Antibody-Mediated Porcine Reproductive and Respiratory Syndrome Virus Infection Downregulates the Production of Interferon-α and Tumor Necrosis Factor-α in Porcine Alveolar Macrophages via Fc Gamma Receptor I and III
Abstract
1. Introduction
2. Materials and Methods
2.1. Cells and Virus
2.2. Antibodies
2.3. Generation of Infectious PRRSV Immune Complexes (ICs)
2.4. PRRSV-ADE Infection Assay in Porcine AMs
2.5. RNA Interference Assay in Porcine AMs
2.6. Activation Assay of FcγRI or FcγRIII in Porcine AMs
2.7. Effect of Activation of FcγRI or FcγRIII on Poly (I:C)-Induced Production of Cytokines in Porcine AMs
2.8. Effect of Activation of FcγRI or FcγRIII on PRRSV-Induced Production of Cytokines in Porcine AMs
2.9. RNA Extraction and Relative Quantitative RT-PCR
2.10. ELISA Assay
2.11. Western Blot Assay
2.12. Flow Cytometry Assay
2.13. Statistical Analysis
3. Results
3.1. Porcine IgG Specific for PRRSV Facilitates PRRSV Replication in Porcine AMs
3.2. PRRSV Infection Induces the Production of IFN-α and TNF-α in Porcine AMs
3.3. PRRSV-ADE Infection DownRegulates the Production of IFN-α and TNF-α in Porcine AMs
3.4. FcγRI and FcγRIII in Porcine AMs Are Involved in PRRSV-ADE Infection
3.5. Activation of FcγRI or FcγRIII Down-Regulates the Production of IFN-α and TNF-α in Porcine AMs
3.6. Activation of FcγRI or FcγRIII Downregulates Poly (I:C)-Induced Production of IFN-α and TNF-α in Porcine AMs
3.7. Activation of FcγRI or FcγRIII Downregulates PRRSV-Induced Production of IFN-α and TNF-α in Porcine AMs
3.8. Activation of FcγRI or FcγRIII Facilitates PRRSV Replication in Porcine AMs
4. Discussion
Supplementary Materials
Author Contributions
Acknowledgments
Conflicts of Interest
References
- Lu, J.; Sun, P.D. Structural mechanism of high affinity FcγRI recognition of immunoglobulin G. Immunol. Rev. 2015, 268, 192–200. [Google Scholar] [CrossRef] [Scilit]
- Baerenwaldt, A.; Lux, A.; Danzer, H.; Spriewald, B.M.; Ullrich, E.; Heidkamp, G.; Dudziak, D.; Nimmerjahn, F. Fcγ receptor IIB (FcγRIIB) maintains humoral tolerance in the human immune system in vivo. Proc. Natl. Acad. Sci. USA 2011, 108, 18772–18777. [Google Scholar] [CrossRef] [Scilit]
- Hessell, A.J.; Hangartner, L.; Hunter, M.; Havenith, C.E.; Beurskens, F.J.; Bakker, J.M.; Lanigan, C.M.; Landucci, G.; Forthal, D.N.; Parren, P.W.; et al. Fc receptor but not complement binding is important in antibody protection against HIV. Nature 2007, 449, 101–104. [Google Scholar] [CrossRef] [Scilit]
- Pincetic, A.; Bournazos, S.; DiLillo, D.J.; Maamary, J.; Wang, T.T.; Dahan, R.; Fiebiger, B.M.; Ravetch, J.V. Type I and type II Fc receptors regulate innate and adaptive immunity. Nat. Immunol. 2014, 15, 707–716. [Google Scholar] [CrossRef] [Scilit]
- Thulin, N.K.; Wang, T.T. The role of Fc gamma receptors in broad protection against influenza viruses. Vaccines 2018, 6, 36. [Google Scholar] [CrossRef] [Scilit]
- Bournazos, S.; Ravetch, J.V. Fcγ receptor function and the design of vaccination strategies. Immunity 2017, 47, 224–233. [Google Scholar] [CrossRef] [Scilit]
- Nimmerjahn, F.; Ravetch, J.V. Fcγreceptors: Old friends and new family members. Immunity 2006, 24, 19–28. [Google Scholar] [CrossRef] [Scilit]
- Hargreaves, C.E.; Rose-Zerilli, M.J.; Machado, L.R.; Iriyama, C.; Hollox, E.J.; Cragg, M.S.; Strefford, J.C. Fcγ receptors: Genetic variation, function, and disease. Immunol. Rev. 2015, 268, 6–24. [Google Scholar] [CrossRef] [Scilit]
