Development of a New Tomato Torrado Virus-Based Vector Tagged with GFP for Monitoring Virus Movement in Plants
Abstract
1. Introduction
2. Materials and Methods
2.1. Plasmid Construction
2.2. Plant Material, Agroinfiltration, and Sap Inoculation
2.3. Virus Detection by RT-PCR
2.4. Fluorescence Monitoring in Plants
2.5. Immunodetection (IP) of the Recombined GFP Protein
3. Results
3.1. The New Generation of Infectious Clones of ToTV Retains Their Biological Activity
3.2. GFP-Tagged ToTV Infects N. Benthamiana, Spreads Efficiently in the Host and Can Be Mechanically Passaged
3.3. GFP-Derived Fluorescence is Detected in Plants Infected with ToTV-GFP
3.4. GFP is Produced in N. Benthamiana Infected by ToTV-GFP
4. Discussion
Supplementary Materials
Author Contributions
Funding
Acknowledgments
Conflicts of Interest
References
- Liu, S.-L.; Wang, Z.-G.; Xie, H.-Y.; Liu, A.-A.; Lamb, D.C.; Pang, D.-W. Single-virus tracking: From imaging methodologies to virological applications. Chem. Rev. 2020, 120, 1936–1979. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Baulcombe, D.C.; Chapman, S.; Santa Cruz, S. Jellyfish green fluorescent protein as a reporter for virus infections. Plant J. 1995, 7, 1045–1053. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Wei, Y.; Han, X.; Wang, Z.; Gu, Q.; Li, H.; Chen, L.; Sun, B.; Shi, Y. Development of a GFP expression vector for Cucurbit chlorotic yellows virus. Virol. J. 2018, 15, 1–4. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Vasques, R.M.; Lacorte, C.; da Luz, L.L.; Aranda, M.A.; Nagata, T. Development of a new tobamovirus-based viral vector for protein expression in plants. Mol. Biol. Rep. 2019, 46, 97–103. [Google Scholar] [CrossRef] [Scilit]
- Sandra, N.; Jailani, A.A.K.; Jain, R.K.; Mandal, B. Development of Soybean Yellow Mottle Mosaic Virus-Based Expression Vector for Heterologous Protein Expression in French Bean. Mol. Biotechnol. 2019, 61, 181–190. [Google Scholar] [CrossRef] [Scilit]
- Ehrengruber, M.U.; Lundstrom, K.; Schweitzer, C.; Heuss, C.; Schlesinger, S.; Gähwiler, B.H. Recombinant Semliki Forest virus and Sindbis virus efficiently infect neurons in hippocampal slice cultures. Proc. Natl. Acad. Sci. USA 1999, 96, 7041–7046. [Google Scholar] [CrossRef] [Scilit]
- Verbeek, M.; Dullemans, A.M.; Van den Heuvel, J.; Maris, P.C.; Van der Vlugt, R.A.A. Identification and characterisation of tomato torrado virus, a new plant picorna-like virus from tomato. Arch. Virol. 2007, 152, 881. [Google Scholar] [CrossRef] [Scilit]
- Bally, J.; Jung, H.; Mortimer, C.; Naim, F.; Philips, J.G.; Hellens, R.; Bombarely, A.; Goodin, M.M.; Waterhouse, P.M. The rise and rise of Nicotiana benthamiana: A plant for all reasons. Annu. Rev. Phytopathol. 2018, 56, 405–426. [Google Scholar] [CrossRef] [Scilit]
- Verbeek, M.; van Bekkum, P.J.; Dullemans, A.M.; van der Vlugt, R.A.A. Torradoviruses are transmitted in a semi-persistent and stylet-borne manner by three whitefly vectors. Virus Res. 2014, 186, 55–60. [Google Scholar] [CrossRef] [Scilit]
- Budziszewska, M.; Obrepalska-Steplowska, A.; Wieczorek, P.; Pospieszny, H. The nucleotide sequence of a Polish isolate of Tomato torrado virus. Virus Genes 2008, 37. [Google Scholar] [CrossRef] [Scilit]
