Selection of DNA Aptamers for Subcellular Localization of RBSDV P10 Protein in the Midgut of Small Brown Planthoppers by Emulsion PCR-Based SELEX
Abstract
1. Introduction
2. Materials and Methods
2.1. Expression and Purification of RBSDV His-P10 Protein
2.2. Selection of Putative Aptamers against RBSDV His-P10 Protein by Emulsion PCR-Based SELEX
2.2.1. Construction of the N80 ssDNA Library for Putative Aptamers Selection
2.2.2. Immobilization of RBSDV His-P10 Protein to Ni-NTA Magnetic Resin
2.2.3. Emulsion PCR (ePCR)
2.2.4. Optimization of Emulsification, Concentrations of MgCl2 and BSA of ePCR
2.2.5. Selection of Putative Aptamers against RBSDV His-P10 Protein by Emulsion PCR-Based SELEX
2.3. Verification of Putative Aptamers by ELONA, Aptamer-Based Dot-Blot ELISA, and Immunofluorescent Localization of RBSDV P10 Protein
2.3.1. Selection of Putative Aptamers against RBSDV His-P10 Protein Measured by Enzyme-Linked Oligonucleotide Assay (ELONA)
2.3.2. Aptamer-Based Dot-Blot ELISA for Verification of Aptamer Specificity
2.3.3. Targeting RBSDV P10 Protein by Fluorescent Aptamers in the Midgut of RBSDV-Infected L. striatellus
2.3.4. Preparation of RBSDV-Free and RBSDV-Infected SBPH
3. Results
3.1. Expression and Purification of RBSDV His-P10 Protein
3.2. Enrichment of Putative Aptamers by Emulsion PCR-Based SELEX against RBSDV His-P10 Protein
3.2.1. Optimization of ePCR
3.2.2. Selection of Putative Aptamers by Emulsion PCR-Based SELEX
3.3. Detection of RBSDV His-P10 Protein Using the Selected Putative Aptamers
3.4. Detection of RBSDV P10 Protein In Vivo Using the Selected Aptamers by Immunofluorescence
4. Discussion
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Acknowledgments
Conflicts of Interest
References
- Ishii, M.; Yoshimura, S. Epidemiological studies on the rice black-streaked dwarf virus in Kanto-Tosan district, Japan. J. Cent. Agric. Exp. Stn. 1973, 17, 61–121. [Google Scholar]
- Shikata, E.; Kitagawa, Y. Rice black-streaked dwarf virus: Its properties, morphology and intracellular localization. Virology 1977, 77, 826–842. [Google Scholar] [CrossRef] [Scilit]
- Fang, S.; Yu, J.; Feng, J.; Han, C.; Li, D.; Liu, Y. Identification of rice black-streaked dwarf fijivirus in maize with rough dwarf disease in China. Arch. Virol. 2001, 146, 167–170. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Wang, Z.-H.; Fang, S.-G.; Xu, J.-L.; Sun, L.-Y.; Li, D.-W.; Yu, J.-L. Sequence analysis of the complete genome of rice black-streaked dwarf virus isolated from maize with rough dwarf disease. Virus Genes 2003, 27, 163–168. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Zhang, H.; Chen, J.; Lei, J.; Adams, M.J. Sequence analysis shows that a dwarfing disease on rice, wheat and maize in China is caused by rice black-streaked dwarf virus. Eur. J. Plant Pathol. 2001, 107, 563–567. [Google Scholar] [CrossRef] [Scilit]