- Nimmerjahn, F.; Bruhns, P.; Horiuchi, K.; Ravetch, J.V. FcgammaRIV: A novel FcR with distinct IgG subclass specificity. Immunity 2005, 23, 41–51. [Google Scholar] [CrossRef] [Scilit]
- Cohen-Solal, J.F.; Cassard, L.; Fridman, W.H.; Sautès-Fridman, C. Fc gamma receptors. Immunol. Lett. 2004, 92, 199–205. [Google Scholar] [CrossRef] [Scilit]
- Nimmerjahn, F.; Ravetch, J.V. Fc gamma receptors as regulators of immune responses. Nat. Rev. Immunol. 2008, 8, 34–47. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Meulenberg, J.J. PRRSV, the virus. Vet. Res. 2000, 31, 11–21. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Dokland, T. The structural biology of PRRSV. Virus Res. 2010, 154, 86–97. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Duan, X.; Nauwynck, H.J.; Pensaert, M.B. Effects of origin and state of differentiation and activation of monocytes/macrophages on their susceptibility to porcine reproductive and respiratory syndrome virus (PRRSV). Arch. Virol. 1997, 142, 2483–2497. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Duan, X.; Nauwynck, H.J.; Pensaert, M.B. Virus quantification and identification of cellular targets in the lungs and lymphoid tissues of pigs at different time intervals after inoculation with porcine reproductive and respiratory syndrome virus (PRRSV). Vet. Microbiol. 1997, 56, 9–19. [Google Scholar] [CrossRef] [Scilit]
- Lunney, J.K.; Fang, Y.; Ladinig, A.; Chen, N.; Li, Y.; Rowland, B.; Renukaradhya, G.J. Porcine reproductive and respiratory syndrome virus (PRRSV): Pathogenesis and interaction with the immune system. Annu. Rev. Anim. Biosci. 2016, 4, 129–154. [Google Scholar] [CrossRef] [Scilit]
- Yoon, K.J.; Wu, L.L.; Zimmerman, J.J.; Hill, H.T.; Platt, K.B. Antibody dependent enhancement (ADE) of porcine reproductive and respiratory syndrome virus (PRRSV) infection in pigs. Viral Immunol. 1996, 9, 51–63. [Google Scholar] [CrossRef] [Scilit]
- Yoon, K.J.; Wu, L.L.; Zimmerman, J.J.; Platt, K.B. Field isolates of porcine reproductive and respiratory syndrome virus (PRRSV) vary in their susceptibility to antibody dependent enhancement (ADE) of infection. Vet. Microbiol. 1997, 55, 277–287. [Google Scholar] [CrossRef] [Scilit]
- Takeda, A.; Sweet, R.W.; Ennis, F.A. Two receptors are required for antibody-dependent enhancement of human immunodeficiency virus type 1 infection: CD4 and Fc gamma R. J. Virol. 1990, 64, 5605–5610. [Google Scholar] [CrossRef] [Scilit]
- Boonnak, K.; Slike, B.M.; Donofrio, G.C.; Marovich, M.A. Human FcγRII cytoplasmic domains differentially influence antibody-mediated dengue virus infection. J. Immunol. 2013, 190, 5659–5665. [Google Scholar] [CrossRef] [Scilit]
- Furuyama, W.; Marzi, A.; Carmody, A.B.; Maruyama, J.; Kuroda, M.; Miyamoto, H.; Nanbo, A.; Manzoor, R.; Yoshida, R.; Igarashi, M.; et al. Fcγ-receptor IIa-mediated Src signaling pathway is essential for the antibody-dependent enhancement of Ebola virus infection. PLoS Pathog. 2016, 12, e1006139. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Taylor, A.; Foo, S.S.; Bruzzone, R.; Dinh, L.V.; King, N.J.; Mahalingam, S. Fc receptors in antibody-dependent enhancement of viral infections. Immunol. Rev. 2015, 268, 340–364. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Nan, Y.; Wu, C.; Gu, G.; Sun, W.; Zhang, Y.J.; Zhou, E.M. Improved vaccine against PRRSV: Current progress and future perspective. Front. Microbiol. 2017, 8, 1635. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Sautter, C.A.; Trus, I.; Nauwynck, H.; Summerfield, A. No evidence for a role for antibodies during vaccination-induced enhancement of porcine reproductive and respiratory syndrome. Viruses 2019, 11, 829. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Halloran, P.J.; Sweeney, S.E.; Strohmeier, C.M.; Kim, Y.B. Molecular cloning and identification of the porcine cytolytic trigger molecule G7 as a Fc gamma RIII alpha (CD16) homologue. J. Immunol. 1994, 153, 2631–2641. [Google Scholar] [PubMed]
