Interferon-λ Attenuates Rabies Virus Infection by Inducing Interferon-Stimulated Genes and Alleviating Neurological Inflammation
Abstract
1. Introduction
2. Materials and Methods
2.1. Viruses, Cell Lines, Antibodies, and Animals
2.2. Treatment with Recombinant Murine IFN-λ
2.3. Isolation of Primary Astrocytes
2.4. Isolation of Primary Microglia
2.5. Construction and Rescue of Recombinant RABVs Expressing Murine IFN-λ
2.6. Fluorescence Morphologies of rRABV-Infected Cells
2.7. Virus Titration
2.8. ELISA
2.9. Quantitative Real-Time PCR (qRT-PCR)
2.10. Western Blot
2.11. Pathogenicity Studies
2.12. Luciferase Reporter Assay
2.13. Quantification of Cytokine Production
2.14. Transendothelial Permeability Assay
2.15. Immunohistochemistry (IHC) and Immunofluorescence
2.16. Measurement of BBB Permeability
2.17. Statistical Analysis
3. Results
3.1. IFN-λ Treatment Inhibits RABV Replication In Vitro
3.2. IFN-λ Attenuates the Pathogenicity of RABV In Vivo
3.3. IFN-λ Limits RABV Replication by Enhancing the Expression of ISGs
3.4. IFN-λ Avoids the Production of Excessive Inflammatory Cytokines
3.5. IFN-λ Restricts Infiltration of Inflammatory Cells into the CNS by Decreasing BBB Permeability
3.6. IFN-λ Maintains Endothelial Barrier Integrity
4. Discussion
Author Contributions
Funding
Acknowledgments
Conflicts of Interest
References
- Fooks, A.R.; Banyard, A.C.; Horton, D.L.; Johnson, N.; McElhinney, L.M.; Jackson, A.C. Current status of rabies and prospects for elimination. Lancet 2014, 384, 1389–1399. [Google Scholar] [CrossRef] [Scilit]
- Lafon, M. Rabies virus receptors. J. Neurovirol. 2005, 11, 82–87. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Dewitteorr, S.J.; Mosssman, K.L. dsRNA and the innate antiviral immune response. Future Virol. 2010, 5, 325–341. [Google Scholar] [CrossRef] [Scilit]
- Myoung, J.; Lee, S.A.; Lee, H.R. Beyond viral interferon regulatory factors: Immune evasion strategies. J. Microbiol. Biotechnol. 2019, 29, 1873–1881. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Faul, E.J.; Wanjalla, C.N.; Suthar, M.S.; Gale, M.; Wirblich, C.; Schnell, M.J. Rabies virus infection induces type I interferon production in an IPS-1 dependent manner while dendritic cell activation relies on IFNAR signaling. PLoS Pathog. 2010, 6, e1001016. [Google Scholar] [CrossRef] [Scilit]
- Hornung, V.; Ellegast, J.; Kim, S.; Brzozka, K.; Jung, A.; Kato, H.; Poeck, H.; Akira, S.; Conzelmann, K.K.; Schlee, M.; et al. 5′-Triphosphate RNA is the ligand for RIG-I. Science 2006, 314, 994–997. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Goodbourn, S.; Didcock, L.; Randall, R.E. Interferons: Cell signalling, immune modulation, antiviral response and virus countermeasures. J. Gen. Virol. 2000, 81, 2341–2364. [Google Scholar] [CrossRef] [Scilit]
- Der, S.D.; Zhou, A.; Williams, B.R.; Silverman, R.H. Identification of genes differentially regulated by interferon alpha, beta, or gamma using oligonucleotide arrays. Proc. Natl. Acad. Sci. USA 1998, 95, 15623–15628. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Nice, T.J.; Baldridge, M.T.; McCune, B.T.; Norman, J.M.; Lazear, H.M.; Artyomov, M.; Diamond, M.S.; Virgin, H.W. Interferon-lambda cures persistent murine norovirus infection in the absence of adaptive immunity. Science 2015, 347, 269–273. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Ank, N.; West, H.; Bartholdy, C.; Eriksson, K.; Thomsen, A.R.; Paludan, S.R. Lambda interferon (IFN-lambda), a type III IFN, is induced by viruses and IFNs and displays potent antiviral activity against select virus infections in vivo. J. Virol. 2006, 80, 4501–4509. [Google Scholar] [CrossRef] [Scilit]