- Bai, F.-W.; Yan, J.; Qu, Z.-C.; Zhang, H.-W.; Xu, J.; Ye, M.-M.; Shen, D.-l. Phylogenetic analysis reveals that a dwarfing disease on different cereal crops in China is due to rice black streaked dwarf virus (RBSDV). Virus Genes 2002, 25, 201–206. [Google Scholar] [CrossRef] [Scilit]
- Wu, J.; Ni, Y.; Liu, H.; Rao, L.; Zhou, Y.; Zhou, X. Development and use of three monoclonal antibodies for the detection of rice black-streaked dwarf virus in field plants and planthopper vectors. Virol. J. 2013, 10, 114. [Google Scholar] [CrossRef] [Scilit]
- Isogai, M.; Uyeda, I.; Lee, B. Detection and assignment of proteins encoded by rice black streaked dwarf fijivirus S7, S8, S9 and S10. J. Gen. Virol. 1998, 79, 1487–1494. [Google Scholar] [CrossRef] [Scilit]
- Liu, H.; Wei, C.; Zhong, Y.; Li, Y. Rice black-streaked dwarf virus outer capsid protein P10 has self-interactions and forms oligomeric complexes in solution. Virus Res. 2007, 127, 34–42. [Google Scholar] [CrossRef] [Scilit]
- Wang, Z.-H.; Fang, S.-G.; Zhang, Z.-Y.; Han, C.-G.; Li, D.-W.; Yu, J.-l. Development of an ID-ELISA for the detection of Rice black-streaked dwarf virus in plants. J. Virol. Methods 2006, 134, 61–65. [Google Scholar] [CrossRef] [Scilit]
- Azuhata, F.; Uyeda, I.; Kimura, I.; Shikata, E. Close similarity between genome structures of rice black-streaked dwarf and maize rough dwarf viruses. J. Gen. Virol. 1993, 74, 1227–1232. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Isogai, M.; Azuhata, F.; Uyeda, I.; Shikata, E.; Kimura, I. Genomic relationships between rice black-streaked dwarf and maize rough dwarf Fijiviruses detected by nucleic acid hybridization. Jpn. J. Phytopathol. 1995, 61, 513–518. [Google Scholar] [CrossRef] [Scilit]
- Wu, S.; Wang, Z.; Fan, Y.; Zhou, Y.; Cheng, Z.; Zhang, W. Detection of pathogen of maize rough dwarf disease (MRDD) in Jiangsu province with RT-PCR. J. Agric. Biotechnol. 2000, 4, 369–372. [Google Scholar]
- Zhou, T.; Fan, Y.; Zhou, Y. Development of a RT-LAMP assay for rapid detection of Rice black-streaked dwarf virus. Sci. Agric. Sin. 2012, 45, 1285–1292. [Google Scholar]
- Xu, Q.; Liu, H.; Yuan, P.; Zhang, X.; Chen, Q.; Jiang, X.; Zhou, Y. Development of a simplified RT-PCR without RNA isolation for rapid detection of RNA viruses in a single small brown planthopper (Laodelphax striatellus Fallén). Virol. J. 2017, 14, 90. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Zhao, C.; Sun, F.; Li, X.; Lan, Y.; Du, L.; Zhou, T.; Zhou, Y. Reverse transcription-recombinase polymerase amplification combined with lateral flow strip for detection of rice black-streaked dwarf virus in plants. J. Virol. Methods 2019, 263, 96–100. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Jia, D.; Han, Y.; Sun, X.; Wang, Z.; Du, Z.; Chen, Q.; Wei, T. The speed of tubule formation of two fijiviruses corresponds with their dissemination efficiency in their insect vectors. Virol. J. 2016, 13, 1–7. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Lu, L.; Wang, Q.; Huang, D.; Xu, Q.; Zhou, X.; Wu, J. Rice black-streaked dwarf virus P10 suppresses protein kinase C in insect vector through changing the subcellular localization of LsRACK1. Philos. Trans. R. Soc. B 2019, 374, 20180315. [Google Scholar] [CrossRef] [Scilit]
