Production of Recombinant African Swine Fever Viruses: Speeding Up the Process
Abstract
1. Introduction
2. Materials and Methods
2.1. Cells and Viruses
2.2. Production of Recombinant ASFV Benin∆EP153R∆EP402R∆DP148R
2.2.1. Transfer Plasmid
2.2.2. Homologous Recombination—Infection/Transfection
2.2.3. Single Cell Isolation via FACS
2.2.4. Viral Genomic DNA Extraction and PCRs
2.2.5. Limiting Dilutions, Propagations and Titrations
3. Results and Discussion
Supplementary Materials
Author Contributions
Funding
Acknowledgments
Conflicts of Interest
References
- Netherton, C.L.; Connell, S.; Benfield, C.T.O.; Dixon, L.K. The Genetics of Life and Death: Virus-Host Interactions Underpinning Resistance to African Swine Fever, a Viral Hemorrhagic Disease. Front. Genet. 2019, 10. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- FAO. Report on African Swine Fever (ASF) in Asia and the Pacific. In Proceedings of the FAO Regional Conference for Asia and the Pacific, Thimphu, Bhutan, 17–20 February 2020. [Google Scholar]
- Arias, M.; De la Torre, A.; Dixon, L.; Gallardo, C.; Jori, F.; Laddomada, A.; Martins, C.; Parkhouse, R.M.; Revilla, Y.; Rodriguez, F.; et al. Approaches and Perspectives for Development of African Swine Fever Virus Vaccines. Vaccines 2017, 5, 35. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Arias, M.; Jurado, C.; Gallardo, C.; Fernández-Pinero, J.; Sánchez-Vizcaíno, J.M. Gaps in African swine fever: Analysis and priorities. Transbound. Emerg. Dis. 2018, 65, 235–247. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Rodríguez, J.M.; Almazán, F.; Viñuela, E.; Rodriguez, J.F. Genetic manipulation of African swine fever virus: Construction of recombinant viruses expressing the β-galactosidase gene. Virology 1992, 188, 67–76. [Google Scholar] [CrossRef] [Scilit]
- Gómez-Puertas, P.; Rodríguez, F.; Ortega, A.; Oviedo, J.M.; Alonso, C.; Escribano, J.M. Improvement of African swine fever virus neutralization assay using recombinant viruses expressing chromogenic marker genes. J. Virol. Methods 1995, 55, 271–279. [Google Scholar] [CrossRef] [Scilit]
- Zsak, L.; Lu, Z.; Kutish, G.F.; Neilan, J.G.; Rock, D.L. An African swine fever virus virulence-associated gene NL-S with similarity to the herpes simplex virus ICP34.5 gene. J. Virol. 1996, 70, 8865–8871. [Google Scholar] [CrossRef] [Scilit]
- Neilan, J.G.; Lu, Z.; Kutish, G.F.; Zsak, L.; Burrage, T.G.; Borca, M.V.; Carrillo, C.; Rock, D.L. A BIR Motif Containing Gene of African Swine Fever Virus, 4CL, Is Nonessential for Growthin Vitroand Viral Virulence. Virology 1997, 230, 252–264. [Google Scholar] [CrossRef] [Scilit]
- Afonso, C.L.; Zsak, L.; Carrillo, C.; Borca, M.V.; Rock, D.L. African swine fever virus NL gene is not required for virus virulence. J. Gen. Virol. 1998, 79, 2543–2547. [Google Scholar] [CrossRef] [Scilit]
- Hernaez, B.; Escribano, J.M.; Alonso, C. Visualization of the African swine fever virus infection in living cells by incorporation into the virus particle of green fluorescent protein-p54 membrane protein chimera. Virology 2006, 350, 1–14. [Google Scholar] [CrossRef] [Scilit]
- Portugal, R.; Martins, C.; Keil, G.M. Novel approach for the generation of recombinant African swine fever virus from a field isolate using GFP expression and 5-bromo-2′-deoxyuridine selection. J. Virol. Methods 2012, 183, 86–89. [Google Scholar] [CrossRef] [Scilit]