- Tian, D.; Luo, Z.; Zhou, M.; Li, M.; Yu, L.; Wang, C.; Yuan, J.; Li, F.; Tian, B.; Sui, B.; et al. Critical role of k1685 and k1829 in the large protein of rabies virus in viral pathogenicity and immune evasion. J. Virol. 2016, 90, 232–244. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Tian, B.; Zhou, M.; Yang, Y.; Yu, L.; Luo, Z.; Tian, D.; Wang, K.; Cui, M.; Chen, H.; Fu, Z.F.; et al. Lab-attenuated rabies virus causes abortive infection and induces cytokine expression in astrocytes by activating mitochondrial antiviral-signaling protein signaling pathway. Front. Immunol. 2017, 8, 2011. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Davis, B.M.; Fensterl, V.; Lawrence, T.M.; Hudacek, A.W.; Sen, G.C.; Schnell, M.J. Ifit2 Is a restriction factor in rabies virus pathogenicity. J. Virol. 2017, 91. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Zhao, L.; Toriumi, H.; Kuang, Y.; Chen, H.; Fu, Z.F. The roles of chemokines in rabies virus infection: Overexpression may not always be beneficial. J. Virol. 2009, 83, 11808–11818. [Google Scholar] [CrossRef] [Scilit]
- Jackson, A.C.; Randle, E.; Lawrance, G.; Rossiter, J.P. Neuronal apoptosis does not play an important role in human rabies encephalitis. J. Neurovirol. 2008, 14, 368–375. [Google Scholar] [CrossRef] [Scilit]
- Chai, Q.; He, W.Q.; Zhou, M.; Lu, H.; Fu, Z.F. Enhancement of blood-brain barrier permeability and reduction of tight junction protein expression are modulated by chemokines/cytokines induced by rabies virus infection. J. Virol. 2014, 88, 4698–4710. [Google Scholar] [CrossRef] [Scilit]
- Miao, F.M.; Zhang, S.F.; Wang, S.C.; Liu, Y.; Zhang, F.; Hu, R.L. Comparison of immune responses to attenuated rabies virus and street virus in mouse brain. Arch. Virol. 2017, 162, 247–257. [Google Scholar] [CrossRef] [Scilit]
- Kuang, Y.; Lackay, S.N.; Zhao, L.; Fu, Z.F. Role of chemokines in the enhancement of BBB permeability and inflammatory infiltration after rabies virus infection. Virus Res. 2009, 144, 18–26. [Google Scholar] [CrossRef] [Scilit]
- Daniels, B.P.; Holman, D.W.; Cruz-Orengo, L.; Jujjavarapu, H.; Durrant, D.M.; Klein, R.S. Viral pathogen-associated molecular patterns regulate blood-brain barrier integrity via competing innate cytokine signals. MBio 2014, 5, e01476-01414. [Google Scholar] [CrossRef] [Scilit]
- Koyuncu, O.O.; Hogue, I.B.; Enquist, L.W. Virus infections in the nervous system. Cell Host Microbe 2013, 13, 379–393. [Google Scholar] [CrossRef] [Scilit]
- Lazear, H.M.; Daniels, B.P.; Pinto, A.K.; Huang, A.C.; Vick, S.C.; Doyle, S.E.; Gale, M., Jr.; Klein, R.S.; Diamond, M.S. Interferon-lambda restricts West Nile virus neuroinvasion by tightening the blood-brain barrier. Sci. Transl. Med. 2015, 7, 284ra259. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Spindler, K.R.; Hsu, T.H. Viral disruption of the blood-brain barrier. Trends Microbiol. 2012, 20, 282–290. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Morimoto, K.; Hooper, D.C.; Carbaugh, H.; Fu, Z.F.; Koprowski, H.; Dietzschold, B. Rabies virus quasispecies: Implications for pathogenesis. Proc. Natl. Acad. Sci. USA 1998, 95, 3152–3156. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Sato, M.; Tanaka, H.; Yamada, T.; Yamamoto, N. Persistent infection of BHK21/WI-2 cells with rubella virus and characterization of rubella variants. Arch. Virol. 1977, 54, 333–343. [Google Scholar] [CrossRef] [Scilit]
- Clark, H.F. Rabies serogroup viruses in neuroblastoma cells: Propagation, “autointerference”, and apparently random back-mutation of attenuated viruses to the virulent state. Infect. Immun. 1980, 27, 1012–1022. [Google Scholar] [CrossRef] [Scilit]