- Ferriol, I.; Turina, M.; Zamora-Macorra, E.J.; Falk, B.W. RNA1-independent replication and GFP expression from Tomato marchitez virus isolate M cloned cDNA. Phytopathology 2016, 106, 500–509. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Ferriol, I.; Vallino, M.; Ciuffo, M.; Nigg, J.C.; Zamora-Macorra, E.J.; Falk, B.W.; Turina, M. The Torradovirus-specific RNA2-ORF1 protein is necessary for plant systemic infection. Mol. Plant Pathol. 2018, 19, 1319–1331. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Wieczorek, P.; Wrzesińska, B.; Frackowiak, P.; Przybylska, A.; Obrȩpalska-Stȩplowska, A. Contribution of Tomato torrado virus Vp26 coat protein subunit to systemic necrosis induction and virus infectivity in Solanum lycopersicum 06 Biological Sciences 0607 Plant Biology. Virol. J. 2019, 16. [Google Scholar] [CrossRef] [Scilit]
- Wieczorek, P.; Obrepalska-Steplowska, A. A single amino acid substitution in movement protein of tomato torrado virus influences ToTV infectivity in Solanum lycopersicum. Virus Res. 2016, 213, 32–36. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Wieczorek, P.; Obrępalska-Stęplowska, A. The N-terminal fragment of the tomato torrado virus RNA1-encoded polyprotein induces a hypersensitive response (HR)-like reaction in Nicotiana benthamiana. Arch. Virol. 2016, 161. [Google Scholar] [CrossRef] [Scilit]
- Zarzyńska-Nowak, A.; Ferriol, I.; Falk, B.W.; Borodynko-Filas, N.; Hasiów-Jaroszewska, B. Construction of Agrobacterium tumefaciens-mediated tomato black ring virus infectious cDNA clones. Virus Res. 2017, 230, 59–62. [Google Scholar] [CrossRef] [Scilit]
- Matsumura, E.E.; Coletta-Filho, H.D.; Machado, M.A.; Nouri, S.; Falk, B.W. Rescue of Citrus sudden death-associated virus in Nicotiana benthamiana plants from cloned cDNA: Insights into mechanisms of expression of the three capsid proteins. Mol. Plant Pathol. 2019, 20, 611–625. [Google Scholar] [CrossRef] [Scilit]
- Green, M.R.; Hughes, H.; Sambrook, J.; MacCallum, P. Molecular cloning: A laboratory manual. In Molecular Cloning: A Laboratory Manual; Cold Spring Harbor Laboratory Press: Cold Spring Harbor, NY, USA, 2012; p. 1890. [Google Scholar]
- Wieczorek, P.; Budziszewska, M.; Obrępalska-Stęplowska, A. Construction of infectious clones of tomato torrado virus and their delivery by agroinfiltration. Arch. Virol. 2014, 160. [Google Scholar] [CrossRef] [Scilit]
- Ferriol, I.; Silva Junior, D.M.; Nigg, J.C.; Zamora-Macorra, E.J.; Falk, B.W. Identification of the cleavage sites of the RNA2-encoded polyproteins for two members of the genus Torradovirus by N-terminal sequencing of the virion capsid proteins. Virology 2016, 498, 109–115. [Google Scholar] [CrossRef] [Scilit]
- Budziszewska, M.; Pospieszny, H.; Obrępalska-Stęplowska, A. Genome Characteristics, Phylogeny and Varying Host Specificity of Polish Kra and Ros Isolates of Tomato torrado virus. J. Phytopathol. 2016, 164, 281–285. [Google Scholar] [CrossRef] [Scilit]
- Wieczorek, P.; Obrepalska-Steplowska, A. Multiplex RT-PCR reaction for simultaneous detection of tomato torrado virus and pepino mosaic virus co-infecting Solanum lycopersicum. J. Plant Prot. Res. 2013, 53, 289–294. [Google Scholar] [CrossRef] [Scilit]
- Gong, Y.-N.; Tang, R.-Q.; Zhang, Y.; Peng, J.; Xian, O.; Zhang, Z.-H.; Zhang, S.-B.; Zhang, D.-Y.; Liu, H.; Luo, X.-W. The NIa-Protease Protein Encoded by the Pepper Mottle Virus Is a Pathogenicity Determinant and Releases DNA Methylation of Nicotiana benthamiana. Front. Microbiol. 2020, 11, 102. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Shi, X.; Cordero, T.; Garrigues, S.; Marcos, J.F.; Daròs, J.; Coca, M. Efficient production of antifungal proteins in plants using a new transient expression vector derived from tobacco mosaic virus. Plant Biotechnol. J. 2019, 17, 1069–1080. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Ibrahim, A.; Odon, V.; Kormelink, R. Plant viruses in plant molecular pharming: Towards the use of enveloped viruses. Front. Plant Sci. 2019, 10, 803. [Google Scholar] [CrossRef] [Scilit]