- Shi, P.; Su, Y.; Li, Y.; Zhang, L.; Lu, D.; Li, R.; Zhang, L.; Huang, J. The alternatively spliced porcine FcγRI regulated PRRSV-ADE infection and proinflammatory cytokine production. Dev. Comp. Immunol. 2019, 90, 186–198. [Google Scholar] [CrossRef] [Scilit]
- Zhang, G.; Qiao, S.; Li, Q.; Wang, X.; Duan, Y.; Wang, L.; Xiao, Z.; Xia, C. Molecular cloning and expression of the porcine high-affinity immunoglobulin G Fc receptor (FcγRI). Immunogenetics 2006, 58, 845–849. [Google Scholar] [CrossRef] [Scilit]
- Yang, Q.; Zhang, Y.; Chen, J.; Zhou, Y.; Li, N.; Qin, Y.; Yang, M.; Xia, P.; Cui, B. Ligation of porcine Fc gamma receptor I inhibits levels of antiviral cytokine in response to PRRSV infection in vitro. Virus Res. 2013, 173, 421–425. [Google Scholar] [CrossRef] [Scilit]
- Zhang, L.; Chen, J.; Wang, D.; Li, N.; Qin, Y.; Du, D.; Yang, M.; Xia, P. Ligation of porcine Fc gamma receptor III inhibits levels of antiviral cytokine in response to PRRSV infection in vitro. Res. Vet. Sci. 2016, 105, 47–52. [Google Scholar] [CrossRef] [Scilit]
- Zhang, L.; Xu, R.; Wei, F.; Li, W.; Li, X.; Zhang, G.; Xia, P. Activation of sialoadhesin down-regulates the levels of innate antiviral cytokines in porcine alveolar macrophages in vitro. Virus Res. 2020, 275, 197792. [Google Scholar] [CrossRef] [Scilit]
- Patel, D.; Nan, Y.; Shen, M.; Ritthipichai, K.; Zhu, X.; Zhang, Y.J. Porcine reproductive and respiratory syndrome virus inhibits type I interferon signaling by blocking STAT1/STAT2 nuclear translocation. J. Virol. 2010, 84, 11045–11055. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- McNab, F.; Mayer-Barber, K.; Sher, A.; Wack, A.; O’Garra, A. Type I interferons in infectious disease. Nat. Rev. Immunol. 2015, 15, 87–103. [Google Scholar] [CrossRef] [Scilit]
- Calzada-Nova, G.; Schnitzlein, W.M.; Husmann, R.J.; Zuckermann, F.A. North American porcine reproductive and respiratory syndrome viruses inhibit type I interferon production by plasmacytoid dendritic cells. J. Virol. 2011, 85, 2703–2713. [Google Scholar] [CrossRef] [Scilit]
- Liu, K.; Ma, G.; Liu, X.; Lu, Y.; Xi, S.; Ou, A.; Wei, J.; Li, B.; Shao, D.; Li, Y.; et al. Porcine reproductive and respiratory syndrome virus counteracts type I interferon-induced early antiviral state by interfering IRF7 activity. Vet. Microbiol. 2019, 229, 28–38. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Lee, S.M.; Schommer, S.K.; Kleiboeker, S.B. Porcine reproductive and respiratory syndrome virus field isolates differ in vitro interferon phenotypes. Vet. Immunol. Immunopathol. 2004, 102, 217–231. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Nan, Y.; Wang, R.; Shen, M.; Faaberg, K.S.; Samal, S.K.; Zhang, Y.J. Induction of type I interferons by a novel porcine reproductive and respiratory syndrome virus isolate. Virology 2012, 432, 261–270. [Google Scholar] [CrossRef] [Scilit]
- Zhang, H.; Guo, X.; Nelson, E.; Christopher-Hennings, J.; Wang, X. Porcine reproductive and respiratory syndrome virus activates the transcription of interferon alpha/beta (IFN-α/β) in monocyte-derived dendritic cells (Mo-DC). Vet. Microbiol. 2012, 159, 494–498. [Google Scholar] [CrossRef] [Scilit]