- Zhao, L.; Rose, K.M.; Elliott, R.; Van Rooijen, N.; Weiss, S.R. Cell-type-specific type I interferon antagonism influences organ tropism of murine coronavirus. J. Virol. 2011, 85, 10058–10068. [Google Scholar] [CrossRef] [Scilit]
- Zhang, G.; Wang, H.; Mahmood, F.; Fu, Z.F. Rabies virus glycoprotein is an important determinant for the induction of innate immune responses and the pathogenic mechanisms. Vet. Microbiol. 2013, 162, 601–613. [Google Scholar] [CrossRef] [Scilit]
- Zhao, L.; Toriumi, H.; Wang, H.; Kuang, Y.; Guo, X.; Morimoto, K.; Fu, Z.F. Expression of MIP-1 (CCL3) by a recombinant rabies virus enhances its immunogenicity by inducing innate immunity and recruiting dendritic cells and B cells. J. Virol. 2010, 84, 9642–9648. [Google Scholar] [CrossRef] [Scilit]
- Reynolds, T.D.; Guayasamin, R.C.; Fujiwara, M.; Robek, M.D. O004 Using type III interferon to improve the efficacy of vaccine and oncolytic viral vectors. Cytokine 2012, 59, 498. [Google Scholar] [CrossRef] [Scilit]
- Huang, J.; Zhang, Y.; Huang, Y.; Gnanadurai, C.W.; Zhou, M.; Zhao, L.; Fu, Z.F. The ectodomain of rabies virus glycoprotein determines dendritic cell activation. Antivir. Res. 2017, 141, 1–6. [Google Scholar] [CrossRef] [Scilit]
- Kinashi, Y.; Yokomizo, N.; Takahashi, S. DNA Double-strand breaks induced byfractionated neutron beam irradiation for boron neutron capture therapy. Anticancer. Res. 2017, 37, 1681–1685. [Google Scholar] [PubMed]
- Zhu, X.; Wang, D.; Zhou, J.; Pan, T.; Chen, J.; Yang, Y.; Lv, M.; Ye, X.; Peng, G.; Fang, L.; et al. Porcine deltacoronavirus nsp5 antagonizes type I interferon signaling by cleaving STAT2. J. Virol. 2017, 91. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Lai, C.Y.; Ou, Y.C.; Chang, C.Y.; Pan, H.C.; Chang, C.J.; Liao, S.L.; Su, H.L.; Chen, C.J. Endothelial Japanese encephalitis virus infection enhances migration and adhesion of leukocytes to brain microvascular endothelia via MEK-dependent expression of ICAM1 and the CINC and RANTES chemokines. J. Neurochem. 2012, 123, 250–261. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Chai, Q.; She, R.; Huang, Y.; Fu, Z.F. Expression of neuronal CXCL10 induced by rabies virus infection initiates infiltration of inflammatory cells, production of chemokines and cytokines, and enhancement of blood-brain barrier permeability. J. Virol. 2015, 89, 870–876. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Hernandez, P.P.; Mahlakoiv, T.; Yang, I.; Schwierzeck, V.; Nguyen, N.; Guendel, F.; Gronke, K.; Ryffel, B.; Hoelscher, C.; Dumoutier, L.; et al. Interferon-lambda and interleukin 22 act synergistically for the induction of interferon-stimulated genes and control of rotavirus infection. Nat. Immunol. 2015, 16, 698–707. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Lin, J.D.; Feng, N.; Sen, A.; Balan, M.; Tseng, H.C.; McElrath, C.; Smirnov, S.V.; Peng, J.; Yasukawa, L.L.; Durbin, R.K.; et al. Distinct Roles of Type I and Type III Interferons in Intestinal Immunity to Homologous and Heterologous Rotavirus Infections. PLoS Pathog. 2016, 12, e1005600. [Google Scholar] [CrossRef] [Scilit]
- Mahlakoiv, T.; Hernandez, P.; Gronke, K.; Diefenbach, A.; Staeheli, P. Leukocyte-derived IFN-alpha/beta and epithelial IFN-lambda constitute a compartmentalized mucosal defense system that restricts enteric virus infections. PLoS Pathog. 2015, 11, e1004782. [Google Scholar] [CrossRef] [Scilit]
- Baldridge, M.T.; Lee, S.; Brown, J.J.; McAllister, N.; Urbanek, K.; Dermody, T.S.; Nice, T.J.; Virgin, H.W. Expression of Ifnlr1 on intestinal epithelial cells is critical to the antiviral effects of interferon lambda against norovirus and reovirus. J. Virol. 2017, 91. [Google Scholar] [CrossRef] [Scilit]