- Gomes de Castro, M.A.; Höbartner, C.; Opazo, F. Aptamers provide superior stainings of cellular receptors studied under super-resolution microscopy. PLoS ONE 2017, 12, e0173050. [Google Scholar] [CrossRef] [Scilit]
- Ellington, A.D.; Szostak, J.W. In vitro selection of RNA molecules that bind specific ligands. Nature 1990, 346, 818–822. [Google Scholar] [CrossRef] [Scilit]
- Tuerk, C.; Gold, L. Systematic evolution of ligands by exponential enrichment: RNA ligands to bacteriophage T4 DNA polymerase. Science 1990, 249, 505–510. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Diehl, F.; Li, M.; He, Y.; Kinzler, K.W.; Vogelstein, B.; Dressman, D. BEAMing: Single-molecule PCR on microparticles in water-in-oil emulsions. Nat. Methods 2006, 3, 551–559. [Google Scholar] [CrossRef] [Scilit]
- Williams, R.; Peisajovich, S.G.; Miller, O.J.; Magdassi, S.; Tawfik, D.S.; Griffiths, A.D. Amplification of complex gene libraries by emulsion PCR. Nat. Methods 2006, 3, 545–550. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Polz, M.F.; Cavanaugh, C.M. Bias in template-to-product ratios in multitemplate PCR. Appl. Environ. Microbiol. 1998, 64, 3724–3730. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Musheev, M.U.; Krylov, S.N. Selection of aptamers by systematic evolution of ligands by exponential enrichment: Addressing the polymerase chain reaction issue. Anal. Chim. Acta 2006, 564, 91–96. [Google Scholar] [CrossRef] [Scilit]
- Shao, K.; Ding, W.; Wang, F.; Li, H.; Ma, D.; Wang, H. Emulsion PCR: A high efficient way of PCR amplification of random DNA libraries in aptamer selection. PLoS ONE 2011, 6, e24910. [Google Scholar] [CrossRef] [Scilit]
- Bai, C.; Lu, Z.; Jiang, H.; Yang, Z.; Liu, X.; Ding, H.; Li, H.; Dong, J.; Huang, A.; Fang, T. Aptamer selection and application in multivalent binding-based electrical impedance detection of inactivated H1N1 virus. Biosens. Bioelectron. 2018, 110, 162–167. [Google Scholar] [CrossRef] [Scilit]
- Wang, R.; Zhao, J.; Jiang, T.; Kwon, Y.M.; Lu, H.; Jiao, P.; Liao, M.; Li, Y. Selection and characterization of DNA aptamers for use in detection of avian influenza virus H5N1. J. Virol. Methods 2013, 189, 362–369. [Google Scholar] [CrossRef] [Scilit]
- Lu, T.; Ma, Q.; Yan, W.; Wang, Y.; Zhang, Y.; Zhao, L.; Chen, H. Selection of an aptamer against Muscovy duck parvovirus for highly sensitive rapid visual detection by label-free aptasensor. Talanta 2018, 176, 214–220. [Google Scholar] [CrossRef] [Scilit]
- Percze, K.; Szakács, Z.; Scholz, É.; András, J.; Szeitner, Z.; Van Den Kieboom, C.H.; Ferwerda, G.; De Jonge, M.I.; Gyurcsányi, R.E.; Mészáros, T. Aptamers for respiratory syncytial virus detection. Sci. Rep. 2017, 7, 42794. [Google Scholar] [CrossRef] [Scilit]