- O’Donnell, V.; Holinka, L.G.; Sanford, B.; Krug, P.W.; Carlson, J.; Pacheco, J.M.; Reese, B.; Risatti, G.R.; Gladue, D.P.; Borca, M.V. African swine fever virus Georgia isolate harboring deletions of 9GL and MGF360/505 genes is highly attenuated in swine but does not confer protection against parental virus challenge. Virus Res. 2016, 221, 8–14. [Google Scholar] [CrossRef] [Scilit]
- Borca, M.V.; O’Donnell, V.; Holinka, L.G.; Sanford, B.; Azzinaro, P.A.; Risatti, G.R.; Gladue, D.P. Development of a fluorescent ASFV strain that retains the ability to cause disease in swine. Sci. Rep. 2017, 7, 46747. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Chen, W.; Zhao, D.; He, X.; Liu, R.; Wang, Z.; Zhang, X.; Li, F.; Shan, D.; Chen, H.; Zhang, J.; et al. A seven-gene-deleted African swine fever virus is safe and effective as a live attenuated vaccine in pigs. Sci. China Life Sci. 2020, 63, 623–634. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Abrams, C.C.; Dixon, L.K. Sequential deletion of genes from the African swine fever virus genome using the cre/loxP recombination system. Virology 2012, 433, 142–148. [Google Scholar] [CrossRef] [Scilit]
- Borca, M.V.; Holinka, L.G.; Berggren, K.A.; Gladue, D.P. CRISPR-Cas9, a tool to efficiently increase the development of recombinant African swine fever viruses. Sci. Rep. 2018, 8, 1–6. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Chapman, D.A.G.; Darby, A.C.; Da Silva, M.; Upton, C.; Radford, A.D.; Dixon, L.K. Genomic analysis of highly virulent Georgia 2007/1 isolate of African swine fever virus. Emerg. Infect. Dis. 2011, 17, 599–605. [Google Scholar] [CrossRef] [Scilit]
- Reis, A.L.; Goatley, L.C.; Jabbar, T.; Sanchez-Cordon, P.J.; Netherton, C.L.; Chapman, D.A.G.; Dixon, L.K. Deletion of the African Swine Fever Virus Gene DP148R Does Not Reduce Virus Replication in Culture but Reduces Virus Virulence in Pigs and Induces High Levels of Protection against Challenge. J. Virol. 2017, 91, e01428-17. [Google Scholar] [CrossRef] [Scilit]
- Enjuanes, L.; Carrascosa, A.L.; Moreno, M.A.; Viñuela, E. Titration of African Swine Fever (ASF) Virus. J. Gen. Virol. 1976, 32, 471–477. [Google Scholar] [CrossRef] [Scilit]
- Hierholzer, J.; Killington, R. Virus isolation and quantitation. In Virology Methods Manual; Elsevier: Amsterdam, The Netherlands, 1996; pp. 25–46. [Google Scholar]
- Shaner, N.C.; Lambert, G.G.; Chammas, A.; Ni, Y.; Cranfill, P.J.; Baird, M.A.; Sell, B.R.; Allen, J.R.; Day, R.N.; Israelsson, M.; et al. A bright monomeric green fluorescent protein derived from Branchiostoma lanceolatum. Nat. Methods 2013, 10, 407–409. [Google Scholar] [CrossRef] [Scilit]
- Portugal, R.S.; Bauer, A.; Keil, G.M. Selection of differently temporally regulated African swine fever virus promoters with variable expression activities and their application for transient and recombinant virus mediated gene expression. Virology 2017, 508, 70–80. [Google Scholar] [CrossRef] [Scilit]
- World Organisation for Animal Health. Technical Disease Card for African Swine Fever; OIE: Paris, France, 2019; Available online: https://www.oie.int/animal-health-in-the-world/technical-disease-cards/ (accessed on 30 April 2020).