- Ye, L.; Schnepf, D.; Staeheli, P. Interferon-lambda orchestrates innate and adaptive mucosal immune responses. Nat. Rev. Immunol. 2019. [Google Scholar] [CrossRef] [Scilit]
- Sommereyns, C.; Paul, S.; Staeheli, P.; Michiels, T. IFN-lambda (IFN-lambda) is expressed in a tissue-dependent fashion and primarily acts on epithelial cells in vivo. PLoS Pathog. 2008, 4, e1000017. [Google Scholar] [CrossRef] [Scilit]
- Hermant, P.; Michiels, T. Interferon-lambda in the context of viral infections: Production, response and therapeutic implications. J. Innate Immun. 2014, 6, 563–574. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Muir, A.J.; Arora, S.; Everson, G.; Flisiak, R.; George, J.; Ghalib, R.; Gordon, S.C.; Gray, T.; Greenbloom, S.; Hassanein, T.; et al. A randomized phase 2b study of peginterferon lambda-1a for the treatment of chronic HCV infection. J. Hepatol. 2014, 61, 1238–1246. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Dumoutier, L.; Tounsi, A.; Michiels, T.; Sommereyns, C.; Kotenko, S.V.; Renauld, J.C. Role of the interleukin (IL)-28 receptor tyrosine residues for antiviral and antiproliferative activity of IL-29/interferon-lambda 1: Similarities with type I interferon signaling. J. Biol. Chem. 2004, 279, 32269–32274. [Google Scholar] [CrossRef] [Scilit]
- Donnelly, R.P.; Kotenko, S.V. Interferon-lambda: A new addition to an old family. J. Interf. Cytokine Res. 2010, 30, 555–564. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Au, W.C.; Moore, P.A.; Lowther, W.; Juang, Y.T.; Pitha, P.M. Identification of a member of the interferon regulatory factor family that binds to the interferon-stimulated response element and activates expression of interferon-induced genes. Proc. Natl. Acad. Sci. USA 1995, 92, 11657–11661. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Li, L.; Wang, H.; Jin, H.; Cao, Z.; Feng, N.; Zhao, Y.; Zheng, X.; Wang, J.; Li, Q.; Zhao, G.; et al. Interferon-inducible GTPase: A novel viral response protein involved in rabies virus infection. Arch. Virol. 2016, 161, 1285–1293. [Google Scholar] [CrossRef] [Scilit]
- Sarmento, L.; Li, X.Q.; Howerth, E.; Jackson, A.C.; Fu, Z.F. Glycoprotein-mediated induction of apoptosis limits the spread of attenuated rabies viruses in the central nervous system of mice. J. Neurovirol. 2005, 11, 571–581. [Google Scholar] [CrossRef] [Scilit]
- Wang, Z.W.; Sarmento, L.; Wang, Y.; Li, X.Q.; Dhingra, V.; Tseggai, T.; Jiang, B.; Fu, Z.F. Attenuated rabies virus activates, while pathogenic rabies virus evades, the host innate immune responses in the central nervous system. J. Virol. 2005, 79, 12554–12565. [Google Scholar] [CrossRef] [Scilit]
- Nakamichi, K.; Saiki, M.; Sawada, M.; Takayama-Ito, M.; Yamamuro, Y.; Morimoto, K.; Kurane, I. Rabies virus-induced activation of mitogen-activated protein kinase and NF-kappaB signaling pathways regulates expression of CXC and CC chemokine ligands in microglia. J. Virol. 2005, 79, 11801–11812. [Google Scholar] [CrossRef] [Scilit]
- Wei, H.; Wang, S.; Chen, Q.; Chen, Y.; Chi, X.; Zhang, L.; Huang, S.; Gao, G.F.; Chen, J.L. Suppression of interferon lambda signaling by SOCS-1 results in their excessive production during influenza virus infection. PLoS Pathog. 2014, 10, e1003845. [Google Scholar] [CrossRef] [Scilit]