- Honda, K.; Takaoka, A.; Taniguchi, T. Type I interferon gene induction by the interferon regulatory factor family of transcription factors. Immunity 2006, 25, 349–360. [Google Scholar] [CrossRef] [Scilit]
- Servant, M.J.; Grandvaux, N.; tenOever, B.R.; Duguay, D.; Lin, R.; Hiscott, J. Identification of the minimal phosphoacceptor site required for in vivo activation of interferon regulatory factor 3 in response to virus and double-stranded RNA. J. Biol. Chem. 2003, 278, 9441–9447. [Google Scholar] [CrossRef] [Scilit]
- López-Fuertes, L.; Campos, E.; Domenech, N.; Ezquerra, A.; Castro, J.; Domínguez, J.; Alonso, F. Porcine reproductive and respiratory syndrome (PRRS) virus down-modulates TNF-alpha production in infected macrophages. Virus Res. 2000, 69, 41–46. [Google Scholar] [CrossRef] [Scilit]
- Moore, K.W.; de Waal Malefyt, R.; Coffman, R.L.; O’Garra, A. Interleukin-10 and the interleukin-10 receptor. Annu. Rev. Immunol. 2001, 19, 683–765. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Gimeno, M.; Darwich, L.; Diaz, I.; de la Torre, E.; Pujols, J.; Martín, M.; Inumaru, S.; Cano, E.; Domingo, M.; Montoya, M.; et al. Cytokine profiles and phenotype regulation of antigen presenting cells by genotype-I porcine reproductive and respiratory syndrome virus isolates. Vet. Res. 2011, 18, 42–49. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Silva-Campa, E.; Cordoba, L.; Fraile, L.; Flores-Mendoza, L.; Montoya, M.; Hernandez, J. European genotype of porcine reproductive and respiratory syndrome (PRRSV) infects monocyte-derived dendritic cells but does not induce Treg cells. Virology 2010, 396, 264–271. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Subramaniam, S.; Sur, J.H.; Kwon, B.; Pattnaik, A.K.; Osorio, F.A. A virulent strain of porcine reproductive and respiratory syndrome virus does not up-regulate interleukin-10 levels in vitro or in vivo. Virus Res. 2011, 155, 415–422. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Sutterwala, F.S.; Noel, G.J.; Salgame, P.; Mosser, D.M. Reversal of proinflammatory responses by ligating the macrophage Fcγ receptor type I. J. Exp. Med. 1998, 188, 217–222. [Google Scholar] [CrossRef] [Scilit]
- Gerber, J.S.; Mosser, D.M. Reversing lipopolysaccharide toxicity by ligating the macrophage Fcγ receptors. J. Immunol. 2001, 166, 6861–6868. [Google Scholar] [CrossRef] [Scilit]
- Newling, M.; Hoepel, W.; Vogelpoel, L.T.C.; Heineke, M.H.; van Burgsteden, J.A.; Taanman-Kueter, E.W.M.; Eggink, D.; Kuijpers, T.W.; Beaumont, T.; van Egmond, M.; et al. Fc gamma receptor IIa suppressed type I and III interferon production by human myeloid immune cells. Eur. J. Immunol. 2018, 48, 1796–1809. [Google Scholar] [CrossRef] [Scilit]
- Chareonsirisuthigul, T.; Kalayanarooj, S.; Ubol, S. Dengue virus (DENV) antibody-dependent enhancement of infection up-regulates the production of anti-inflammatory cytokines, but suppresses anti-DENV free radical and pro-inflammatory cytokine production, in THP-1 cells. J. Gen. Virol. 2007, 88, 365–375. [Google Scholar] [CrossRef] [Scilit]
- Khandia, R.; Munjal, A.; Dhama, K.; Karthik, K.; Tiwari, R.; Malik, Y.S.; Singh, R.K.; Chaicumpa, W. Modulation of Dengue/Zika virus pathogenicity by antibody-dependent enhancement and strategies to protect against enhancement in Zika virus infection. Front. Immunol. 2018, 23, 597. [Google Scholar] [CrossRef] [Scilit]
- Ubol, S.; Phuklia, W.; Kalayanarooj, S.; Modhiran, N. Mechanisms of immune evasion induced by a complex of dengue virus and preexisting enhancing antibodies. J. Infect. Dis. 2010, 201, 923–935. [Google Scholar] [CrossRef] [Scilit]
