTTGGATGCCATGAAACT | Capsid gene (575–555′) | |||
Redondovirus-replication gene_F | Genetic characterization | GTTGTCACTTGTGAAACGATGA | 1400 | Replication gene (1711–1733′) | 95 °C for 5 m; 45 cycles of 95 °C for 20 s, 50 °C for 30 s, 72 °C for 2 m; 72 °C for 5 m |
Redondovirus-replication gene_R | TCGACGATAAACTCTCTTTCTTGA | Replication gene (43–19′) |
Redondoviruses Negative | Redondoviruses Positive | Total | ||||
---|---|---|---|---|---|---|
Brisavirus | Vientovirus | Undefined * | Subtotal | |||
Study participants ^ | 25 | 9 | 23 | 1 | 33 | 58 |
Baseline samples | 29 | 6 | 20 | 3 | 29 | 58 |
Disease-episode samples | 61 | 9 | 18 | 3 | 30 | 91 |
Study Year 2013 | |||||||
---|---|---|---|---|---|---|---|
Baseline | Disease Episode 1 | Disease Episode 2 | Disease Episode 3 | Disease Episode 4 | Disease Episode 5 | Duration of Persistence (Days) | |
Participant ID 60-07 | VienV VZ 14-Apr | VienV VZ 09-Jul | VienV S39 11-Sep | VienV S39 26-Sep | RedonV 15-NoV | VienV S39 18-Dec | 86 and 98, respectively |
Participant ID 48-01 | VienV S19 14-Apr | VienV S19 10-Jul | 87 | ||||
Participant ID 81-15 | VienV S8 29-Mar | VienV S8 18-Jun | 81 | ||||
Participant ID 49-01 | VienV S15 14-Apr | VienV S15 20-Jun | 67 | ||||
Participant ID 51-02 | VienV S17 14-Apr | VienV S17 20-Jun | 67 | ||||
Participant ID 22-01 | BrisaV S32 29-Mar | BrisaV S32 08-Aug | 132 | ||||
Participant ID 81-23 | BrisaV S4 07-Apr | BrisaV S4 05-Jun | 10-Jul | 59 | |||
Participant ID 61-05 | RedonV 14-Apr | BrisaV S56 18-Oct | RedonV 08-Nov | BrisaV S56 25-Nov | 38 | ||
Participant ID 60-12 | 14-Apr | BrisaV S83 19-Nov | BrisaV S83 24-Dec | 35 |
Total | Redondoviruses Positive * | Redondoviruses Negative | p-Value | |
---|---|---|---|---|
Number of participants | 58 | 33 | 25 | NA ^ |
Having chronic diseases (%) | 4 (6.9) | 1 (3) | 3 (12) | 0.3 |
Occupation (%) | ||||
Animal-raising farmer | 26 (44.8) | 13 (39.4) | 13 (52) | 0.3 |
Animal-health worker | 12 (20.7) | 5 (15.2) | 7 (28) | 0.1 |
Slaughterer | 18 (31) | 15 (45.5) | 3 (12) | 0.02 |
Rat trader | 2 (3.4) | 0 (0) | 2(8) | NA |
Females/males (ratio) | 16/42 (0.4) | 11/22 (0.5) | 6/19 (0.3) | 1 |
Median age in year (range) | 35.5 (7–76) | 43.8 (23–76) | 33.8 (7–72) | 0.02# |
No. of Disease Episodes | Redondoviruses Positive | Redondoviruses Negative | p-Value # | ||||
---|---|---|---|---|---|---|---|
Total | Brisavirus * | Vientovirus * | p-Value | ||||
N = 91 | N = 30 | N = 9 | N = 18 | NA | N = 61 | NA | |
Fever | 91 (100) | 30 (100) | 9 (100) | 18 (100) | 1 | 61 (100) | 1 |
Cough | 75 (82.4) | 24 (80) | 8 (88.9) | 14 (77.8) | 1 | 51 (83.6) | 1 |
Sneezing | 69 (75.8) | 22 (73.3) | 5 (55.6) | 15 (83.3) | 0.743 | 47 (77.0) | 1 |
Sore throat | 49 (53.8) | 19 (63.3) | 5 (55.6) | 13 (72.2) | 1 | 30 (49.2) | 1 |