- Moore, M.D.; Escudero-Abarca, B.I.; Suh, S.H.; Jaykus, L.-A. Generation and characterization of nucleic acid aptamers targeting the capsid P domain of a human norovirus GII. 4 strain. J. Biotechnol. 2015, 209, 41–49. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Escudero-Abarca, B.I.; Suh, S.H.; Moore, M.D.; Dwivedi, H.P.; Jaykus, L.-A. Selection, characterization and application of nucleic acid aptamers for the capture and detection of human norovirus strains. PLoS ONE 2014, 9. [Google Scholar] [CrossRef] [Scilit]
- Beier, R.; Pahlke, C.; Quenzel, P.; Henseleit, A.; Boschke, E.; Cuniberti, G.; Labudde, D. Selection of a DNA aptamer against norovirus capsid protein VP1. Fems Microbiol. Lett. 2014, 351, 162–169. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Xi, Z.; Huang, R.; Li, Z.; He, N.; Wang, T.; Su, E.; Deng, Y. Selection of HBsAg-specific DNA aptamers based on carboxylated magnetic nanoparticles and their application in the rapid and simple detection of hepatitis B virus infection. Acs Appl. Mater. Interfaces 2015, 7, 11215–11223. [Google Scholar] [CrossRef] [Scilit]
- Chen, F.; Hu, Y.; Li, D.; Chen, H.; Zhang, X.-L. CS-SELEX generates high-affinity ssDNA aptamers as molecular probes for hepatitis C virus envelope glycoprotein E2. PLoS ONE 2009, 4, e8142. [Google Scholar] [CrossRef] [Scilit]
- Park, J.-W.; Lee, S.J.; Choi, E.-J.; Kim, J.; Song, J.-Y.; Gu, M.B. An ultra-sensitive detection of a whole virus using dual aptamers developed by immobilization-free screening. Biosens. Bioelectron. 2014, 51, 324–329. [Google Scholar] [CrossRef] [Scilit]
- Komorowska, B.; Hasiów-Jaroszewska, B.; Minicka, J. Application of nucleic acid aptamers for detection of Apple stem pitting virus isolates. Mol. Cell. Probes 2017, 36, 62–65. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Schütze, T.; Wilhelm, B.; Greiner, N.; Braun, H.; Peter, F.; Mörl, M.; Erdmann, V.A.; Lehrach, H.; Konthur, Z.; Menger, M. Probing the SELEX process with next-generation sequencing. PLoS ONE 2011, 6, e29604. [Google Scholar] [CrossRef] [Scilit]
- Schütze, T.; Rubelt, F.; Repkow, J.; Greiner, N.; Erdmann, V.A.; Lehrach, H.; Konthur, Z.; Glökler, J. A streamlined protocol for emulsion polymerase chain reaction and subsequent purification. Anal. Biochem. 2011, 410, 155–157. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Stoltenburg, R.; Krafčiková, P.; Víglaský, V.; Strehlitz, B. G-quadruplex aptamer targeting Protein A and its capability to detect Staphylococcus aureus demonstrated by ELONA. Sci. Rep. 2016, 6, 33812. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Wu, W.; Liu, H.; Dong, Y.; Zhang, Y.; Wong, S.-M.; Wang, C.; Zhou, Y.; Xu, Q. Determination of Suitable RT-qPCR Reference Genes for Studies of Gene Functions in Laodelphax striatellus (Fallén). Genes 2019, 10, 887. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Yufa, R.; Krylova, S.M.; Bruce, C.; Bagg, E.A.; Schofield, C.J.; Krylov, S.N. Emulsion PCR significantly improves nonequilibrium capillary electrophoresis of equilibrium mixtures-based aptamer selection: Allowing for efficient and rapid selection of aptamer to unmodified ABH2 protein. Anal. Chem. 2015, 87, 1411–1419. [Google Scholar] [CrossRef] [Scilit]