- Almazán, F.; Rodríguez, J.M.; Andrés, G.; Pérez, R.; Viñuela, E.; Rodriguez, J.F. Transcriptional analysis of multigene family 110 of African swine fever virus. J. Virol. 1992, 66, 6655–6667. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Cackett, G.; Matelska, D.; Sýkora, M.; Portugal, R.; Malecki, M.; Bähler, J.; Dixon, L.; Werner, F. The African Swine Fever Virus Transcriptome. J. Virol. 2020, 94, e00119-20. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Zhang, X.; Edwards, J.P.; Mosser, D.M. The expression of exogenous genes in macrophages: Obstacles and opportunities. In Macrophages and Dendritic Cells; Humana Press: Totowa, NJ, USA, 2009; pp. 123–143. [Google Scholar]
- Warwick, C.A.; Usachev, Y.M. Culture, Transfection, and Immunocytochemical Analysis of Primary Macrophages. In Signal Transduction Immunohistochemistry: Methods and Protocols; Kalyuzhny, A.E., Ed.; Springer: New York, NY, USA, 2017; pp. 161–173. [Google Scholar] [CrossRef] [Scilit]
- Hernaez, B.; Alonso, C. Dynamin- and Clathrin-Dependent Endocytosis in African Swine Fever Virus Entry. J. Virol. 2010, 84, 2100–2109. [Google Scholar] [CrossRef] [Scilit]
- de León, P.; Bustos, M.J.; Carrascosa, A.L. Laboratory methods to study African swine fever virus. Virus Res. 2013, 173, 168–179. [Google Scholar] [CrossRef] [Scilit]
- Kotani, H.; NewtonIII, P.B.; Zhang, S.; Chiang, Y.L.; Otto, E.; Weaver, L.; Blaese, R.M.; Anderson, W.F.; McGarrity, G.J. Improved Methods of Retroviral Vector Transduction and Production for Gene Therapy. Hum. Gene Ther. 1994, 5, 19–28. [Google Scholar] [CrossRef] [Scilit]
- Verma, R.S.; Giannola, D.; Shlomchik, W.; Emerson, S.G. Increased Efficiency of Liposome-Mediated Transfection by Volume Reduction and Centrifugation. BioTechniques 1998, 25, 46–49. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Borca, M.V.; Carrillo, C.; Zsak, L.; Laegreid, W.W.; Kutish, G.F.; Neilan, J.G.; Burrage, T.G.; Rock, D.L. Deletion of a CD2-Like Gene, 8-DR, from African Swine Fever Virus Affects Viral Infection in Domestic Swine. J. Virol. 1998, 72, 2881–2889. [Google Scholar] [CrossRef] [Scilit]
- Monteagudo, P.L.; Lacasta, A.; López, E.; Bosch, L.; Collado, J.; Pina-Pedrero, S.; Correa-Fiz, F.; Accensi, F.; Navas, M.J.; Vidal, E.; et al. BA71ΔCD2: A New Recombinant Live Attenuated African Swine Fever Virus with Cross-Protective Capabilities. J. Virol. 2017, 91, e01058-17. [Google Scholar] [CrossRef] [Scilit]
- Borca, M.V.; O’Donnell, V.; Holinka, L.G.; Risatti, G.R.; Ramirez-Medina, E.; Vuono, E.A.; Shi, J.; Pruitt, S.; Rai, A.; Silva, E.; et al. Deletion of CD2-like gene from the genome of African swine fever virus strain Georgia does not attenuate virulence in swine. Sci. Rep. 2020, 10, 494. [Google Scholar] [CrossRef] [Scilit]
- Galindo, I.; Almazán, F.; Bustos, M.J.; Viñuela, E.; Carrascosa, A.L. African Swine Fever Virus EP153R Open Reading Frame Encodes a Glycoprotein Involved in the Hemadsorption of Infected Cells. Virology 2000, 266, 340–351. [Google Scholar] [CrossRef] [Scilit]