Dyspnea | 9 (9.9) | 3 (10.0) | 1 (11.1) | 2 (11.1) | 1 | 6 (9.8) | 1 |
Headache | 57 (62.6) | 24 (80.0) | 8 (88.9) | 14 (77.8) | 1 | 33 (54.1) | 0.243 |
Body aches | 47 (51.6) | 19 (63.3) | 9 (100) | 10 (55.6) | 0.261 | 28 (45.9) | 0.666 |
Watery diarrhea | 11 (12.1) | 4 (13.3) | 2 (22.2) | 2 (11.1) | 1 | 7 (11.5) | 1 |
Nausea | 2 (2.2) | 0 (0) | 0 (0) | 0 (0) | NA | 2 (3.3) | NA |
Redondoviruses Positive * | Redondoviruses Negative | p-Value # | ||||
---|---|---|---|---|---|---|
Total | Brisavirus | Vientovirus | p-Value | |||
33 | 9 | 23 | NA | 25 | NA | |
Gemycircularvirus VIZIONS-2013 ^ | 8 (24.2) | 2 (22.2) | 5 (21.7) | 1 | 7 (28) | 0.7 |
Cyclovirus VIZIONS-2013 | 4 (12.1) | 1 (11.1) | 3 (13) | 1 | 5 (20) | 0.5 |
Rhinovirus | 4 (12.1) | 0 (0) | 4 (17.4) | 0.3 | 1 (4) | 0.4 |
Respiratory syncytial virus A | 2 (6.1) | 0 (0) | 2 (8.7) | 1 | 0 (0) | 0.5 |
Statovirus VIZIONS-2013 | 2 (6.1) | 1 (11.1) | 1 (4.3) | 0.5 | 0 (0) | 0.5 |
Statovirus | 2 (6.1) | 0 (0) | 2 (8.7) | 1 | 0 (0) | 0.5 |
Enterovirus | 1 (3) | 0 (0) | 1 (4.3) | 1 | 1 (4) | 1 |
Influenza A virus | 1 (3) | 1 (11.1) | 0 (0) | 0.3 | 0 (0) | 1 |
Metapneumovirus | 1 (3) | 0 (0) | 1 (4.3) | 1 | 0 (0) | 1 |
Gemycircularvirus | 1 (3) | 0 (0) | 1 (4.3) | 1 | 0 (0) | 1 |
Coronavirus OC43 | 0 (0) | 0 (0) | 0 (0) | NA | 1 (4) | 0.4 |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2021 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Tu, N.T.K.; Deng, X.; Hong, N.T.T.; Ny, N.T.H.; Phuc, T.M.; Tam, P.T.T.; Han, D.A.; Ha, L.T.T.; Thwaites, G.; Doorn, H.R.v.; et al. Redondoviridae: High Prevalence and Possibly Chronic Shedding in Human Respiratory Tract, But No Zoonotic Transmission. Viruses 2021, 13, 533. https://doi.org/10.3390/v13040533
Tu NTK, Deng X, Hong NTT, Ny NTH, Phuc TM, Tam PTT, Han DA, Ha LTT, Thwaites G, Doorn HRv, et al. Redondoviridae: High Prevalence and Possibly Chronic Shedding in Human Respiratory Tract, But No Zoonotic Transmission. Viruses. 2021; 13(4):533. https://doi.org/10.3390/v13040533
Chicago/Turabian StyleTu, Nguyen Thi Kha, Xutao Deng, Nguyen Thi Thu Hong, Nguyen Thi Han Ny, Tran My Phuc, Pham Thi Thanh Tam, Duong An Han, Luu Thi Thu Ha, Guy Thwaites, H. Rogier van Doorn, and et al. 2021. "Redondoviridae: High Prevalence and Possibly Chronic Shedding in Human Respiratory Tract, But No Zoonotic Transmission" Viruses 13, no. 4: 533. https://doi.org/10.3390/v13040533
APA StyleTu, N. T. K., Deng, X., Hong, N. T. T., Ny, N. T. H., Phuc, T. M., Tam, P. T. T., Han, D. A., Ha, L. T. T., Thwaites, G., Doorn, H. R. v., Virtala, A.-M. K., Delwart, E., Baker, S., Vapalahti, O., Tan, L. V., & on behalf of the VIZIONS Consortium. (2021). Redondoviridae: High Prevalence and Possibly Chronic Shedding in Human Respiratory Tract, But No Zoonotic Transmission. Viruses, 13(4), 533. https://doi.org/10.3390/v13040533