- Bao, D.; Wang, R.; Qiao, S.; Wan, B.; Wang, Y.; Liu, M.; Shi, X.; Guo, J.; Zhang, G. Antibody-dependent enhancement of PRRSV infection down-modulates TNF-α and IFN-β transcription in macrophages. Vet. Immunol. Immunopathol. 2013, 156, 128–134. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Mahalingam, S.; Lidbury, B.A. Suppression of lipopolysaccharide-induced antiviral transcription factor (STAT-1 and NF-kappa B) complexes by antibody-dependent enhancement of macrophage infection by Ross River virus. Proc. Natl. Acad. Sci. USA 2002, 99, 13819–13824. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Gu, W.; Guo, L.; Yu, H.; Niu, J.; Huang, M.; Luo, X.; Li, R.; Tian, Z.; Feng, L.; Wang, Y. Involvement of CD16 in antibody-dependent enhancement of porcine reproductive and respiratory syndrome virus infection. J. Gen. Virol. 2015, 96, 1712–1722. [Google Scholar] [CrossRef] [Scilit] [PubMed]




























| Target Gene Name # | Sequence (5′-3′) |
|---|---|
| FcγRI | Sense: GCCUUGAGGUGUCAUGGAUTT Antisense: AUCCAUGACACCUCAAGGCTT |
| FcγRIII | Sense: GUGGAGAAUACACGUGUAATT Antisense: UUACACGUGUAUUCUCCACTT |
| Negative control | Sense: UUCUCCGAACGUGUCACGUTT Antisense: ACGUGACACGUUCGGAGAATT |
| Primer Name # | Primer Sequence (5′-3′) | |
|---|---|---|
| IFN-α F | GGATCAGCAGCTCAGGG | |
| IFN-α R | GAGGGTGAGTCTGTGGAAGTA | |
| TNF-α F | AGCCGCATCGCCGTCTCCTAC | |
| TNF-α R | CCTGCCCAGATTCAGCAAAGTCC | |
| IL-10 F | GCATCCACTTCCCAACCA | |
| IL-10 R | TCGGCATTACGTCTTCCAG | |
| ISG15 F | GGTGCAAAGCTTCAGAGACC | [31] |
| ISG15 R | GTCAGCCAGACCTCATAGGC | |
| ISG56 F | TCAGAGGTGAGAAGGCTGGT | [31] |
| ISG56 R | GCTTCCTGCAAGTGTCCTTC | |
| OAS2 F | CACAGCTCAGGGATTTCAGA | [31] |
| OAS2 R | TCCAACGACAGGGTTTGTAA | |
| FcγRI F | TGAAACAAAGTTGCTCCCA | |
| FcγRI R | GCTGCGCTTGATGACCT | |
| FcγRIII F | CTGCTGCTTCTGGTTTCA | |
| FcγRIII R | CCATTCCACCTCCACTC | |
| β-actin F | CGGGACATCAAGGAGAAGC | |
| β-actin R | CTCGTTGCCGATGGTGATG |
© 2020 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Zhang, L.; Li, W.; Sun, Y.; Kong, L.; Xu, P.; Xia, P.; Zhang, G. Antibody-Mediated Porcine Reproductive and Respiratory Syndrome Virus Infection Downregulates the Production of Interferon-α and Tumor Necrosis Factor-α in Porcine Alveolar Macrophages via Fc Gamma Receptor I and III. Viruses 2020, 12, 187. https://doi.org/10.3390/v12020187
Zhang L, Li W, Sun Y, Kong L, Xu P, Xia P, Zhang G. Antibody-Mediated Porcine Reproductive and Respiratory Syndrome Virus Infection Downregulates the Production of Interferon-α and Tumor Necrosis Factor-α in Porcine Alveolar Macrophages via Fc Gamma Receptor I and III. Viruses. 2020; 12(2):187. https://doi.org/10.3390/v12020187
Chicago/Turabian StyleZhang, Liujun, Wen Li, Yangyang Sun, Linghao Kong, Pengli Xu, Pingan Xia, and Gaiping Zhang. 2020. "Antibody-Mediated Porcine Reproductive and Respiratory Syndrome Virus Infection Downregulates the Production of Interferon-α and Tumor Necrosis Factor-α in Porcine Alveolar Macrophages via Fc Gamma Receptor I and III" Viruses 12, no. 2: 187. https://doi.org/10.3390/v12020187
APA StyleZhang, L., Li, W., Sun, Y., Kong, L., Xu, P., Xia, P., & Zhang, G. (2020). Antibody-Mediated Porcine Reproductive and Respiratory Syndrome Virus Infection Downregulates the Production of Interferon-α and Tumor Necrosis Factor-α in Porcine Alveolar Macrophages via Fc Gamma Receptor I and III. Viruses, 12(2), 187. https://doi.org/10.3390/v12020187