- Abil, Z.; Ellefson, J.W.; Gollihar, J.D.; Watkins, E.; Ellington, A.D. Compartmentalized partnered replication for the directed evolution of genetic parts and circuits. Nat. Protoc. 2017, 12, 2493. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Bauer, M.; Macdonald, J.; Henri, J.; Duan, W.; Shigdar, S. The application of aptamers for immunohistochemistry. Nucleic Acid Ther. 2016, 26, 120–126. [Google Scholar] [CrossRef] [Scilit]








| Round | Input DNA (Folded Aptamers) | ① P10-Beads Complex | ② Binding Time | ③ Wash Time | ③ Wash Volume | ④⑤ ePCR Cycles | ⑥ Monitor Index | ||||
|---|---|---|---|---|---|---|---|---|---|---|---|
| μg | pmol | Beads (μL) | P10 (μg) | (min) | (μL) | Output DNA (μg) | pmol | Output/Input Ratio | |||
| 1 | 35.7 | 1000 | 30 | 30 | 90 | 1 | 500 | 20 | 12.800 | 179.2 | 0.18 |
| 2 | 3 | 42 | 15 | 15 | 60 | 1 | 500 | 20 | 10.070 | 141.0 | 3.36 |
| 3 | 2 | 28 | 15 | 15 | 45 | 2 | 500 | 20 | 3.010 | 42.1 | 1.51 |
| 4 | 2 | 28 | 15 | 15 | 45 | 2 | 500 | 20 | 4.385 | 61.4 | 2.19 |
| 5 | 2 | 28 | 15 | 15 | 45 | 2 | 500 | 20 | 4.175 | 58.5 | 2.09 |
| 6 | 2 | 28 | 15 | 15 | 45 | 2 | 1000 | 20 | 7.665 | 107.3 | 3.83 |
| ⑦ Negative Selection I | 2 | 28 | 20 | 0 | 60 | ||||||
| 7 | 2 | 28 | 15 | 15 | 45 | 2 | 1000 | 20 | 12.515 | 175.2 | 6.26 |
| 8 | 2 | 28 | 15 | 15 | 30 | 3 | 1000 | 20 | 14.105 | 197.5 | 7.05 |
| ⑦ Negative Selection II | 1 | 14 | 20 | 0 | 60 | ||||||
| 9 | 1 | 14 | 15 | 15 | 20 | 3 | 1000 | 15 | 12.080 | 169.1 | 12.08 |
| 10 | 0.5 | 7 | 5 | 5 | 15 | 3 | 1000 | 10 | 4.105 | 57.5 | 8.21 |
| Serial No. | T-A Clone No. | Sequence (5′-3′) | nt |
|---|---|---|---|
| 1 | 1 | TGACACCGTACCTGCTCTAGATGAAGACTGATGATGCCTGTCAACGCGCGGAACCACTGGATCAAGACGGACCGGAACCGTGTTCACTGTCGACAAGCACGCCAGGGACTAT | 118 |
| 2 | 3 | TGACACCGTACCTGCTCTAGCGGTCTCGTGAATCTGCAGACGAATTTGTGTAATATGAGCGCATATGTATAACATTGCAGACAAGGTCGAGAGCGCGTAAGCACGCCAGGGACTAT | 122 |
| 3 | 4 | TGACACCGTACCTGCTCTGGGTGTGGAGATTGTGAGGGGAGGTGCTAGCATGGATAGAAAGTAAAGAGGAGGAAAGTGCGGAGTAAGGAGGCGGGGAAGCACGCCAGGGACTAT | 120 |
| 4 | 5 | TGACACCGTACCTGCTCTGACAGTCCTCGTACAAAGGTCGAGTCATCATACCCGCCGTAACCCCTTACGGGTCGAGCCAAGCACGCCAGGGACTAT | 102 |
| 5 | 6 | TGACACCGTACCTGCTCTCAGGGCAACACTATGACATAGGGAACTCTCGGAACACAGGGAGGCCTCCAGTACAATTCGGATGTGAACTGCAAGCACGCCAGGGACTAT | 114 |
| 6 | 11 | TGACACCGTACCTGCTCTAGCACGGCACCCATGGGCAGTATACCGTCCCCCGCGAAAGACGGGCCGCTGCGGTAAGCACGCCAGGGACTAT | 97 |
| 7 | 13 | TGACACCGTACCTGCTCTACCCCGCATTATCCTTATAACCCGATAGAATAAACGACGAGGTCGGCGAAAGACCGAAGGCGGTGCAGGGCCAAGCATGCAAGCACGCCAGGGACTAT | 122 |
| 8 | 15 | TGACACCGTACCTGCTCTAGCCACCTTCGTAGACACCATATCAGAAAGAGATACCCAGGAGGCGCCCCCGTGTGCGAACGAAGGGCGATTGTAACGAAGCACGCCAGGGACTAT | 120 |
| 9 | 16 | TGACACCGTACCTGCTCTGGGCCGTTGATTCCAACCCTTTATGGCGGCGTGCGAAAGACACGATCAACGCGCAGCCCCAAGCACGCCAGGGACTAT | 102 |