- Hurtado, C.; Bustos, M.J.; Granja, A.G.; de León, P.; Sabina, P.; López-Viñas, E.; Gómez-Puertas, P.; Revilla, Y.; Carrascosa, A.L. The African swine fever virus lectin EP153R modulates the surface membrane expression of MHC class I antigens. Arch. Virol. 2011, 156, 219–234. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Rodríguez, J.M.; Yáñez, R.J.; Almazán, F.; Viñuela, E.; Rodriguez, J.F. African swine fever virus encodes a CD2 homolog responsible for the adhesion of erythrocytes to infected cells. J. Virol. 1993, 67, 5312–5320. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- King, K.; Chapman, D.; Argilaguet, J.M.; Fishbourne, E.; Hutet, E.; Cariolet, R.; Hutchings, G.; Oura, C.A.L.; Netherton, C.L.; Moffat, K.; et al. Protection of European domestic pigs from virulent African isolates of African swine fever virus by experimental immunisation. Vaccine 2011, 29, 4593–4600. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Shaner, N.C.; Lin, M.Z.; McKeown, M.R.; Steinbach, P.A.; Hazelwood, K.L.; Davidson, M.W.; Tsien, R.Y. Improving the photostability of bright monomeric orange and red fluorescent proteins. Nat. Methods 2008, 5, 545–551. [Google Scholar] [CrossRef] [Scilit] [PubMed]




| Gene Target | Primer Sequence (5′-3′) | Genome Position a | Expected PCR Product Size (bp b) |
|---|---|---|---|
| DP148R | |||
| Forward | GTCCGCAACAAGGCTATTGAG | 178,296–178,602 | 307 |
| Reverse | GACGTTTACGCAGTGGGGC | ||
| EP153R | |||
| Forward | GATTGGAACTAATATGATAACTC | 67,137–67,433 | 297 |
| Reverse | TCACCACGTAATATTACCGT | ||
| EP402R | |||
| Forward | GTTCATGTTGTGGTCATAACATATC | 67,763–68,365 | 603 |
| Reverse | GAGATGGTTCATGTATGGAAGTG | ||
| GUS | |||
| Forward | GGTCCGTCCTGTAGAAACCCCAA | -- | 907 |
| Reverse | GCCACGCAAGTCCGCATCTTCATG | ||
| mNeonGreen | |||
| Forward | TACACATCTTTGGCTCCATC | -- | 634 |
| Reverse | CCCATCACATCGGTAAAGG |
| Primer Name | Primer Sequence (5′-3′) | Genome Position a |
|---|---|---|
| Del_EP153R_CD2v-SeqF1 | CTTTGCCGTAGAAACAATACA | 65,867 |
| Del_EP153R_CD2v-SeqR3 | TCAGGCTGTGTTCAATAA | 69,978 |
| mNG_SeqR | CCATGTCAAAGTCCACACCG | -- |
| mNG_SeqF | CCAATGGCGGCTAACTATCTG | -- |
© 2020 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Rathakrishnan, A.; Moffat, K.; Reis, A.L.; Dixon, L.K. Production of Recombinant African Swine Fever Viruses: Speeding Up the Process. Viruses 2020, 12, 615. https://doi.org/10.3390/v12060615
Rathakrishnan A, Moffat K, Reis AL, Dixon LK. Production of Recombinant African Swine Fever Viruses: Speeding Up the Process. Viruses. 2020; 12(6):615. https://doi.org/10.3390/v12060615
Chicago/Turabian StyleRathakrishnan, Anusyah, Katy Moffat, Ana Luisa Reis, and Linda K. Dixon. 2020. "Production of Recombinant African Swine Fever Viruses: Speeding Up the Process" Viruses 12, no. 6: 615. https://doi.org/10.3390/v12060615
APA StyleRathakrishnan, A., Moffat, K., Reis, A. L., & Dixon, L. K. (2020). Production of Recombinant African Swine Fever Viruses: Speeding Up the Process. Viruses, 12(6), 615. https://doi.org/10.3390/v12060615