- Almazán, F.; González, J.M.; Pénzes, Z.; Izeta, A.; Calvo, E.; Plana-Durán, J.; Enjuanes, L. Engineering the largest RNA virus genome as an infectious bacterial artificial chromosome. Proc. Natl. Acad. Sci. USA 2000, 97, 5516–5521. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Choi, I.-R.; French, R.; Hein, G.L.; Stenger, D.C. Fully biologically active in vitro transcripts of the eriophyid mite-transmitted wheat streak mosaic tritimovirus. Phytopathology 1999, 89, 1182–1185. [Google Scholar] [CrossRef] [Scilit]
- Hellens, R.P.; Edwards, E.A.; Leyland, N.R.; Bean, S.; Mullineaux, P.M. pGreen: A versatile and flexible binary Ti vector for Agrobacterium-mediated plant transformation. Plant Mol. Biol. 2000, 42, 819–832. [Google Scholar] [CrossRef] [Scilit]






| Primer Name | Sequence 5′→3′ | Purpose |
|---|---|---|
| pJL89ToT1_R | TATATTCTCAAAATAACTCTTTTAACCTCTCCAAATGAAATGAACTTCC | Amplification of plasmid backbone for cloning of cDNA copy of the ToTV-Kra RNA1 |
| pJL89ToT1i2_F | TTTAAAAAAAAAAAAAAAAAAAAAAAAAGGGTCGGCATGGCATCTC | |
| pJL89ToT2_R | TATTGTATAAAATTATTCTTTTAAACCTCTCCAAATGAAATGAACTTCC | Amplification of plasmid backbone for cloning of cDNA copy of the ToTV-Kra RNA2 |
| pJL89ToT1i2_F | TTTAAAAAAAAAAAAAAAAAAAAAAAAAGGGTCGGCATGGCATCTC | |
| asTo1A_pJL_FW | TTTCATTTGGAGAGGTTAAAAGAGTTATTTTGAGAATATAAC | Amplification of cDNA copy of ToTV RNA1 |
| asTo2C_pJL_RV | ATGCCATGCCGACCCTTTTTTTTTTTTTTTTTTTTTTTTTAAAAT | |
| asTo2A_pJL_FW | TTTCATTTGGAGAGGTTTAAAAGAATAATTTTATACAATATTTATGT | Amplification of cDNA copy of ToTV RNA2 |
| asTo2C_pJL_RV | ATGCCATGCCGACCCTTTTTTTTTTTTTTTTTTTTTTTTTAAAAT | |
| pJLRNA2_CASF4 | AGCAAGACAGCGCTTCTATAAAGAAGCAGCGAAAGCGCAAGTGAAAAACAAGGTGGCCCAAAC | Preparation ToTV-Kra copy of RNA2 variant with duplicated protease recognition site |
| pJLRNA_CASR4 | GGAATCTCCTCGACGGAGGTCTGCGCTACTTTATTCTTAACCTGAGCCTTGGCCGCCTC | |
| EGFP_CASF3 | ACCTCCGTCGAGGAGATTCCGTCAACGAGCTTTGCGACCATGGTGAGCAAGGGCGAG | Amplification of sGFP coding sequence |
| EGFP_CASR3 | TATAGAAGCGCTGTCTTGCTTGCTCTTTCGCTACGCGTTCCTTGTACAGCTCGTCCAT | |
| 2TT5 | GATGAGAAAGGAAAGAAGCAG | Reverse transcription-polymerase chain reaction (RT-PCR) for detection of ToTV variants in plants |
| 2TT6 | CATATCACCCAAATGCTTCTC | |
| 3A/Vp35seqF | CCCTTTGATTGTTATGATGGCTT | |
| 3A/Vp35seqR | TGGGCCTTACAGCTTCATTG | |
| GFP_F | ATGGTGAGCAAGGGCGAG | |
| GFP_R | CTTGTACAGCTCGTCC |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2020 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Wieczorek, P.; Budziszewska, M.; Frąckowiak, P.; Obrępalska-Stęplowska, A. Development of a New Tomato Torrado Virus-Based Vector Tagged with GFP for Monitoring Virus Movement in Plants. Viruses 2020, 12, 1195. https://doi.org/10.3390/v12101195
Wieczorek P, Budziszewska M, Frąckowiak P, Obrępalska-Stęplowska A. Development of a New Tomato Torrado Virus-Based Vector Tagged with GFP for Monitoring Virus Movement in Plants. Viruses. 2020; 12(10):1195. https://doi.org/10.3390/v12101195
Chicago/Turabian StyleWieczorek, Przemysław, Marta Budziszewska, Patryk Frąckowiak, and Aleksandra Obrępalska-Stęplowska. 2020. "Development of a New Tomato Torrado Virus-Based Vector Tagged with GFP for Monitoring Virus Movement in Plants" Viruses 12, no. 10: 1195. https://doi.org/10.3390/v12101195
APA StyleWieczorek, P., Budziszewska, M., Frąckowiak, P., & Obrępalska-Stęplowska, A. (2020). Development of a New Tomato Torrado Virus-Based Vector Tagged with GFP for Monitoring Virus Movement in Plants. Viruses, 12(10), 1195. https://doi.org/10.3390/v12101195