- Galani, I.E.; Triantafyllia, V.; Eleminiadou, E.E.; Koltsida, O.; Stavropoulos, A.; Manioudaki, M.; Thanos, D.; Doyle, S.E.; Kotenko, S.V.; Thanopoulou, K.; et al. Interferon-lambda Mediates Non-redundant Front-Line Antiviral Protection against Influenza Virus Infection without Compromising Host Fitness. Immunity 2017, 46, 875–890. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Davidson, S.; Crotta, S.; McCabe, T.M.; Wack, A. Pathogenic potential of interferon alphabeta in acute influenza infection. Nat. Commun. 2014, 5, 3864. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Jo, D.; Liu, D.; Yao, S.; Collins, R.D.; Hawiger, J. Intracellular protein therapy with SOCS3 inhibits inflammation and apoptosis. Nat. Med. 2005, 11, 892–898. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Fox, B.A.; Sheppard, P.O.; O’Hara, P.J. The role of genomic data in the discovery, annotation and evolutionary interpretation of the interferon-lambda family. PLoS ONE 2009, 4, e4933. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Lasfar, A.; Lewis-Antes, A.; Smirnov, S.V.; Anantha, S.; Abushahba, W.; Tian, B.; Reuhl, K.; Dickensheets, H.; Sheikh, F.; Donnelly, R.P.; et al. Characterization of the mouse IFN-lambda ligand-receptor system: IFN-lambdas exhibit antitumor activity against B16 melanoma. Cancer Res. 2006, 66, 4468–4477. [Google Scholar] [CrossRef] [Scilit] [PubMed]








| Primers | Sequence (5′–3′) |
|---|---|
| IFNλ-BsiWI-F | TTGCGTACGATGCTCCTCCTGCTGTTG |
| IFNλ-NheI-R | CTAGCTAGCTCAGACACACTGGTCTCC |
| B2c-GL-F | CAGGGGGGAATGTGTCAGTC |
| B2c-GL-R | GCCTCTGACTCAATTGGATC |
| Primers | Sequence (5′–3′) |
|---|---|
| N mRNA-F | GATCGTGGAACACCATACCC |
| N mRNA-R | TTCATAAGCGGTGACGACTG |
| vRNA-F | CTCCACAACGAGATGCTCAA |
| vRNA-R | CATCCAACGGGAACAAGACT |
| IFN-a4-F | CCCACAGCCCAGAGAGTGACC |
| IFN-a4-R | GGCCCTCTTGTTCCCGAGGT |
| IFN-a5-F | CCTCAGGAACAAGAGAGCCTTA |
| IFN-a5-R | TCCTGTGGGAATCCAAAGTC |
| IFN-β-F | AGATGTCCTCAACTGCTCTC |
| IFN-β-R | AGATTCACTACCAGTCCCAG |
| IFIT2-F | TGGGGAAACTATGCTTGGGT |
| IFIT2-R | CCTCACAGTCAAGAGCAGGA |
| IIGP1-F | AATACCTGCCTCACGCTCAT |
| IIGP1-R | GCTACTCTGTGGGTTCTGGC |
| STAT1-F | CAGGTGTTGTCAGATCGAACCTTCC |
| STAT1-R | TTCAGCTCTTGCAATTTCACCAACA |
| NF-κB (p65)-F | CATTTCCGCCTCTGGCGAATG |
| NF-κB (p65)-R | CGTTGCTTCGGCTGTTCGATG |
| TNF-α-F | TCACTGGAGCCTCGAATGTC |
| TNF-α-R | GTGAGGAAGGCTGTGCATTG |
| ZO-1-F | GTCCCTCCTCTGATACCTTCCTC |
| ZO-1-R | CTGGCAGTGTCATTCACATCTTTCT |
| Occludin-F | TACAGACCCAAGAGCAGCA |
| Occludin-R | AGCCGTACATAGATCCAGAA |
| β-actin-F | CACTGCCGCATCCTCTTCCTCCC |
| β-actin-R | CAATAGTGATGACCTGGCCGT |
© 2020 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Li, Y.; Zhao, L.; Luo, Z.; Zhang, Y.; Lv, L.; Zhao, J.; Sui, B.; Huang, F.; Cui, M.; Fu, Z.F.; et al. Interferon-λ Attenuates Rabies Virus Infection by Inducing Interferon-Stimulated Genes and Alleviating Neurological Inflammation. Viruses 2020, 12, 405. https://doi.org/10.3390/v12040405
Li Y, Zhao L, Luo Z, Zhang Y, Lv L, Zhao J, Sui B, Huang F, Cui M, Fu ZF, et al. Interferon-λ Attenuates Rabies Virus Infection by Inducing Interferon-Stimulated Genes and Alleviating Neurological Inflammation. Viruses. 2020; 12(4):405. https://doi.org/10.3390/v12040405
Chicago/Turabian StyleLi, Yingying, Ling Zhao, Zhaochen Luo, Yachun Zhang, Lei Lv, Jianqing Zhao, Baokun Sui, Fei Huang, Min Cui, Zhen F. Fu, and et al. 2020. "Interferon-λ Attenuates Rabies Virus Infection by Inducing Interferon-Stimulated Genes and Alleviating Neurological Inflammation" Viruses 12, no. 4: 405. https://doi.org/10.3390/v12040405
APA StyleLi, Y., Zhao, L., Luo, Z., Zhang, Y., Lv, L., Zhao, J., Sui, B., Huang, F., Cui, M., Fu, Z. F., & Zhou, M. (2020). Interferon-λ Attenuates Rabies Virus Infection by Inducing Interferon-Stimulated Genes and Alleviating Neurological Inflammation. Viruses, 12(4), 405. https://doi.org/10.3390/v12040405