| 10 | 17 | TGACACCGTACCTGCTCTGCCGTAGTGATCCTCCTTAACAGTGACCTATAGATCGTTCGTCGTATTTGCTTTGACAATCCTTCTCAGATACTCTCCCGAAGCACGCCAGGGACTAT | 122 |
| 11 | 20 | TGACACCGTACCTGCTCTAGTCGTGGTCATGCAGCACGGAAGCGTAAGACTTCCCGCTGGACGGTCGGTAAGACGGTAAATGACTCCGCAAGCACGCCAGGGACTAT | 113 |
| 12 | 21 | TGACACCGTACCTGCTCTCTACCAGCTCCGACGATCCAGTATTGTGAACCCCGCGCGGTAGCGTTCTCGTCTTCGTGGAGTGGAACGCAAGCACGCCAGGGACTAT | 112 |
| 13 | 22 | TGACACCGTACCTGCTCTGCCCGTAGACAAAGTCCGCCCCGAAATCGCAAGACTGCAAGCGAAAGACTAAAGCGATCGAATAAGATCCGATTCAGGGGAAAGCACGCCAGGGACTAT | 123 |
| 14 | 24 | TGACACCGTACCTGCTCTGCCGTAGTGATCCTCCTTAACAGTGACCTATAGATCGTTCGCCGTATTTGCTTTGACAATCCTTCTCAGATACTCTCCCGAAGCACGCCAGGGACTAT | 122 |
| 15 | 25 | TGACACCGTACCTGCTCTGGGCCGTTGATTCCAACCCATTATCGCGGCGTGCGAAAGACACGATCAACGCGCAGCCCCAAGCACGCCAGGGACTAT | 102 |
| 16 | 26 | TGACACCGTACCTGCTCTGGGTCAGCGAAAGACTACCCCCGTGGCGCGCGGAAGACGCGCCCAGCAGGACCAGCCGAACACCCCAAGCACGCCAGGGACTAT | 108 |
| 17 | 27 | TGACACCGTACCTGCTCTAGGGAGTCGATGTTCCCTGCTCACGACATGGTCCGCGGAAGACGGACAGGACATCCCGAGAAGCGAGCGAGCATCTCGCTAAGCACGCCAGGGACTAT | 122 |
| 18 | 29 | TGACACCGTACCTGCTCTACCTGGATGCGCGTTAGACGCTGTTGAATAATCATCGCAAAGAGTCCAGGTACGCAAGGTTATGGACAGTGTGCCAAGCACGCCAGGGACTAT | 117 |
| 19 | 32 | TGACACCGTACCTGCTCTAGAACGCAGCTCAAAAGCTCGCCCAGCACCCGAAAAGAGGTGCGGCCGTCTGAGGGAAGCAGCGCAGAACCCCGAAGCACGCCAGGGACTAT | 116 |
| 20 | 34 | TGACACCGTACCTGCTCTGGAGACGAAGAGATAAGGCAGAAGTTGAGAAGATGGGATGAGGGCCGGGAAGCACGCCAGGGACTAT | 91 |
| 21 | 36 | TGACACCGTACCTGCTCTACCCCGCATTATCCTTATAACCCGATAGAATAAATGACGAGGTCGGCGAAAGACCGAAGGCGGTGCAGGGCCAAGCATGCAAGCACGCCAGGGACTAT | 122 |
| 22 | 38 | TGACACCGTACCTGCTCTGGGCCGTTGATTCCAACCCTTTATCGCGGCGTGCGAAAGACACGATCAACGCGCAGCCCCAAGCACGCCAGGGACTAT | 102 |
| 23 | 45 | TGACACCGTACCTGCTCTGGGCGGTGCGTCGCTTTGCTGAAGCCAGATTGGTCTTTGACAGAGATCAGACAGAACTGTTCCAGAAAGCGAGGGAAGCACGCCAGGGACTAT | 117 |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2020 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Liu, H.; Zhou, Y.; Xu, Q.; Wong, S.-M. Selection of DNA Aptamers for Subcellular Localization of RBSDV P10 Protein in the Midgut of Small Brown Planthoppers by Emulsion PCR-Based SELEX. Viruses 2020, 12, 1239. https://doi.org/10.3390/v12111239
Liu H, Zhou Y, Xu Q, Wong S-M. Selection of DNA Aptamers for Subcellular Localization of RBSDV P10 Protein in the Midgut of Small Brown Planthoppers by Emulsion PCR-Based SELEX. Viruses. 2020; 12(11):1239. https://doi.org/10.3390/v12111239
Chicago/Turabian StyleLiu, Haoqiu, Yijun Zhou, Qiufang Xu, and Sek-Man Wong. 2020. "Selection of DNA Aptamers for Subcellular Localization of RBSDV P10 Protein in the Midgut of Small Brown Planthoppers by Emulsion PCR-Based SELEX" Viruses 12, no. 11: 1239. https://doi.org/10.3390/v12111239
APA StyleLiu, H., Zhou, Y., Xu, Q., & Wong, S.-M. (2020). Selection of DNA Aptamers for Subcellular Localization of RBSDV P10 Protein in the Midgut of Small Brown Planthoppers by Emulsion PCR-Based SELEX. Viruses, 12(11), 1239. https://doi.org/10.3390/v12111239
